Skip to main content
European Spine Journal logoLink to European Spine Journal
. 2010 Apr 2;19(9):1545–1550. doi: 10.1007/s00586-010-1385-y

Polymorphism in vitamin D receptor is associated with bone mineral density in patients with adolescent idiopathic scoliosis

Kuen Tak Suh 1, Il-Soo Eun 2, Jung Sub Lee 1,✉
PMCID: PMC2989276  PMID: 20361340

Abstract

Low bone mass and osteopenia have been reported in the axial and peripheral skeleton of adolescent idiopathic scoliosis (AIS) patients. Furthermore, several recent studies have shown that gene polymorphisms are related to osteoporosis. However, no study has yet linked polymorphisms in the vitamin D receptor (VDR) gene and bone mass in AIS. Accordingly, the authors examined the association between bone mass and VDR gene polymorphisms in 198 girls diagnosed with AIS. The VDR BsmI (rs1544410), FokI (rs2228670) and Cdx2 (rs11568820) polymorphisms and bone mineral density at the lumbar spine (LSBMD) and femoral neck (FNBMD) were analyzed and compared to their levels in healthy controls. Mean LSBMD and FNBMD in AIS patients were lower than in age- and sex-matched healthy controls (P = 0.0022 and P = 0.0013, respectively). A comparison of genotype frequencies in AIS patients and controls revealed a significant difference for the BsmI polymorphism only (P = 0.0054). Furthermore, a significant association was found between the VDR BsmI polymorphism and LSBMD. In particular, LSBMD in AIS patients with the AA genotype was found to be significantly lower than in patients with the GA (P < 0.05) or GG (P < 0.01) genotypes. However, no significant association was found between LSBMD or FNBMD and the VDR FokI or Cdx2 polymorphisms. These results suggest that the VDR BsmI polymorphism is associated with LSBMD in girls with AIS.

Keywords: Adolescent idiopathic scoliosis, Bone mineral density, Vitamin D receptor, Polymorphism

Introduction

The etiology and pathogenesis of adolescent idiopathic scoliosis (AIS) is unclear despite the large number of studies conducted. The cause of scoliosis is believed to be multifactorial due to the associations between the development of scoliosis and growth, hormonal secretion, gravity and others [1, 15, 16, 21, 26, 27, 33, 36, 43]. However, none of these parameters has been demonstrated to play a causative role in the development of AIS.

Burner et al. [5] first reported an association between osteopenia and idiopathic scoliosis using the Singh index. Generalized low bone mass and osteopenia in both the axial and peripheral skeletons have been reported in AIS [7, 8, 11, 13, 35, 38], and abnormal histomorphometric bone cell activity has been observed in AIS bone biopsies [9]. In addition, low bone mass is likely to persist through to adulthood in AIS patients [7], and there is increasing concern that adolescents with idiopathic scoliosis might have a lower peak bone mass, which would increase the risk of developing osteoporosis and related complications in later life [7, 8]. However, the precise mechanism and causes of bone loss in AIS have not been identified.

Osteoporosis is defined as a reduction in bone mass caused by a deterioration of the bone microarchitecture, which results in bone fragility and increases fracture risk. AIS is a complex disorder, which demonstrates interactions between environmental and genetic factors. In particular, genetic influences have been reported to account for 50–80% of inter-individual bone mineral density (BMD) variability. Furthermore, several genetic association studies have demonstrated relationships between polymorphisms of candidate genes and decreased BMD and fracture risk [14, 20, 30, 39, 40, 42].

1,25-Dihydroxyvitamin D3 (1,25(OH)2D3) plays a central role in skeletal metabolism by binding to its nuclear steroid receptor, vitamin D receptor (VDR). 1,25(OH)2D3 can stimulate bone formation and resorption by acting on osteoblastic and osteoclastic lineage cells and thus regulates bone turnover [4]. Some have shown associations between serum 25(OH)D3 status and BMD and osteoporotic fractures [10, 17], and that 25(OH)D3 inadequacies are associated with elevated risks of osteoporosis and osteoporotic fractures [18, 23].

Adolescence is a critical time for the acquisition of bone mass, around 40% of skeletal mass is acquired during pubertal maturation [32], and vitamin D is known to play an important role in this bone gain during adolescence. Moreover, it has been reported that pubertal girls with hypovitaminosis D are at risk of failing to achieve maximum peak bone mass [24], which suggests that the genes of any component of the vitamin D endocrine pathway are candidate loci of the osteoporosis gene. In addition, the VDR gene appears to play an important role in the genetic regulation of bone mass and in the pathogenesis of fractures.

Several investigators have evaluated the association between VDR gene polymorphisms and BMD in postmenopausal women, and a smaller number of studies have been conducted in children [2, 22, 25, 34, 37, 44]. However, no report has yet linked bone mass in AIS and a VDR gene polymorphism. Accordingly, we undertook to examine association between bone mass and VDR gene polymorphisms in girls with AIS.

Materials and methods

A total of 198 Korean girls (11–13 years of age), newly diagnosed with AIS at the authors’ institution, and 120 age-matched healthy girls were enrolled after applying the exclusion criteria detailed below. The following candidates were excluded: those who had received any type of treatment for scoliosis, those with a history of a congenital deformity, a neuromuscular disease, an endocrine disease, skeletal dysplasia or a connective tissue abnormality, those with mental retardation or psychiatric disease, and those who had taken medication known to affect bone metabolism. All subjects and parents provided informed consent before the study commencement. This study was approved by the clinical research ethics committee at our institute.

Evaluation of scoliosis severity

Normal standing whole spine antero-posterior radiographs were obtained for each AIS patient at the first presentation. A standard technique was used to measure Cobb’s angle, and when more than one curve was found, the most severe was selected for measurements. Curves of <10° were excluded.

Anthropometric measurements

Anthropometric measurements included body height and body weight. Corrected heights for patients were calculated using Bjure’s formula (Log y = 0.011x − 0.177, where y is the loss of trunk height (cm) due to a deformed spine and x is the greatest Cobb angle of the primary curve) [8]. The body mass indices (BMIs) were calculated by dividing weight (kg) by uncorrected height squared (m2).

Dual-energy X-ray absorptiometry

Lumbar spinal bone mineral density (LSBMD) and femoral neck BMD (FNBMD) of the non-dominant proximal femur were measured by dual-energy X-ray absorptiometry (DEXA) (XR-36; Norland Corp., Fort Atkinson, WI, USA). LSBMDs were measured at L1–L4 in anterior–posterior view. The scoliotic curvature can make it difficult to measure spinal BMD reliably. To minimize this problem, the amount of spinal rotation in patients was determined by pre-scanning the spine and measuring LSBMD in the neutral position [35].

Biochemical markers of bone turnover

Blood samples were collected between 8:00 and 10 a.m. after an overnight fast. Plasma and serum samples were analyzed in a routine laboratory using standard procedures. Osteocalcin in heparinized plasma was measured using a solid-phase, two-site chemiluminescent enzyme-labeled immunometric assay (Immulite Osteocalcin, Diagnostic Product Corporation, Los Angeles, CA, USA), serum alkaline phosphatase (ALP) by RIA (Tandem-R Ostase, Beckman Coulter, Fullerton, CA, USA) and serum 25(OH)D3 and 1,25(OH)2D3 levels were measured by RIA using an IDS (Immunodiagnostic System Limited, UK). The intra-assay and inter-assay variabilities for 25(OH)D3 and 1,25(OH)2D3 were both below 10%.

Genotyping

Genomic DNA was extracted from peripheral blood leukocytes using a QIAamp DNA blood kit (Qiagen GmbH, Hilden, Germany). Polymerase chain reaction (PCR) primers were designed for the BsmI (rs1544410), FokI (rs2228670) and Cdx2 (rs11568820) SNPs of the VDR gene. Polymorphic regions of the VDR gene were amplified by PCR using the specific forward primers (GGCAACCTGAAGGGAGACGTA for rs1544410, AGCTGGCCCTGGCACTGACTCTGCTCT for rs2228670 and ACTGCAGCCTTGACCTCCTA for rs11568820) and the specific reverse primers (CTCTTTGGACCTCATCACCGAC for rs1544410, ATGGAAACACCTTGCTTCTTCTCCCTC for rs2228670 and AAAGCAAACCAAGGGGTCTT for rs11568820). PCR products were digested with BsmI, FokI or HypCHIII restriction enzyme, respectively, and then electrophoresed through 1.5% agarose gel to confirm the reaction. Products were purified directly from PCR using a PCR cleaning kit (Qiagen GmbH). Sequences were determined by cycle sequencing using an ABI PRISM Bigdye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA) on an automated DNA sequencer (ABI PRISM 310, Perkin Elmer Applied Biosystems, Foster City, CA, USA).

Statistical analysis

Statistical analysis was performed using SPSS 11.5 software for Windows (SPSS, Chicago, IL, USA). Results are presented as mean ± standard deviations. The Hardy–Weinberg equilibrium was tested for each SNP in the patient and control groups using the chi-square test. Frequency distributions of genotypes in patients and controls were compared using the chi-square test for each SNP studied. Inter-group comparisons were made using the t test, ANOVA, and the non-parametric Kruskal–Wallis test. Statistical significance was accepted for P values of <0.05.

Results

The genotype frequencies of all studied SNPs were determined by screening DNA samples from the 318 subjects. The genotype frequencies of the two study groups are summarized in Table 1. The genotype frequency distributions of all three polymorphic SNPs were in Hardy–Weinberg equilibrium. Comparisons of genotype frequencies of the three polymorphisms studied in AIS patients and healthy controls revealed a significant difference for only the BsmI polymorphism (P = 0.0054).

Table 1.

Genotype frequency distributions in AIS patients and healthy controls

AIS (n = 198) Control (n = 120) P value
BsmI 0.0054
 GG 50 46
 AG 102 61
 AA 46 13
FokI 0.7665
 CC 64 42
 CT 104 63
 TT 30 15
Cdx2 0.7254
 GG 136 84
 GA 49 26
 AA 13 10

Subject characteristics are presented in Table 2. For each genotype, the difference in age, BMI, cBMI and biochemical markers were compared in the two study groups. No statistically significant differences were identified. Mean LSBMD and FNBMD in patients were decreased to be lower than in controls (P = 0.0022 and P = 0.0013, respectively).

Table 2.

Genotype frequency distributions in AIS patients and healthy controls

AIS (n = 198) Control (n = 120) P value
Age (years) 12.5 ± 0.8 12.7 ± 1.0 0.1766
BMI 18.0 ± 1.6 18.2 ± 2.3 0.5051
cBMI 17.7 ± 1.6 18.2 ± 2.3 0.0582
25(OH)D3 (ng/mL) 14.3 ± 9.4 13.4 ± 6.7 0.5700
1,25(OH)2D3 (pg/mL) 79.4 ± 28.9 81.0 ± 19.5 0.3833
Osteocalcin (μg/L) 25.6 ± 7.5 21.8 ± 10.2 0.3301
Alkaline phosphatase (μg/L) 12.7 ± 5.9 11.4 ± 7.8 0.3725
LSBMD (g/cm2) 0.717 ± 0.050 0.737 ± 0.068 0.0022
FNBMD (g/cm2) 0.705 ± 0.044 0.725 ± 0.064 0.0013

cBMI Corrected BMI

The BsmI polymorphism was found to be significantly associated with LSBMD, but not with FNBMD (Table 3). In particular, AIS patients with the AA genotype had a significantly lower LSBMD than patients with the GA (P < 0.05) or GG (P < 0.01) genotype. However, no significant association was found between either LSBMD or FNBMD and the FokI or Cdx2 polymorphisms.

Table 3.

Bone mineral densities in AIS patients with different genotypes

GG GA AA P value
BsmI
 LSBMD 0.728 ± 0.054 0.720 ± 0.048 0.696 ± 0.048 0.0046
 FNBMD 0.707 ± 0.047 0.701 ± 0.039 0.712 ± 0.052 0.3298
CC CT TT P value
FokI
 LSBMD 0.719 ± 0.054 0.718 ± 0.048 0.707 ± 0.050 0.4863
 FNBMD 0.705 ± 0.047 0.707 ± 0.042 0.699 ± 0.046 0.7019
GG GA AA P value
Cdx2
 LSBMD 0.715 ± 0.050 0.718 ± 0.051 0.730 ± 0.057 0.7190
 FNBMD 0.705 ± 0.046 0.701 ± 0.040 0.722 ± 0.038 0.2475

Discussion

Adolescent idiopathic scoliosis patients have been reported to have a low bone mass and osteopenia in both the axial and peripheral skeletons [6, 8, 11, 13, 35, 38]. However, the precise mechanism of bone loss in AIS patients is unclear. As osteoporosis is a disease with a strong genetic component, much effort is focused on the identification of SNPs associated with the osteoporotic phenotype [31]. Morrison et al. [29] were the first to report that the BsmI polymorphism of the VDR gene is responsible for part of the genetic effect on peak bone mass. Subsequent association studies between VDR gene polymorphism and BMD have been conducted [2, 22, 25, 34, 37, 44]. However, no report has yet linked bone mass in AIS and a VDR gene polymorphism.

The VDR gene is one of the most widely studied osteoporosis-related genes. However, the numerous genetic association studies undertaken on the topic have yielded conflicting results [2, 22, 25, 34, 37, 44]. Arabi et al. [3] concluded that VDR gene polymorphisms, identified using BsmI restriction enzyme, are associated with the bone mineral contents of the lumbar spine and femoral neck in healthy girls, whereas Lorentzon et al. [25] reported that the VDR gene polymorphism defined by ApaI and BsmI, is related to LSBMD in healthy adolescent girls. However, meta-analyses of the BsmI polymorphism have produced contradictory results for an association with FNBMD [12, 19]. Furthermore, in the GENOMOS study, no association was found between the BsmI-ApaI-TaqI (VDR) haplotype and any osteoporotic phenotype, whereas Cdx2 polymorphism was found to be associated with LSBMD, FNBMD and the risk of vertebral fracture [28, 41]. Laaksonen et al. [22] concluded that the VDR FokI polymorphism is not associated with BMD or quantitative ultrasound parameters in girls, whereas Ames et al. [2] found that the FokI polymorphism at the VDR translation initiation site was associated with BMD and calcium deposition in children. On the other hand, Strandberg et al. [34] concluded that FokI genotypes are independently related to LSBMD, but not to FNBMD.

Since the first report was issued on the relationship between VDR genotypes and BMD in 1994 [29], a large number of studies have been conducted. However, the majority of these studies involved adults rather than children [2, 22, 25, 34]. Nevertheless, published results are conflicting, regardless of age, and in children appear to differ by gender, pubertal status and the restriction enzyme used [2, 22, 25, 34]. Thus, in the present study, we enrolled an age- and sex-matched healthy control group to minimize these effects.

We examined the BsmI (rs1544410), FokI (rs2228670) and Cdx2 (rs11568820) SNPs of the VDR gene to identify those genes involved in the regulation of bone mass in Korean AIS patients, who incidentally represent a near ethnically homogenous population. In addition, we compared genotype frequencies in AIS patients and healthy controls. These comparisons revealed a significant difference in the genotype frequencies of the BsmI polymorphism in the two study groups. In addition, BsmI polymorphism was associated with LSBMD in AIS patients. The prevalences of the three BsmI genotypes in patients were GG 25.3%, GA 51.5% and AA 23.2%. In particular, AIS patients with the A allele had a significantly lower LSBMD, but this was not observed for FNBMD. However, no significant differences were observed between patients and controls in terms of the genotype frequencies of the FokI and Cdx2 polymorphisms, and the genotypes of these two polymorphisms were not found to influence LSBMD or FNBMD in patients. Our findings concur with those of some previous studies, but not all of these studies assessed relationships in adolescent girls [2, 22, 25, 28, 34].

A number of limitations of the present study require consideration. First, the number of samples tested was relatively small and thus further studies in a larger patient population are required. Second, we did not evaluate interactions with other genes, such as the estrogen receptor gene, or with other relevant gene polymorphisms, such as those of the calcium sensing receptor gene. Furthermore, associations with other factors, such as the markers of bone metabolism, bone quality, and other candidate genes, should also be evaluated.

Summarizing, we examined the association between VDR gene polymorphisms and BMD in Korean girls with AIS. We found VDR gene polymorphism using BsmI restriction enzyme influences on LSBMD. Therefore, early diagnosis of the disease using well-known genetic markers will provide beneficial information regarding individual susceptibility to low bone mass and may help high-risk individuals to take precautions against further reduction of bone mass. Further studies on a larger number of subjects are required to determine the mechanism responsible for low bone mass in AIS.

Acknowledgments

The authors thank the study participants and their parents for making this study possible and Frederick N. Dyer, Ph.D., for his suggestions.

References

  • 1.Ahn UM, Ahn NU, Nallamshetty L, Buchowski JM, Rose PS, Miller NH, Kostuik JP, Sponseller PD. The etiology of adolescent idiopathic scoliosis. Am J Orthop. 2002;31:387–395. [PubMed] [Google Scholar]
  • 2.Ames S, Ellis K, Gunn S, Copeland K, Abrams S. Vitamin D receptor gene polymorphism predicts calcium absorption and bone mineral density in children. J Bone Miner Res. 1999;14:740–746. doi: 10.1359/jbmr.1999.14.5.740. [DOI] [PubMed] [Google Scholar]
  • 3.Arabi A, Zahed L, Mahfoud Z, El-Onsi L, Nabulsi M, Maalouf J, Fuleihan GE (2009) Vitamin D receptor gene polymorphisms modulate the skeletal response to vitamin D supplementation in healthy girls. Bone. doi:10.1016/j.bone.2009.07.074 [DOI] [PubMed]
  • 4.Baldock PA, Thomas GP, Hodge JM, Baker SUK, Dressel U, O’Loughlin PD, Nicholson GC, Briffa KH, Eisman JA, Gardiner EM. Vitamin D action and regulation of bone remodeling: suppression of osteoclastogenesis by the mature osteoblast. J Bone Miner Res. 2006;21:1618–1626. doi: 10.1359/jbmr.060714. [DOI] [PubMed] [Google Scholar]
  • 5.Burner WL, Badger VM, Sherman FC. Osteoporosis and acquired back deformities. J Pediatr Orthop. 1982;2:383–385. doi: 10.1097/01241398-198210000-00006. [DOI] [PubMed] [Google Scholar]
  • 6.Cheng JC, Guo X. Osteopenia in adolescent idiopathic scoliosis. A primary problem or secondary to the spinal deformity? Spine. 1997;22:1716–1721. doi: 10.1097/00007632-199708010-00006. [DOI] [PubMed] [Google Scholar]
  • 7.Cheng JC, Guo X, Sher AH. Persistent osteopenia in adolescent idiopathic scoliosis. A longitudinal follow up study. Spine. 1999;24:1218–1222. doi: 10.1097/00007632-199906150-00008. [DOI] [PubMed] [Google Scholar]
  • 8.Cheng JC, Qin L, Cheung CS, Sher AH, Lee KM, Ng SW, Guo X. Generalized low areal and volumetric bone mineral density in adolescent idiopathic scoliosis. J Bone Miner Res. 2000;15:1587–1595. doi: 10.1359/jbmr.2000.15.8.1587. [DOI] [PubMed] [Google Scholar]
  • 9.Cheng JC, Tang SP, Guo X, Chan CW, Qin L. Osteopenia in adolescent idiopathic scoliosis: a histomorphometric study. Spine. 2001;26:E19–E23. doi: 10.1097/00007632-200104150-00023. [DOI] [PubMed] [Google Scholar]
  • 10.Collins D, Jasani C, Fogelman I, Swaminathan R. Vitamin D and bone mineral density. Osteoporos Int. 1998;8:110–114. doi: 10.1007/BF02672505. [DOI] [PubMed] [Google Scholar]
  • 11.Cook SD, Harding AF, Morgan EL, Nicholson RJ, Thomas KA, Whitecloud TS, Ratner ES. Trabecular bone mineral density in idiopathic scoliosis. J Pediatr Orthop. 1987;7:168–174. doi: 10.1097/01241398-198703000-00011. [DOI] [PubMed] [Google Scholar]
  • 12.Cooper GS, Umbach DM. Are vitamin D receptor polymorphisms associated with bone mineral density? A meta-analysis. J Bone Miner Res. 1996;11:1841–1849. doi: 10.1002/jbmr.5650111203. [DOI] [PubMed] [Google Scholar]
  • 13.Eun IS, Park WW, Suh KT, Kim JI, Lee JS. Association between osteoprotegerin gene polymorphism and bone mineral density in patients with adolescent idiopathic scoliosis. Eur Spine J. 2009;18:1936–1940. doi: 10.1007/s00586-009-1145-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fang Y, Meurs JB, Bergink AP, Hofman A, Duijn CM, Leeuwen JP, Pols HA, Uitterlinden AG. Cdx-2 polymorphism in the promoter region of the human vitamin D receptor gene determines susceptibility to fracture in the elderly. J Bone Miner Res. 2003;18:1632–1641. doi: 10.1359/jbmr.2003.18.9.1632. [DOI] [PubMed] [Google Scholar]
  • 15.Ford DM, Bagnall KM, Clements CA, McFadden KD. Muscle spindles in the paraspinal musculature of patients with adolescent idiopathic scoliosis. Spine. 1988;13:461–465. doi: 10.1097/00007632-198805000-00004. [DOI] [PubMed] [Google Scholar]
  • 16.Ford DM, Bagnall KM, McFadden KD, Greenhill BJ, Raso VJ. Paraspinal muscle imbalance in adolescent idiopathic scoliosis. Spine. 1984;9:373–376. doi: 10.1097/00007632-198405000-00008. [DOI] [PubMed] [Google Scholar]
  • 17.Fradinger E, Zanchetta J. Vitamin D and bone mineral density in ambulatory women living in Buenos Aires, Argentina. Osteoporos Int. 2001;2:24–27. doi: 10.1007/s001980170153. [DOI] [PubMed] [Google Scholar]
  • 18.Garnero P, Munoz F, Sornay-Rendu E, Delmas P. Association of vitamin D status with bone mineral density, bone turnover, bone loss and fracture risk in healthy postmenopausal women. The OFELY study. Bone. 2007;40:716–722. doi: 10.1016/j.bone.2006.09.026. [DOI] [PubMed] [Google Scholar]
  • 19.Gong G, Stern H, Cheng S, Fong N, Mordeson J, Deng H, Recker R. The association of bone mineral density with vitamin D receptor polymorphisms. Osteoporos Int. 1999;9:55–64. doi: 10.1007/s001980050116. [DOI] [PubMed] [Google Scholar]
  • 20.Ioannidis JP, Ralston SH, Bennett ST, Brandi ML, Grinberg D, Karassa FB, Langdahl B, Meurs JB, Mosekilde L, Scollen S, Albagha OM, Bustamante M, Carey AH, Dunning AM, Enjuanes A, Leeuwen JP, Mavilia C, Masi L, McGuigan FE, Nogues X, Pols HA, Reid DM, Schuit SC, Sherlock RE, Uitterlinden AG, GENOMOS Study Differential genetic effects of ESR1 gene polymorphisms on osteoporosis outcomes. JAMA. 2004;292:2105–2114. doi: 10.1001/jama.292.17.2105. [DOI] [PubMed] [Google Scholar]
  • 21.Kindsfater K, Lowe T, Lawellin D, Weinstein D, Akmakjian J. Levels of platelet calmodulin for the prediction of progression and severity of adolescent idiopathic scoliosis. J Bone Joint Surg. 1994;76-A:1186–1192. doi: 10.2106/00004623-199408000-00009. [DOI] [PubMed] [Google Scholar]
  • 22.Laaksonen M, Karkkainen M, Outila T, Rita H, Lamberg-Allard C. Vitamin D receptor gene start codon polymorphism (FokI) is associated with forearm bone mineral density and calcaneal ultrasound in Finnish adolescent boys but not in girls. J Bone Miner Metab. 2004;22:479–485. doi: 10.1007/s00774-004-0510-6. [DOI] [PubMed] [Google Scholar]
  • 23.LeBoff MS, Kohlmeier L, Hurwiz S, Franklin J, Wright J, Glowacki J. Occult vitamin D deficiency in postmenopausal US women with acute hip fracture. JAMA. 1999;28:1505–1511. doi: 10.1001/jama.281.16.1505. [DOI] [PubMed] [Google Scholar]
  • 24.Lehtonen-Veromaa MK, Mottonen TT, Nuotio IO, Irjala KM, Leino AE, Viikari JS. Vitamin D and attainment of peak bone mass among peripubertal Finnish girls: 3-y prospective study. Am J Clin Nutr. 2002;76:1446–1453. doi: 10.1093/ajcn/76.6.1446. [DOI] [PubMed] [Google Scholar]
  • 25.Lorentzon M, Lorentzon R, Nordstrom P. Vitamin D receptor gene polymorphism is related to bone density, circulating osteocalcin and parathyroid hormone in healthy adolescent girls. J Bone Miner Res. 2001;19:302–307. doi: 10.1007/s007740170014. [DOI] [PubMed] [Google Scholar]
  • 26.Machida M, Dubousset J, Imamura Y, Iwaya T, Yamada T, Kimura J, Toriyama S. Pathogenesis of idiopathic scoliosis: SEPs in chicken with experimentally induced scoliosis and in patients with idiopathic scoliosis. J Pediatr Orthop. 1994;14:329–335. doi: 10.1097/01241398-199405000-00010. [DOI] [PubMed] [Google Scholar]
  • 27.McCarrey JR, Abbott UK, Benson DR, Riggins RS. Genetics of scoliosis in chickens. J Hered. 1981;72:6–10. doi: 10.1093/oxfordjournals.jhered.a109428. [DOI] [PubMed] [Google Scholar]
  • 28.Mencej-Bedrac S, Prezelj J, Kocjan T, Teskac K, Ostanek B, Smelcer M, Marc J. The combinations of polymorphisms in vitamin D receptor, osteoprotegerin and tumour necrosis factor superfamily member 11 genes are associated with bone mineral density. J Mol Endocrinol. 2009;42:239–247. doi: 10.1677/JME-08-0108. [DOI] [PubMed] [Google Scholar]
  • 29.Morrison NA, Qi JC, Tokita A, Kelly PJ, Crofts L, Nguyen TV, Sambrook PN, Eisman JA. Prediction of bone density from vitamin D receptor alleles. Nature. 1994;367:284–287. doi: 10.1038/367284a0. [DOI] [PubMed] [Google Scholar]
  • 30.Murray RE, McGuigan F, Grant SF, Reid DM, Ralston SH. Polymorphisms of the interleukin-6 gene associated with bone mineral density. Bone. 1997;21:89–92. doi: 10.1016/S8756-3282(97)00081-1. [DOI] [PubMed] [Google Scholar]
  • 31.Ralston SH, Crombrugghe B. Genetic regulation of bone mass and susceptibility to osteoporosis. Genes Dev. 2006;20:2492–2506. doi: 10.1101/gad.1449506. [DOI] [PubMed] [Google Scholar]
  • 32.Saggese G, Baroncelli GI, Bertelloni S. Puberty and bone development. Best Pract Res Clin Endocrinol Metab. 2002;16:53–64. doi: 10.1053/beem.2001.0180. [DOI] [PubMed] [Google Scholar]
  • 33.Stilwell DL., Jr Structural deformities of vertebrae: bone adaptation and modeling in experimental scoliosis and kyphosis. J Bone Joint Surg. 1962;44-A:611–634. [PubMed] [Google Scholar]
  • 34.Strandberg S, Nordstrom P, Lorentzon R, Lorentzon M. Vitamin D receptor start codon polymorphism (FokI) is related to bone mineral density in healthy adolescent boys. J Bone Miner Res. 2003;21:109–113. doi: 10.1007/s007740300018. [DOI] [PubMed] [Google Scholar]
  • 35.Suh KT, Lee SS, Hwang SH, Kim SJ, Lee JS. Elevated soluble receptor activator of nuclear factor-κB ligand and reduced bone mineral density in patients with adolescent idiopathic scoliosis. Eur Spine J. 2007;16:1563–1569. doi: 10.1007/s00586-007-0390-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Suh KT, Lee SS, Kim SJ, Kim YK, Lee JS. Pineal gland metabolism in patients with adolescent idiopathic scoliosis. J Bone Joint Surg. 2007;89-B:66–71. doi: 10.1302/0301-620X.89B1.18058. [DOI] [PubMed] [Google Scholar]
  • 37.Thakkinstian A, d’Este C, Eisman J, Nguyen T, Attia J. Meta-analysis of molecular association studies: vitamin D receptor gene polymorphisms and BMD as a case study. J Bone Miner Res. 2004;19:419–428. doi: 10.1359/JBMR.0301265. [DOI] [PubMed] [Google Scholar]
  • 38.Thomas KA, Cook SD, Skalley TC, Renshaw SV, Makuch RS, Gross M, Whitecloud TS, 3rd, Bennett JT. Lumbar spine and femoral neck bone mineral density in idiopathic scoliosis: a follow up study. J Pediatr Orthop. 1992;12:235–240. doi: 10.1097/01241398-199203000-00016. [DOI] [PubMed] [Google Scholar]
  • 39.Uitterlinden AG, Burger H, Huang Q, Yue F, McGuigan FE, Grant SF, Hofman A, Leeuwen JP, Pols HA, Ralston SH. Relation of alleles of the collagen type 1 alpha gene to bone density and the risk of osteoporotic fractures in postmenopausal women. N Engl J Med. 1998;338:1016–1021. doi: 10.1056/NEJM199804093381502. [DOI] [PubMed] [Google Scholar]
  • 40.Uitterlinden AG, Pols HA, Burger H, Huang Q, Daele PL, Duijn CM, Hofman A, Birkenhager JC, Leeuwen JP. A large-scale population-based study of the association of vitamin D receptor gene polymorphisms with bone mineral density. J Bone Miner Res. 1996;11:1241–1248. doi: 10.1002/jbmr.5650110908. [DOI] [PubMed] [Google Scholar]
  • 41.Uitterlinden AG, Ralston SH, Brandi ML, Carey AH, Grinberg D, Langdahl BL, Lips P, Lorenc R, Obermayer-Pietsch B, Reeve J, Reid DM, Amedei A, Bassiti A, Bustamante M, Husted LB, Diez-Perez A, Dobnig H, Dunning AM, Enjuanes A, Fahrleitner-Pammer A, Fang Y, Karczmarewicz E, Kruk M, Leeuwen JP, Mavilia C, Meurs JB, Mangion J, McGuigan FE, Pols HA, Renner W, Rivadeneira F, Schoor NM, Scollen S, Sherlock RE, Ioannidis JP, APOSS Investigators. EPOS Investigators. EPOLOS Investigators. FAMOS Investigators. LASA Investigators. Rotterdam Study Investigators. GENOMOS Study The association between common vitamin D receptor gene variations and osteoporosis: a participant-level meta-analysis. Ann Intern Med. 2006;145:255–264. doi: 10.7326/0003-4819-145-4-200608150-00005. [DOI] [PubMed] [Google Scholar]
  • 42.Meurs JB, Schuit SC, Weel AE, Klift M, Bergink AP, Arp PP, Colin EM, Fang Y, Hofman A, Duijn CM, Leeuwen JP, Pols HA, Uitterlinden AG. Association of 5′ estrogen receptor alpha gene polymorphisms with bone mineral density, vertebral bone area and fracture risk. Hum Mol Genet. 2003;12:1745–1754. doi: 10.1093/hmg/ddg176. [DOI] [PubMed] [Google Scholar]
  • 43.Wang ED, Drummond DS, Dormans JP, Moshang T, Davidson RS, Gruccio D. Scoliosis in patients treated with growth hormone. J Pediatr Orthop. 1997;17:708–711. doi: 10.1097/00004694-199711000-00003. [DOI] [PubMed] [Google Scholar]
  • 44.Zintzaras E, Rodopoulou P, Koukoulis GN. BsmI, TaqI, ApaI and FokI polymorphisms in the vitamin D receptor (VDR) gene and the risk of osteoporosis: a meta-analysis. Dis Markers. 2006;22:317–326. doi: 10.1155/2006/921694. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from European Spine Journal are provided here courtesy of Springer-Verlag

RESOURCES