Abstract
Gemcitabine is a cytotoxic cytidine analog, which is widely used in anti-cancer therapy. One mechanism by which gemcitabine acts is by inhibiting nucleotide excision repair (NER). Recently NER was implicated in Gadd45 mediated DNA demethylation and epigenetic gene activation. Here we analyzed the effect of gemcitabine on DNA demethylation. We find that gemcitabine inhibits specifically Gadd45a mediated reporter gene activation and DNA demethylation, similar to the topoisomerase I inhibitor camptothecin, which also inhibits NER. In contrast, base excision repair inhibitors had no effect on DNA demethylation. In Xenopus oocytes, gemcitabine inhibits DNA repair synthesis accompanying demethylation of oct4. In mammalian cells, gemcitabine induces DNA hypermethylation and silencing of MLH1. The results indicate that gemcitabine induces epigenetic gene silencing by inhibiting repair mediated DNA demethylation. Thus, gemcitabine can function epigenetically and provides a tool to manipulate DNA methylation.
Introduction
Gemcitabine (2′deoxy-2′2′-difluorocytidine monohydrochloride, GEMZAR) is one of the most widely used anti-cancer drugs and is particularly effective against solid tumors [1]. Pioneering work from the Plunkett laboratory showed that gemcitabine is a pro-drug, which after intracellular uptake is metabolized to gemcitabine diphosphate and triphosphate, whose incorporation into DNA results in chain termination by inhibiting DNA polymerase activity [2], [3]. Unlike its analog cytosine arabinoside, which causes immediate termination of DNA polymerization, gemcitabine allows limited nucleotide polymerization by a process termed masked chain termination, which prevents exonucleases from excising the aberrant gemcitabine nucleotide [4], [5]. Incorporated gemcitabine can be recognized by p53 and DNA dependent protein kinase, which may induce apoptosis [6]. Gemcitabine also potently inhibits ribonucleotide reductase, resulting in a decrease of competing deoxyribonucleotide pools necessary for DNA synthesis [5], [7], [8]. Thus, gemcitabine inhibits DNA synthesis by at least two different modes. Gemcitabine can also induce increased ligase I levels [9].
Gemcitabine is frequently used in combination with cisplatin, which forms DNA adducts, that can be repaired by nucleotide excision repair (NER). The synergistic action of both drugs is thought to reside in an inhibitory effect of gemcitabine on the repair of the DNA lesions induced by cisplatin [10], [11], [12]. The current model is that gemcitabine inhibits DNA repair synthesis, which is an obligatory step in NER and thereby potentiates cisplatin effects.
Recently, we have implicated NER in the removal of 5′-methylcytosine (5mC) from DNA during active DNA demethylation [13]. In DNA of metazoa, 5mC is a common epigenetic mark associated with gene silencing, which can be reversed by active DNA demethylation. We showed that Growth Arrest and DNA Damage inducible protein 45 a (Gadd45a) is a key mediator of active DNA demethylation [13]. Gadd45a binds directly to and requires the activity of Xeroderma pigmentosum complementation group protein G (XPG), a 3′endonuclease of the NER complex. We therefore suggested a model where Gadd45a is targeted to specific sites of demethylation and recruits the DNA repair machinery. Methylated cytosines are then excised and replaced by unmethylated nucleotides [13].
Since gemcitabine inhibits NER, it was of interest if it also affects DNA methylation. Here we tested this possibility and find that gemcitabine inhibits specifically Gadd45a mediated reporter gene activation. Moreover, gemcitabine inhibits unscheduled DNA synthesis in methylated oct4 plasmid in Xenopus oocytes. Finally, it induces hypermethylation and inhibits expression of MLH1. The results therefore indicate a new epigenetic mode of gemcitabine action.
Results and Discussion
We first examined gemcitabine along with other cytotoxic drugs in a methylation sensitive reporter assay, where we monitored Gadd45a-mediated re-activation of an in vitro methylated – and hence silenced - Gal-responsive luciferase reporter plasmid [13]. The Gal4 reporter system is based on the ability of GAL4-Elk1 fusion protein to specifically bind and activate a Gal4 driven luciferase gene [14], [15]. Camptothecin and β-lapachone are inhibitors of topoisomerase I, an enzyme required during DNA repair [16]. Etoposide and merbarone are inhibitors of topoisomerase II, which is not involved in NER or base excision repair (BER) [17], [18].
All three DNA repair inhibitors, gemcitabine, camptothecin and β-lapachone inhibited Gadd45a-mediated activation of the reporter (Fig. 1A). In contrast, the topoisomerase II inhibitors etoposide and merbarone had little effect. Importantly, activation of the same methylated reporter plasmid by the transcriptional activator Gal-Elk1 (Fig. 1B) as well as activation of the cotransfected Renilla luciferase reporter plasmid used for normalization (not shown), were unaffected by the DNA repair inhibitors, ruling out unspecific inhibitory effects of these compounds on transcription and/or translation. Furthermore, an in vitro methylated EGFP reporter plasmid under the control of the oct4 regulatory region fused to the thymidine kinase promoter was transcriptionally activated by Gadd45a as monitored by the re-expression of EGFP (Fig. 1C). This re-activation was also impaired by gemcitabine treatment.
To directly test if this transcriptional repression by gemcitabine is indeed due to DNA hypermethylation, we monitored methylation levels using methylation sensitive Southern blotting. Untransfected in vitro methylated reporter plasmid was expectedly resistant to the methylation sensitive restriction enzyme HpaII, but digested by the methylation insensitive isoschizomer MspI (Fig. 2A). Following transfection, the reporter was mostly HpaII insensitive, while its co-transfection with Gadd45a induced HpaII sensitivity, indicating DNA demethylation. Treatment with gemcitabine impaired this demethylation.
To independently corroborate these results, we employed bisulfite sequencing. We first confirmed that the reporter was initially fully methylated (Fig. S1). Sequencing of the reporter recovered from transfected cells revealed, interestingly, some spontaneous demethylation. Gadd45a overexpression induced substantial demethylation of the EGFP reporter, most pronounced (two-fold) at the site -299 (Fig. 2B). Importantly, gemcitabine treatment reversed this effect resulting in methylation levels comparable to control without Gadd45, and also reduced endogenous demethylation. These results supports that gemcitabine inhibits Gadd45a mediated DNA demethylation. Furthermore, since endogenous demethylation is also gemcitabine sensitive this may involve endogenous Gadd45a and NER.
Besides NER, a base excision repair-based mechanism (BER) has been implicated in active DNA demethylation in mammalian cells [19], [20], [21]. Moreover, Gadd45a may also affect BER in addition to its effect on NER [19], [22]. Since BER also requires DNA synthesis, the question arose if gemcitabine may function as a BER inhibitor. We therefore tested bona fide BER inhibitors. CRT 0044876 (CRT) and betulinic acid (Bet) are inhibitors of AP Endonuclease I, [23] and DNA Polymerase β [24], respectively, both of which are key enzymes in BER. Furthermore, ABT-888 (ABT) blocks PARP-1, a sensor of single and double strand breaks during BER [25]. Remarkably, none of these compounds affected Gadd45a mediated demethylation of the pOctTK-EGFP reporter as assessed by methylation sensitive PCR (Fig. 3). This suggests that BER does not play a role in Gadd45a mediated demethylation, at least in this context. Under the same conditions, camptothecin (Cpt) as well as gemcitabine (Gem) blocked the Gadd45a induced DNA demethylation as well as endogenous demethylation, again supporting a NER model for Gadd45a demethylation.
DNA demethylation can theoretically also occur in a passive manner if the reporter plasmid is repetitively replicated. To experimentally rule out this scenario in our reporter system, we performed methylation sensitive PCR assaying the bacterial methylation state of the transfected plasmid (Fig. S2). A single ClaI recognition site in the backbone of pOctTK-EGFP is also target for bacterial Dam methylation. Bacterial Dam methylation blocks ClaI restriction at this site. During replication in eukaryotic cells, the bacterial methylation would be diluted if the plasmid was replicating and would gain ClaI sensitivity. While the reporter from dam− cells was sensitive to ClaI, the pOctTK-EGFP from dam + E.coli remained resistant to ClaI digest 65 h after transfection and thus was not replicated in the transfected cells. Hence, Gadd45 mediated demethylation is replication-independent and therefore active.
We showed previously that Gadd45a is required for DNA demethylation of the oct4 promoter in Xenopus oocytes. This demethylation is accompanied by unscheduled DNA repair synthesis, since Bromo-deoxyuridine (BrdU) is incorporated into methylated but not unmethylated oct4 plasmid [13]. Xenopus oocytes are resting cells, and hence BrdU incorporation cannot be due to replication but rather be related to DNA repair processes. We therefore tested if this unscheduled DNA repair synthesis is sensitive to gemcitabine. BrdU was coinjected in oocytes with methylated oct4 plasmid with or without gemcitabine. After 0, 12, or 36 h, plasmid DNA was immunoprecipitated with anti-BrdU antibodies and analyzed by PCR. The amount of PCR product obtained is a measure of BrdU incorporation and hence, DNA synthesis. In control samples, a progressive PCR product increase is observed with time (Fig. 4, lanes 2–4) [13]. Significantly, gemcitabine treatment almost completely abolished this BrdU incorporation (lanes 6–8). This result suggests that gemcitabine inhibits DNA repair synthesis associated with DNA demethylation. As a caveat, we cannot rule out the possibility that the reduced PCR product after BrdU immunoprecipitation is due to an inhibitory effect of Gemcitabine or its metabolites on Taq DNA polymerase. However, our data obtained by various methods (methylation-sensitive PCR, Southern blotting, bisulfite sequencing) argue that the effects of gemcitabine are rather due to inhibition of DNA repair.
Next, we analyzed the effect of gemcitabine on methylation of endogenous loci and first examined global methylation levels. The bulk of 5mC in the genome is associated with telomeres and repetitive DNA, rather than transcribed genes. As cancer is often associated with global DNA hypomethylation, in particular hypomethylated chromosome 1 satellite 2 repetitive elements (C1S2) [26], [27], we analyzed the effect of gemcitabine on the methylation of these elements. Gemcitabine did not alter C1S2 methylation in HEK293 or MCF7 cells at any tested concentration or at any time point analyzed (18–42 h after treatment, data not shown) (Fig. 5A–B). This was surprising, since we previously reported that Gadd45a induces C1S2 demethylation and global hypomethylation. However, using improved experimental conditions we now found that Gadd45a overexpression does not induce significant C1S2 demethylation or global hypomethylation in HCT116 cells, unlike the demethylating drug 5-aza-2′-deoxycytidine (AZA) (Fig. 5C–D). Rather, the major demethylation effect of Gadd45 appears to be restricted to single copy genes ([19], [28], [29] and our unpublished data).
We therefore analyzed the effect of gemcitabine on DNA methylation of an endogenous single-copy gene. The promoter of MLH1 is a well studied methylation regulated gene which is kept partially unmethylated by Gadd45a [13]. Treating HEK293 and MCF7 cells with increasing amounts of gemcitabine led to a significant hypermethylation of the MLH1 promoter as assessed by methylation-sensitive PCR (Fig. 6A). This increase in methylation was accompanied by reduced MLH1 expression (Fig. 6B). In contrast, etoposide was without significant effect.
Epigenetic therapy is becoming an increasingly important strategy for cancer treatment since cancer cells show genome wide epigenetic alterations. For example, many tumor suppressor genes are hypermethylated while the bulk of the genome is hypomethylated [30], [31]. However, clinical drugs affecting DNA methylation are limited to 5-azacytidine (Vidaza) and its derivative 5-aza-2′-deoxycytidine (decitabine, Dacogen), both of which induce DNA hypomethylation (reviewed in [32]). Previously it was shown that a number of cytotoxic anticancer drugs which block DNA replication induce DNA hypermethylation. It was proposed that this effect is due to methylation of CpGs at stalled replication forks, which would normally not be methylated [33], [34]. However, the doses required in these experiments were in the micro- to millimolar range, and thus 1000x higher than the doses used in our experiments. Therefore the physiological- or clinical relevance of this “cytotoxic hypermethylation” effect is unclear. Unlike “cytotoxic hypermethylation”, gemcitabine did not affect global DNA methylation and did not markedly inhibit cell proliferation at the doses used in our experiments (data not shown).
Our results rather support a model where gemcitabine functions by inhibiting NER and thereby DNA demethylation, thus leading to gene silencing. We therefore propose that gemcitabine besides its various known effects also acts as an epigenetic drug on DNA methylation, which has consequences for the understanding of its effect in cancer therapy. For example, MLH1 is a tumor suppressor and the fact that its expression is silenced by gemcitabine may be an undesirable effect in cancer treatment. More generally, gemcitabine may be a useful tool to specifically interfere with Gadd45 mediated DNA demethylation in biological processes ranging from embryonic gene activation to adult neurogenesis [19], [29].
Materials and Methods
Tissue culture and transfection
HEK293, HEK293T, MCF7 and RKO cells (ATCC numbers: CRL-1573, CRL-11268, HTB-22, CRL-2577, respectively) were grown at 37°C in 10% CO2 (5% CO2 for RKO cells) in Dulbecco's Modified Eagle's Medium (DMEM), 10% fetal calf serum, 2 mM L-Glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. HCT116 cells (ATCC number: CCL-247) were cultured at 37°C under 10% CO2 in McCoy's 5A medium supplemented as described above. Transient DNA transfections were carried out using FuGENE6 (Roche) following the manufacturer instructions. For MLH1 and C1S2 methylation analysis, cells were treated with 34, 67 or 134 nM gemcitabine (Eli Lilly) or 43 nM etoposide (Sigma Aldrich) for 18 h or with 500 nM 5-aza-2′-deoxycytidine (AZA, Sigma) for 42 h before harvesting. For methylation-sensitive Southern blotting and bisulfite sequencing, cells were transfected on 10 cm dishes with 1.2 µg pBl-KS control plasmid or Gadd45a along with pOctTK-EGFP. 3 h after transfection, cells were treated with 134 nM gemcitabine for 65 h. For methylation-sensitive PCR of pOctTK-EGFP at HpaII site −299, cells were transfected in 6-well dishes with 100 ng pBl-KS control plasmid or hGadd45a along with 200 ng pOctTK-EGFP using Turbofect transfection reagent (Fermentas) following the manufacturer instructions. Immediately after transfection, cells were treated with 50, 100 or 150 nM gemcitabine, 15, 25 or 50 nM camptothecin (MP Biomedicals), 50, 100 or 200 µM CRT 0044876 (Sigma Aldrich), 1, 5 or 10 µM betulinic acid (Sigma Aldrich), 5, 10 or 20 µM ABT-888 (Tebu Bio) or 10, 20 or 40 nM etoposide (Sigma Aldrich) for 48 h.
Luciferase reporter assay
Dual-Luciferase reporter assays (Promega) were performed 40 h after transient DNA transfection of HEK293T cells in 96-well plates with a total of 110 ng DNA per well, containing 5 ng firefly luciferase reporter, 5 ng pBS or 5 ng Xenopus tropicalis Gadd45a plasmid, 0.1 ng Renilla luciferase reporter plasmid and 100 ng pBS. Reporter plasmids were produced in the dam −/dcm − bacteria strain SCS110 and in vitro methylated using the HpaII- and HhaI-methylase. Transfections were performed in triplicate. Where indicated, cells were treated with 67 nM gemcitabine, 26 nM camptothecin (MP Biomedicals), 43 nM etoposide (Sigma-Aldrich), 30 nM β-lapachone (Calbiochem) or 20 nM merbarone (Calbiochem) for 18 h. Results are shown as the mean of triplicates and error bars indicate standard deviation. Experiments were repeated three times.
Quantitative RT-PCR (qPCR)
RNA was isolated using the RNeasy Kit (Qiagen) and reverse transcribed with the SuperScript II reverse transcriptase (Invitrogen). Real-Time PCR was performed using Roche LightCycler480 probes master and primers in combination with predesigned mono-color hydrolysis probes of the Roche Universal probe library (UPL). The following primers and UPL probes were designed at https://www.roche-applied-science.com/sis/rtpcr/upl/adc.jsp. hMLH1 forward 5′- GAATGCGCTATGTTCTATTCCA, reverse 5′-ATGGAGCCAGGCACTTCA, UPL probe #38. For quantification Roche LC480 relative quantification software module was used. All values were normalized to the level of the housekeeping gene GAPDH.
Analysis of DNA methylation
Genomic DNA (gnDNA) from treated cells or transfected reporter plasmids were prepared using the Blood & Tissue kit (Qiagen). The DNA was split into three parts and either digested with PvuII, HpaII or its methylation insensitive isoschizomer MspI. Methylation was determined by comparing HpaII digested versus PvuII control digested DNA samples via qPCR using methylation sensitive PCR primers (HpaII hMLH1 forward, 5′- CCTCAGCAGAGGCACACA; reverse, 5′- CGGGGAATACGAAATATCCA in combination with SYBR green; HpaII pOctTK -299 forward, 5′- ATAACCAGCCACCTTGATCTG; reverse, 5′- ATTCGCCAATGACAAGACG in combination with Roche UPL probe #39). As internal normalization control, a PCR using methylation insensitive primers (for gnDNA: forward, 5′-CTCCAACTCAGGGCCTACAC; reverse, 5′-CCAGGCTTTTGTGGCCTAT in combination with SYBR green; for pOctTK plasmid: forward, 5′-ACTGCATCTCCCTTTCCTTGT; reverse, 5′-GCCCCCTGCAAGTCTTTT in combination with Roche UPL probe #137) was performed (data not shown). MspI digest served as control for an intact restriction enzyme recognition site. To control for complete HpaII digest, amplification of the promoter of the unmethylated GAPDH housekeeping gene containing two HpaII sites (data not shown) or the unmethylated reporter plasmid was performed.
COBRA was performed as described [35]. Genomic DNA methylation levels were determined by capillary electrophoretic analysis, as described [36].
Methylation-sensitive Southern blotting was performed as described previously [13]. For bisulfite sequencing, the transfected pOctTK-EGFP reporter plasmid was recovered from the cells using alkaline lysis as described [37], subjected to another round of purification using the DNA MiniPrep Kit (Qiagen). The recovered plasmid DNA was linearized by NotI restriction digest and 500 ng DNA were bisulfite converted using the Epitect Kit (Qiagen). 2.5 µl of the converted DNA was used as template for PCR amplification using Accuprime Taq DNA polymerase (Invitrogen) and the following primers: forward, 5′ GATTTGTTTTGTAGGTGGAGAGTTT; reverse, AAATAAACTTCAAAATCAACTTACC. The PCR product was cloned using the TA cloning kit (Invitrogen) and single clones sent for sequencing. The experiment was reproduced three times with very similar results.
BrdU incorporation in Xenopus oocytes
BrdU incorporation assays were performed essentially as described [13]. 5 fmol gemcitabine was injected with 5 pmol BrdU and 10 pg HpaII/HhaI in vitro methylated oct4 plasmid. Plasmid DNA was recovered from oocytes harvested 0, 12 or 36 h after injection. BrdU-labeled control DNA (BrdU-Luc) generated by nick-translation was added during lysis to monitor the immunoprecipitation.
Supporting Information
Acknowledgments
We thank N. Giese, D. Mayer and H. Schöler for reagents. We thank Frank Lyko and Sabine Hagemann for help with capillary electrophoresis.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was funded by the Deutsche Forschungsgemeinschaft (NI 286/12-1). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Toschi L, Finocchiaro G, Bartolini S, Gioia V, Cappuzzo F. Role of gemcitabine in cancer therapy. Future Oncol. 2005;1:7–17. doi: 10.1517/14796694.1.1.7. [DOI] [PubMed] [Google Scholar]
- 2.Heinemann V, Hertel LW, Grindey GB, Plunkett W. Comparison of the cellular pharmacokinetics and toxicity of 2′,2′-difluorodeoxycytidine and 1-beta-D-arabinofuranosylcytosine. Cancer Res. 1988;48:4024–4031. [PubMed] [Google Scholar]
- 3.Heinemann V, Schulz L, Issels RD, Plunkett W. Gemcitabine: a modulator of intracellular nucleotide and deoxynucleotide metabolism. Semin Oncol. 1995;22:11–18. [PubMed] [Google Scholar]
- 4.Bouffard DY, Momparler LF, Momparler RL. Comparison of antineoplastic activity of 2′,2′-difluorodeoxycytidine and cytosine arabinoside against human myeloid and lymphoid leukemic cells. Anticancer Drugs. 1991;2:49–55. doi: 10.1097/00001813-199102000-00007. [DOI] [PubMed] [Google Scholar]
- 5.Huang P, Chubb S, Hertel LW, Grindey GB, Plunkett W. Action of 2′,2′-difluorodeoxycytidine on DNA synthesis. Cancer Res. 1991;51:6110–6117. [PubMed] [Google Scholar]
- 6.Achanta G, Pelicano H, Feng L, Plunkett W, Huang P. Interaction of p53 and DNA-PK in response to nucleoside analogues: potential role as a sensor complex for DNA damage. Cancer Res. 2001;61:8723–8729. [PubMed] [Google Scholar]
- 7.Heinemann V, Xu YZ, Chubb S, Sen A, Hertel LW, et al. Inhibition of ribonucleotide reduction in CCRF-CEM cells by 2′,2′-difluorodeoxycytidine. Mol Pharmacol. 1990;38:567–572. [PubMed] [Google Scholar]
- 8.Baker CH, Banzon J, Bollinger JM, Stubbe J, Samano V, et al. 2′-Deoxy-2′-methylenecytidine and 2′-deoxy-2′,2′-difluorocytidine 5′-diphosphates: potent mechanism-based inhibitors of ribonucleotide reductase. J Med Chem. 1991;34:1879–1884. doi: 10.1021/jm00110a019. [DOI] [PubMed] [Google Scholar]
- 9.Sun D, Urrabaz R, Kelly S, Nguyen M, Weitman S. Enhancement of DNA ligase I level by gemcitabine in human cancer cells. Clin Cancer Res. 2002;8:1189–1195. [PubMed] [Google Scholar]
- 10.Yang LY, Li L, Jiang H, Shen Y, Plunkett W. Expression of ERCC1 antisense RNA abrogates gemicitabine-mediated cytotoxic synergism with cisplatin in human colon tumor cells defective in mismatch repair but proficient in nucleotide excision repair. Clin Cancer Res. 2000;6:773–781. [PubMed] [Google Scholar]
- 11.Moufarij MA, Phillips DR, Cullinane C. Gemcitabine potentiates cisplatin cytotoxicity and inhibits repair of cisplatin-DNA damage in ovarian cancer cell lines. Mol Pharmacol. 2003;63:862–869. doi: 10.1124/mol.63.4.862. [DOI] [PubMed] [Google Scholar]
- 12.Crul M, van Waardenburg RC, Bocxe S, van Eijndhoven MA, Pluim D, et al. DNA repair mechanisms involved in gemcitabine cytotoxicity and in the interaction between gemcitabine and cisplatin. Biochem Pharmacol. 2003;65:275–282. doi: 10.1016/s0006-2952(02)01508-3. [DOI] [PubMed] [Google Scholar]
- 13.Barreto G, Schafer A, Marhold J, Stach D, Swaminathan SK, et al. Gadd45a promotes epigenetic gene activation by repair-mediated DNA demethylation. Nature. 2007;445:671–675. doi: 10.1038/nature05515. [DOI] [PubMed] [Google Scholar]
- 14.Marais R, Wynne J, Treisman R. The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell. 1993;73:381–393. doi: 10.1016/0092-8674(93)90237-k. [DOI] [PubMed] [Google Scholar]
- 15.Sadowski I, Ptashne M. A vector for expressing GAL4(1-147) fusions in mammalian cells. Nucleic Acids Res. 1989;17:7539. doi: 10.1093/nar/17.18.7539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Liu LF, Desai SD, Li TK, Mao Y, Sun M, et al. Mechanism of action of camptothecin. Ann N Y Acad Sci. 2000;922:1–10. doi: 10.1111/j.1749-6632.2000.tb07020.x. [DOI] [PubMed] [Google Scholar]
- 17.Larsen AK, Escargueil AE, Skladanowski A. Catalytic topoisomerase II inhibitors in cancer therapy. Pharmacol Ther. 2003;99:167–181. doi: 10.1016/s0163-7258(03)00058-5. [DOI] [PubMed] [Google Scholar]
- 18.Downes CS, Mullinger AM, Johnson RT. Action of etoposide (VP-16-123) on human cells: no evidence for topoisomerase II involvement in excision repair of u.v.-induced DNA damage, nor for mitochondrial hypersensitivity in ataxia telangiectasia. Carcinogenesis. 1987;8:1613–1618. doi: 10.1093/carcin/8.11.1613. [DOI] [PubMed] [Google Scholar]
- 19.Rai K, Huggins IJ, James SR, Karpf AR, Jones DA, et al. DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and gadd45. Cell. 2008;135:1201–1212. doi: 10.1016/j.cell.2008.11.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kangaspeska S, Stride B, Metivier R, Polycarpou-Schwarz M, Ibberson D, et al. Transient cyclical methylation of promoter DNA. Nature. 2008;452:112–115. doi: 10.1038/nature06640. [DOI] [PubMed] [Google Scholar]
- 21.Hajkova P, Jeffries SJ, Lee C, Miller N, Jackson SP, et al. Genome-wide reprogramming in the mouse germ line entails the base excision repair pathway. Science. 329:78–82. doi: 10.1126/science.1187945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Jung HJ, Kim EH, Mun JY, Park S, Smith ML, et al. Base excision DNA repair defect in Gadd45a-deficient cells. Oncogene. 2007;26:7517–7525. doi: 10.1038/sj.onc.1210557. [DOI] [PubMed] [Google Scholar]
- 23.Madhusudan S, Smart F, Shrimpton P, Parsons JL, Gardiner L, et al. Isolation of a small molecule inhibitor of DNA base excision repair. Nucleic Acids Res. 2005;33:4711–4724. doi: 10.1093/nar/gki781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gao Z, Maloney DJ, Dedkova LM, Hecht SM. Inhibitors of DNA polymerase beta: activity and mechanism. Bioorg Med Chem. 2008;16:4331–4340. doi: 10.1016/j.bmc.2008.02.071. [DOI] [PubMed] [Google Scholar]
- 25.Horton TM, Jenkins G, Pati D, Zhang L, Dolan ME, et al. Poly(ADP-ribose) polymerase inhibitor ABT-888 potentiates the cytotoxic activity of temozolomide in leukemia cells: influence of mismatch repair status and O6-methylguanine-DNA methyltransferase activity. Mol Cancer Ther. 2009;8:2232–2242. doi: 10.1158/1535-7163.MCT-09-0142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Suzuki K, Suzuki I, Leodolter A, Alonso S, Horiuchi S, et al. Global DNA demethylation in gastrointestinal cancer is age dependent and precedes genomic damage. Cancer Cell. 2006;9:199–207. doi: 10.1016/j.ccr.2006.02.016. [DOI] [PubMed] [Google Scholar]
- 27.Qu G, Dubeau L, Narayan A, Yu MC, Ehrlich M. Satellite DNA hypomethylation vs. overall genomic hypomethylation in ovarian epithelial tumors of different malignant potential. Mutat Res. 1999;423:91–101. doi: 10.1016/s0027-5107(98)00229-2. [DOI] [PubMed] [Google Scholar]
- 28.Jin S, Guo C, Pfeifer G. GADD45A does not promote DNA demethylation. PloS Genet. 2008;4:1–9. doi: 10.1371/journal.pgen.1000013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ma DK, Jang MH, Guo JU, Kitabatake Y, Chang ML, et al. Neuronal activity-induced Gadd45b promotes epigenetic DNA demethylation and adult neurogenesis. Science. 2009;323:1074–1077. doi: 10.1126/science.1166859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Toyota M, Issa JP. CpG island methylator phenotypes in aging and cancer. Semin Cancer Biol. 1999;9:349–357. doi: 10.1006/scbi.1999.0135. [DOI] [PubMed] [Google Scholar]
- 31.Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–428. doi: 10.1038/nrg816. [DOI] [PubMed] [Google Scholar]
- 32.Stresemann C, Lyko F. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine. Int J Cancer. 2008;123:8–13. doi: 10.1002/ijc.23607. [DOI] [PubMed] [Google Scholar]
- 33.Nyce J. Drug-induced DNA hypermethylation and drug resistance in human tumors. Cancer Res. 1989;49:5829–5836. [PubMed] [Google Scholar]
- 34.Nyce JW. Drug-induced DNA hypermethylation: a potential mediator of acquired drug resistance during cancer chemotherapy. Mutat Res. 1997;386:153–161. doi: 10.1016/s1383-5742(96)00051-8. [DOI] [PubMed] [Google Scholar]
- 35.Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997;25:2532–2534. doi: 10.1093/nar/25.12.2532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Stach D, Schmitz OJ, Stilgenbauer S, Benner A, Dohner H, et al. Capillary electrophoretic analysis of genomic DNA methylation levels. Nucleic Acids Res. 2003;31:E2. doi: 10.1093/nar/gng002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wade-Martins R, Frampton J, James MR. Long-term stability of large insert genomic DNA episomal shuttle vectors in human cells. Nucleic Acids Res. 1999;27:1674–1682. doi: 10.1093/nar/27.7.1674. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.