Skip to main content
Molecular Vision logoLink to Molecular Vision
. 2010 Oct 29;16:2185–2191.

Distribution of COL8A2 and COL8A1 gene variants in Caucasian primary open angle glaucoma patients with thin central corneal thickness

T Desronvil 1, D Logan-Wyatt 1, W Abdrabou 1, M Triana 1, R Jones 1, S Taheri 1, E Del Bono 1, LR Pasquale 1, M Olivier 2, JL Haines 3, BJ Fan 1, JL Wiggs 1,✉
PMCID: PMC2994337  PMID: 21139683

Abstract

Purpose

One approach to identify genes that contribute to common complex ocular disorders such as primary open angle glaucoma (POAG) is to study the genetic determinates of endophenotypes that are defined by underlying pre-disposing heritable quantitative traits such as central corneal thickness (CCT). Collagen VIII is a major component of Descemet’s membrane and studies in mice have indicated that targeted inactivation of the genes encoding the collagen type 8 alpha1 (Col8a1) and collagen type 8 alpha2 (Col8a2) subunits (COL8A1 and COL8A2) results in thinning of the corneal stroma and of Descemet’s membrane. The purpose of this study is to evaluate COL8A1 and COL8A2 as candidate genes for thin CCT in human POAG patients.

Methods

100 Caucasian POAG patients were enrolled in this study. The entire COL8A1 and COL8A2 coding sequence was determined in 8 patients with CCT<513 µm (one standard deviation (36 microns) below the mean (550 microns) and 8 patients with CCT>586 µm (one standard deviation above the mean). Selected COL8A2 exons containing variants of interest were sequenced in the full POAG cohort. Association and quantitative trait analyses were performed.

Results

Three patients with CCT less than 513 µm and advanced POAG were found to have missense changes in COL8A2; two patients had a previously identified mutation, R155Q and one had a novel change, P678L (p=0.0035, Fisher’s exact test). Missense changes were not found in any of the patients with CCT>513 µm and missense changes in the COL8A1 gene were not found in any patient. One common COL8A2 SNP, rs274754 was also statistically associated with CCT (p=0.018).

Conclusions

In this study we have identified COL8A2 missense changes in a group of Caucasian patients with very thin CCT and advanced POAG. These results suggest that DNA sequence variants in the COL8A2 gene may be associated with thin corneas in some glaucoma patients. Further study of COL8A2 variants in other patient populations, especially those with thinner CCT such as African-Americans would provide further support for a role of COL8A2 in corneal thickness and in glaucoma.

Introduction

Primary open angle glaucoma (POAG) is phenotypically and genetically complex. One approach to identify genes that contribute to common complex traits is to study the genetic determinants of endophenotypes that are defined by underlying pre-disposing quantitative traits [1]. Mapping genes influencing the related quantitative trait, rather than the complete complex phenotype, has several important advantages including objective phenotype definitions and a possible reduction in the underlying molecular heterogeneity. Several quantitative traits with significant heritability are associated with POAG including intraocular pressure (IOP), optic nerve vertical cup-to-disc ratio, optic nerve area, and central corneal thickness (CCT) [2-9].

The ocular hypertension treatment trial (OHTS) initially identified thin CCT as a risk factor for progression from ocular hypertension to glaucoma [10]. Subsequently, other studies have suggested that thin CCT is associated with increased severity of visual field loss and more rapid progression of visual field loss [11-15]. Central corneal thickness is a normally distributed, highly heritable quantitative trait in human populations [16], with individuals of African race having lower CCT than Caucasian populations [17,18]. The increased incidence of POAG in African populations is consistent with the increased risk of disease associated with thin CCT.

Candidate gene studies and a recent genome-wide association study have identified several genes that may contribute to CCT variation, including the genes for type I collagen [19] and the genes coding for collagen 5 alpha1 (COL5A1), autogenous vein graft remodeling associated protein 8 (AVGR8), and A-kinase anchor protein 13 (AKAP13) [20]. These results suggest that genes coding for proteins that maintain corneal stromal integrity may be good candidates for genetic determinants influencing the trait.

Collagen VIII (COL8) is a major component of Descemet’s membrane, and is composed of two subunits, collagen VIIIA1 (COL8A1) and collagen VIIIA2 (COL8A2) which form homotrimers [21]. Targeted inactivation of the COL8A1 and COL8A2 genes in mice results in anterior segment dysgenesis and thin corneal stroma [22], suggesting that COL8A1 and/or COL8A2 may contribute to the development of thin CCT. Further support for a role of COL8A2 in corneal thickness comes from a more recent study documenting thin corneas in mice with a COL8A2 missense change, G257D [23]. The purpose of this study is to evaluate COL8A1 and COL8A2 as candidate genes for thin CCT in human POAG patients.

Methods

Patients

This study was approved by the institutional review board of the Massachusetts Eye and Ear Infirmary, Boston, MA. After informed consent, 100 Caucasian POAG patients from the Massachusetts Eye and Ear Infirmary glaucoma service were enrolled in this study. Central corneal thickness (CCT) was measured using an ultrasonic pachymeter (DGH Technology, Inc., Exton, PA). The recorded value was an average of three measurements for each eye. The number used for CCT for each patient was the average of each eye. The following criteria were used to establish POAG affected status: 1) IOP≥22 mmHg in both eyes on 2 occasions, or IOP≥19 mmHg in both eyes on treatment with 2 or more glaucoma medications; 2) Visual field loss in at least one eye on a reliable visual field (reliable visual field is defined by fixation loss ≤33%, false positive rate ≤20% and false negative rate ≤20%) that is in a distribution consistent with nerve fiber layer loss and corresponds to changes in the optic nerve; and 3) Optic nerve damage in at least one eye characterized by two of the following: vertical cup/disc ratio >0.7, superior or inferior neuroretinal rim <0.1, focal notching of the superior or inferior neuroretinal rim, nerve fiber bundle defect with a width of 2 or more retinal vein diameters located 1 disc diameter from the optic nerve, asymmetry of the cup/disc ratio >0.2 without asymmetric refraction, and disc hemorrhage. Patients with known corneal disease and patients who had undergone corneal surgery, including refractive surgery, were excluded from this study.

DNA sequencing

Genomic DNA was prepared from buccal cell samples using established techniques (Gentra, Minneapolis, MN). Initially, the entire coding region of COL8A1 and COL8A2 was sequenced in 8 patients with CCT<513 μm (one standard deviation from the mean of 550±36 μm) and 8 patients with CCT>586 μm (one standard deviation from the mean). Genomic DNA was sequenced using primers (Table 1) designed to amplify the coding exons as well as the adjacent splice sites for both the COL8A1 and COL8A2 genes.  PCR was performed in a thermal cycler (model 2720; Applied Biosystems Inc., Foster City, CA) set at the following parameters: 50 °C for 2 min, 95 °C for 10 min, 92 °C for 15 s, and 58 °C for 1 min for a total of 60 cycles. PCR products were directly sequenced on the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) with BigDye Terminators (Applied Biosystems) according to standard protocols. Selected COL8A2 exons containing variants of interest were sequenced in the entire POAG cohort using the same techniques.

Table 1. Characteristics of primers used for amplification and sequencing.

Primer name Sequence Melting temp Product size
Primers for coding exons of COL8A1 (NM_001850)
Exon 4 Forward
AAGTCACTTGGCCTTGCAG
59.02
456
Exon 4 Reverse
CCCCTCTGATCCCATAATTTAG
58.84
 
Exon 5_1 Forward
ACTTCATTGATGTGAGAGACAATC
57.34
630
Exon 5_1 Reverse
TGGAGCCCCTGGCTTTC
62.33
 
Exon 5_2 Forward
AGGTGCGCCAGGTGTAAAG
61.24
594
Exon 5_2 Reverse
ACTTCACCAAGGAAACCTGG
59.04
 
Exon 5_3 Forward
CAAAGGAGAAGGTGGGATTG
59.52
584
Exon 5_3 Reverse
TGCCTTTCTTAGCCCCGTAG
61.59
 
Exon 5_4 Forward
GAGTGGCAGGACTTCATGG
59.20
777
Exon 5_4 Reverse
TGTACACAATGGTCCAAATTTTC
58.78
 
Primers for coding exons of COL8A2 (NM_005202)
Exon 1 Forward
CAGGGCTGGCTTGATGAC
60.36
312
Exon 1 Reverse
AGGGAGGCAGGGGATTTG
62.33
 
Exon 2_1 Forward
GGAATGGGTAGATGGGGTC
59.01
599
Exon 2_1 Reverse
AACCAGGTTTGCCTAAGCC
59.18
 
Exon 2_2 Forward
GATAATGGAGTGGGCCAGC
60.44
580
Exon 2_2 Reverse
CACTAGGCCCCTGGTCAC
59.05
 
Exon 2_3 Forward
GCTTCCTGGCAGACGTG
59.00
597
Exon 2_3 Reverse
AGCCCAAACTGTGGCTTG
59.83
 
Exon 2_4 Forward
CTCCCCTGGAATCACGG
59.98
636
Exon 2_4 Reverse TTGAAAAGGTCGCTCTACCAC 59.37  

Statistical methods

The association of missense changes in COL8A2 and CCT<513 µm was assessed using Fisher’s exact test. Quantitative trait analysis for rs274754 and rs3738360 was performed using PLINK (version 1.07) [24], and p-values were adjusted for gender and age of enrollment using logistic regression.

Results

Identification of sequence variants in COL8A1 and COL8A2

100 Caucasian POAG patients with a mean CCT of 550±36 µm (range 488–676 µm) were evaluated for this study. The mean CCT in our POAG sample is similar to that observed in the normal Caucasian population [25]. The mean age at enrollment was 68 years and the population was 51% female. Initially we sequenced the entire coding sequence for both the COL8A1 and COL8A2 genes in 8 patients with CCT<513 µm (one standard deviation from the mean) and in 8 patients with CCT>586 µm (one standard deviation from the mean). Three patients with CCT less than 513 µm were found to have missense changes in COL8A2; two patients had a previously identified mutation, R155Q and one had a novel change, P678L. Missense changes were not found in any of the patients with CCT>586 µm and missense changes were not found in any patients in the COL8A1 gene. Two common COL8A2 SNPs, rs274754 and rs3738360 were also found in both groups of patients. The entire cohort was further genotyped for R155Q, P678L, rs274754, and rs3738360 by genomic sequencing. Missense changes were not identified in any of the remaining POAG patients. The location of each variant in the COL8A2 gene is shown in Figure 1.

Figure 1.

Figure 1

Structure of the COL8A2 gene and protein domains. The COL8A2 gene consists of two exons separated by single intron. The protein contains NC2, NC1, C1q, and triple helical domains as indicated. The locations of the variants studied are indicated with arrows.

Quantitative trait analysis

The two common COL8A2 SNPs (rs274754 and rs3738360) were genotyped in the entire cohort and analyzed for association with CCT. The genotype frequencies, mean CCT values for each genotype and associated p values for these two SNPs are shown in Table 2. SNP rs274754, located in the first intron is statistically associated with CCT (p=0.018), while SNP rs3738360, located in the 3′ UTR does not demonstrate an association in this group of individuals.

Table 2. QTL association analysis of common SNPs and CCT in Caucasian POAG patients.

SNP Genotype N CCT µm (mean±SD)
rs3738360
TT
78
550.6±38.0
 
GT
14
545.5±30.9
 
GG
0
-
 
Total
92
p-trend=0.64; p-adj=0.57
rs274754
TT
45
561.3±32.4
 
CT
23
539.9±30.4
 
CC
18
545.1±48.8
  Total 86 p-trend=0.047; p-adj=0.018

CCT: the average measures of central corneal thickness between left and right eyes; p-adj: p value adjusting for sex and age of enrollment.

COL8A2 missense carrier phenotypes

Phenotypic information for the three COL8A2 missense carriers is shown in Table 3. All three patients have very thin CCT, and advanced POAG including elevated intraocular pressure, optic nerve degeneration, and significant visual field defects. None of these patients had undergone refractive surgery or any other type of corneal surgery before CCT measurement.

Table 3. COL8A2 missense carrier phenotypes.

 
Patient ID (genotype)
Phenotype information 4381 (R155Q) 4964 (R155Q) 4995 (P678L)
Gender
Male
Male
Male
CCT µm (OD, OS)
502, 526
484, 481
507, 497
Age of enrollment
49
86
73
Visual acuity (OD, OS)
20/25, 20/50
20/60, 20/30
20/25, 20/20
Refractive error (OD, OS)
-1.00 -0.75 x002
-1.50 -1.25 x017
-1.75 -1.26 x065
0.00 -2.25 x098
-0.50 -0.50 x150
0.00 -0.50 x047
Gonioscopy
Open angle
Open angle
Open Angle
IOP >21
Yes
Unknown
Yes
Optic nerve VCDR (OD, OS)
0.95, 0.95
0.95, 0.90
0.9, 0.8
Visual Fields* OD: PSD 11.5- NS (S/I), ND (S/I), PS (S)
OS: PSD 9.1- NS (S/I), ND (S/I), PS (S/I) OD: Central island only
OS: Central island only OD: PSD 9.5- NS (S/I), ND (S/I), PS (S/I)
OS: PSD 5.5- ND (S), PS (S/I)

*Humphrey automated visual fields (24–2) were obtained for individuals 4831, 4995, and Goldman visual fields were available for individual 4964. Abbreviations: VCDR- vertical cup to disc ratio; PSD- pattern standard deviation; NS- Nasal step; ND- Nasal depression; PS- paracentral scotoma; S- superior; I- inferior.

Functional significance of COL8A2 missense variants

R155Q and P678L were found in 3 of 16 patients with CCT<513 µm and in none of the patients with CCT>513 µm (p=0.0035, Fisher’s exact test). Both R155Q and P678L are evolutionarily conserved amino acids (Figure 2). R155Q has been previously defined as a pathological variant contributing to Fuch’s Endothelial Dystrophy (FED) [26]. To further assess the probability that these variants impact corneal pathogenesis we used three tests of functional significance: PolyPhen-2 [27], SIFT [28] and PMUT [29]. Both PolyPhen-2 and PMUT identified P678L as a pathological variant (Table 4), while SIFT indicated that the proline to leucine change at position 678 could be tolerated. Surprisingly, both PMUT and SIFT suggested that R155Q, previously implicated in FED and PPMD, could be a tolerated variant while PolyPhen-2 was not able to make an assessment.

Figure 2.

Figure 2

Evolutionary conservation of R155Q and P678L. Arrows indicate the position of Arginine 155 and Proline 678. Conserved amino acids are highlighted in yellow.

Table 4. Tests of functional significance.

SNP PolyPhen-2 PMUT SIFT
R155Q
Unable to assess
Neutral (score=0.439)
Tolerated
P678L Probably damaging (score=0.999) Pathological (score=0.845) Tolerated

Discussion

In this study we have identified COL8A2 missense changes in a group of Caucasian patients with very thin CCT and advanced POAG. R155Q was found in two patients and P678L was found in one patient with CCT<513 µm. Both of these missense changes are evolutionarily conserved and are likely to be pathogenic. R155Q is located in the evolutionarily conserved triple helical domain. Although tests of functional significance suggest that the glutamine could be tolerated at position 155, the R155Q change has been previously associated with Fuch’s endothelial dystrophy (FED) [26] suggesting that the variant has a role in corneal disease. P678L is a novel COL8A2 missense change that is located in the highly conserved C1q domain. This variant is predicted to be pathologic by PolyPhen-2 and PMUT. Other COL8A2 missense changes have also been found in FED (R34H, R304Q, Q455K, Q455V, and L450W) [26,30-33]. COL8A2 mutations have not been found in patients with keratoconus or keratoglobus [34]. Our patients did not have clinical evidence of any of these corneal disorders.

As the previous reports relating COL8A2 missense changes to corneal disease have not included CCT measurement as part of the clinical assessment, it is not possible to determine if the patients carrying these gene variants also had thin CCT. However, given our results and the complex genetics of FED [35], it is likely that COL8A2 missense changes are responsible for thin CCT and that COL8A2 variants may also be one factor that can contribute to FED. Indeed several reports support this hypothesis, including a report describing familial aggregation, but not perfect segregation, of a COL8A2 missense change and FED [36] and the identification of the R155Q change in one FED affected patient and two controls in a population from South India [37]. The R155Q variant is also relatively common in the Japanese, a population known to have thinner CCT [38,39].

We also evaluated two common SNPs, rs274754 located within intron 1 near the 5′ end of the gene and rs3738360 located in the 3′UTR. Only SNP rs274754 was statistically associated with CCT, with the G allele associated with thinner CCT. Interestingly the G allele of rs274754 is more common in Africans (dbSNP), and individuals of African origin have thinner corneas and a higher incidence of POAG than Caucasians [40,41]. It would be of interest to evaluate the association between CCT and rs274754 and other common COL8A2 SNPs in a larger POAG sample and also in African populations.

POAG is inherited as a complex non-Mendelian trait that is likely to result from multiple genetic and environmental factors. Identifying genes responsible for POAG pre-disposing endophenotypes, such as thin CCT, is one path toward defining the underlying complex genetic architecture of the disease. This study suggests that COL8A2 gene variants can contribute to thin CCT. Further studies identifying genes that contribute to POAG endophenotypes will help define the molecular events underlying the complex phenotype as well as lead to gene-based tests for screening and diagnosis.

Acknowledgments

Supported in part by NIH/NEI grants EY015872 and P30 EY014104, the Massachusetts Lions Eye Research Fund and Research to Prevent Blindness.

References

  • 1.Charlesworth J, Kramer PL, Dyer T, Diego V, Samples JR, Craig JE, Mackey DA, Hewitt AW, Blangero J, Wirtz MK. The path to open-angle glaucoma gene discovery: endophenotypic status of intraocular pressure, cup-to-disc ratio, and central corneal thickness. Invest Ophthalmol Vis Sci. 2010;51:3509–14. doi: 10.1167/iovs.09-4786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Klein BE, Klein R, Lee KE. Heritability of risk factors for primary open angle glaucoma: the Beaver Dam Eye Study. Invest Ophthalmol Vis Sci. 2004;45:59–62. doi: 10.1167/iovs.03-0516. [DOI] [PubMed] [Google Scholar]
  • 3.van Koolwijk LM, Despriet DD, van Duijn CM, Pardo Cortes LM, Vingerling JR, Aulchenko YS, Oostra BA, Klaver CC, Lemij HG. Genetic contributions to glaucoma: heritability of intraocular pressure, retinal nerve fiber layer thickness, and optic disc morphology. Invest Ophthalmol Vis Sci. 2007;48:3669–76. doi: 10.1167/iovs.06-1519. [DOI] [PubMed] [Google Scholar]
  • 4.Chang TC, Congdon NG, Wojciechowski R, Muñoz B, Gilbert D, Chen P, Friedman DS, West SK. Determinants and heritability of intraocular pressure and cup-to-disc ratio in a defined older population. Ophthalmology. 2005;112:1186–91. doi: 10.1016/j.ophtha.2005.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Schwartz JT, Reuling FH, Feinleib M. Size of the physiologic cup of the optic nerve head. hereditary and environmental factors. Arch Ophthalmol. 1975;93:776–8. doi: 10.1001/archopht.1975.01010020670002. [DOI] [PubMed] [Google Scholar]
  • 6.Ramdas WD, van Koolwijk LM, Ikram MK, Jansonius NM, de Jong PT, Bergen AA, Isaacs A, Amin N, Aulchenko YS, Wolfs RC, Hofman A, Rivadeneira F, Oostra BA, Uitterlinden AG, Hysi P, Hammond CJ, Lemij HG, Vingerling JR, Klaver CC, van Duijn CM. A genome-wide association study of optic disc parameters. PLoS Genet. 2010;6:e1000978. doi: 10.1371/journal.pgen.1000978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Macgregor S, Hewitt AW, Hysi PG, Ruddle JB, Medland SE, Henders AK, Gordon SD, Andrew T, McEvoy B, Sanfilippo PG, Carbonaro F, Tah V, Li YJ, Bennett SL, Craig JE, Montgomery GW, Tran-Viet KN, Brown NL, Spector TD, Martin NG, Young TL, Hammond CJ, Mackey DA. Genome-wide association identifies ATOH7 as a major gene determining human optic disc size. Hum Mol Genet. 2010;19:2716–24. doi: 10.1093/hmg/ddq144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Toh T, Liew SH, MacKinnon JR, Hewitt AW, Poulsen JL, Spector TD, Gilbert CE, Craig JE, Hammond CJ, Mackey DA. Central corneal thickness is highly heritable: the twin eye studies. Invest Ophthalmol Vis Sci. 2005;46:3718–22. doi: 10.1167/iovs.04-1497. [DOI] [PubMed] [Google Scholar]
  • 9.Zheng Y, Ge J, Huang G, Zhang J, Liu B, Hur YM, He M. Heritability of central corneal thickness in Chinese: the Guangzhou Twin Eye Study. Invest Ophthalmol Vis Sci. 2008;49:4303–7. doi: 10.1167/iovs.08-1934. [DOI] [PubMed] [Google Scholar]
  • 10.Gordon MO, Beiser JA, Brandt JD, Heuer DK, Higginbotham EJ, Johnson CA, Keltner JL, Miller JP, Parrish RK, 2nd, Wilson MR, Kass MA. The Ocular Hypertension Treatment Study: baseline factors that predict the onset of primary open-angle glaucoma. Arch Ophthalmol. 2002;120:714–20. doi: 10.1001/archopht.120.6.714. [DOI] [PubMed] [Google Scholar]
  • 11.Herndon LW, Weizer JS, Stinnett SS. Central corneal thickness as a risk factor for advanced glaucoma damage. Arch Ophthalmol. 2004;122:17–21. doi: 10.1001/archopht.122.1.17. [DOI] [PubMed] [Google Scholar]
  • 12.Hewitt AW, Cooper RL. Relationship between corneal thickness and optic disc damage in glaucoma. Clin Experiment Ophthalmol. 2005;33:158–63. doi: 10.1111/j.1442-9071.2005.00971.x. [DOI] [PubMed] [Google Scholar]
  • 13.Medeiros FA, Sample PA, Zangwill LM, Bowd C, Aihara M, Weinreb RN. Corneal thickness as a risk factor for visual field loss in patients with preperimetric glaucomatous optic neuropathy. Am J Ophthalmol. 2003;136:805–13. doi: 10.1016/s0002-9394(03)00484-7. [DOI] [PubMed] [Google Scholar]
  • 14.Kim JW, Chen PP. Central corneal pachymetry and visual field progression in patients with open-angle glaucoma. Ophthalmology. 2004;111:2126–32. doi: 10.1016/j.ophtha.2004.04.029. [DOI] [PubMed] [Google Scholar]
  • 15.Leske MC, Heijl A, Hyman L, Bengtsson B, Dong L, Yang Z. Predictors of long-term progression in the early manifest glaucoma trial. Ophthalmology. 2007;114:1965–72. doi: 10.1016/j.ophtha.2007.03.016. [DOI] [PubMed] [Google Scholar]
  • 16.Dimasi DP, Burdon KP, Craig JE. The genetics of central corneal thickness. Br J Ophthalmol. 2010;94:971–6. doi: 10.1136/bjo.2009.162735. [DOI] [PubMed] [Google Scholar]
  • 17.Leite MT, Alencar LM, Gore C, Weinreb RN, Sample PA, Zangwill LM, Medeiros FA. Comparison of corneal biomechanical properties between healthy blacks and whites using the Ocular Response Analyzer. Am J Ophthalmol. 2010;150:163–8.e1. doi: 10.1016/j.ajo.2010.02.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Racette L, Liebmann JM, Girkin CA, Zangwill LM, Jain S, Becerra LM, Medeiros FA, Bowd C, Weinreb RN, Boden C, Sample PA. ADAGES Group. African Descent and Glaucoma Evaluation Study (ADAGES): III. Ancestry differences in visual function in healthy eyes. Arch Ophthalmol. 2010;128:551–9. doi: 10.1001/archophthalmol.2010.58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Dimasi DP, Chen JY, Hewitt AW, Klebe S, Davey R, Stirling J, Thompson E, Forbes R, Tan TY, Savarirayan R, Mackey DA, Healey PR, Mitchell P, Burdon KP, Craig JE. Novel quantitative trait loci for central corneal thickness identified by candidate gene analysis of osteogenesis imperfecta genes. Hum Genet. 2010;127:33–44. doi: 10.1007/s00439-009-0729-3. [DOI] [PubMed] [Google Scholar]
  • 20.Vitart V, Bencic G, Hayward C, Herman JS, Huffman J, Campbell S, Bucan K, Navarro P, Gunjaca G, Marin J, Zgaga L, Kolcic I, Polasek O, Kirin M, Hastie ND, Wilson JF, Rudan I, Campbell H, Vatavuk Z, Fleck B, Wright A. New loci associated with central cornea thickness include COL5A1, AKAP13 and AVGR8. Hum Mol Genet. 2010;19:4304–11. doi: 10.1093/hmg/ddq349. [DOI] [PubMed] [Google Scholar]
  • 21.Levy SG, Moss J, Sawada H, Dopping-Hepenstal PJ, McCartney AC. The composition of wide-spaced collagen in normal and diseased Descemet's membrane. Curr Eye Res. 1996;15:45–52. doi: 10.3109/02713689609017610. [DOI] [PubMed] [Google Scholar]
  • 22.Hopfer U, Fukai N, Hopfer H, Wolf G, Joyce N, Li E, Olsen BR. Targeted disruption of Col8a1 and Col8a2 genes in mice leads to anterior segment abnormalities in the eye. FASEB J. 2005;19:1232–44. doi: 10.1096/fj.04-3019com. [DOI] [PubMed] [Google Scholar]
  • 23.Puk O, Dalke C, Calzada-Wack J, Ahmad N, Klaften M, Wagner S, de Angelis MH, Graw J. Reduced corneal thickness and enlarged anterior chamber in a novel ColVIIIa2G257D mutant mouse. Invest Ophthalmol Vis Sci. 2009;50:5653–61. doi: 10.1167/iovs.09-3550. [DOI] [PubMed] [Google Scholar]
  • 24.Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D, Maller J, Sklar P, de Bakker PI, Daly MJ, Sham PC. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007;81:559–75. doi: 10.1086/519795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Leite MT, Alencar LM, Gore C, Weinreb RN, Sample PA, Zangwill LM, Medeiros FA. Comparison of corneal biomechanical properties between healthy blacks and whites using the Ocular Response Analyzer. Am J Ophthalmol. 2010;150:163–8.e1. doi: 10.1016/j.ajo.2010.02.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Biswas S, Munier FL, Yardley J, Hart-Holden N, Perveen R, Cousin P, Sutphin JE, Noble B, Batterbury M, Kielty C, Hackett A, Bonshek R, Ridgway A, McLeod D, Sheffield VC, Stone EM, Schorderet DF, Black GC. Missense mutations in COL8A2, the gene encoding the alpha2 chain of type VIII collagen, cause two forms of corneal endothelial dystrophy. Hum Mol Genet. 2001;10:2415–23. doi: 10.1093/hmg/10.21.2415. [DOI] [PubMed] [Google Scholar]
  • 27.Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7:248–9. doi: 10.1038/nmeth0410-248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31:3812–4. doi: 10.1093/nar/gkg509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ferrer-Costa C, Gelpí JL, Zamakola L, Parraga I, de la Cruz X, Orozco M. PMUT: a web-based tool for the annotation of pathological mutations on proteins. Bioinformatics. 2005;15:3176–8. doi: 10.1093/bioinformatics/bti486. [DOI] [PubMed] [Google Scholar]
  • 30.Gottsch JD, Sundin OH, Liu SH, Jun AS, Broman KW, Stark WJ, Vito EC, Narang AK, Thompson JM, Magovern M. Inheritance of a novel COL8A2 mutation defines a distinct early-onset subtype of fuchs corneal dystrophy. Invest Ophthalmol Vis Sci. 2005;46:1934–9. doi: 10.1167/iovs.04-0937. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang C, Bell WR, Sundin OH, De La Cruz Z, Stark WJ, Green WR, Gottsch JD. Immunohistochemistry and electron microscopy of early-onset fuchs corneal dystrophy in three cases with the same L450W COL8A2 mutation. Trans Am Ophthalmol Soc. 2006;104:85–97. [PMC free article] [PubMed] [Google Scholar]
  • 32.Liskova P, Prescott Q, Bhattacharya SS, Tuft SJ. British family with early onset Fuchs endothelial corneal dystrophy associated with p.L450W mutation in the COL8A2 gene. Br J Ophthalmol. 2007;91:1717–8. doi: 10.1136/bjo.2007.115154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mok JW, Kim HS, Joo CK. Q455V mutation in COL8A2 is associated with Fuchs' corneal dystrophy in Korean patients. Eye. 2009;23:895–903. doi: 10.1038/eye.2008.116. [DOI] [PubMed] [Google Scholar]
  • 34.Aldave AJ, Bourla N, Yellore VS, Rayner SA, Khan MA, Salem AK, Sonmez B. Keratoconus is not associated with mutations in COL8A1 and COL8A2. Cornea. 2007;26:963–5. doi: 10.1097/ICO.0b013e31811dfaf7. [DOI] [PubMed] [Google Scholar]
  • 35.Afshari NA, Li YJ, Pericak-Vance MA, Gregory S, Klintworth GK. Genome-wide linkage scan in fuchs endothelial corneal dystrophy. Invest Ophthalmol Vis Sci. 2009;50:1093–7. doi: 10.1167/iovs.08-1839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Aldave AJ, Rayner SA, Salem AK, Yoo GL, Kim BT, Saeedian M, Sonmez B, Yellore VS. No pathogenic mutations identified in the COL8A1 and COL8A2 genes in familial Fuchs corneal dystrophy. Invest Ophthalmol Vis Sci. 2006;47:3787–90. doi: 10.1167/iovs.05-1635. [DOI] [PubMed] [Google Scholar]
  • 37.Hemadevi B, Srinivasan M, Arunkumar J, Prajna NV, Sundaresan P. Genetic analysis of patients with Fuchs endothelial corneal dystrophy in India. BMC Ophthalmol. 2010;10:3. doi: 10.1186/1471-2415-10-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kobayashi A, Fujiki K, Murakami A, Kato T, Chen LZ, Onoe H, Nakayasu K, Sakurai M, Takahashi M, Sugiyama K, Kanai A. Analysis of COL8A2 gene mutation in Japanese patients with Fuchs' endothelial dystrophy and posterior polymorphous dystrophy. Jpn J Ophthalmol. 2004;48:195–8. doi: 10.1007/s10384-003-0063-6. [DOI] [PubMed] [Google Scholar]
  • 39.Tomidokoro A, Araie M, Iwase A, Tajimi Study Group. Corneal thickness and relating factors in a population-based study in Japan: the Tajimi study. Am J Ophthalmol. 2007;144:152–4. doi: 10.1016/j.ajo.2007.02.031. [DOI] [PubMed] [Google Scholar]
  • 40.Mercieca K, Odogu V, Fiebai B, Arowolo O, Chukwuka F. Comparing central corneal thickness in a sub-Saharan cohort to African Americans and Afro-Caribbeans. Cornea. 2007;26:557–60. doi: 10.1097/ICO.0b013e3180415d90. [DOI] [PubMed] [Google Scholar]
  • 41.Friedman DS, Jampel HD, Muñoz B, West SK. The prevalence of open-angle glaucoma among blacks and whites 73 years and older: the Salisbury Eye Evaluation Glaucoma Study. Arch Ophthalmol. 2006;124:1625–30. doi: 10.1001/archopht.124.11.1625. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES