Erratum to: Occult hepatitis B in blood donors in Indonesia: altered antigenicity of the hepatitis B virus surface protein

Erratum to: Hepatol Int DOI 10.1007/s12072-010-9203-5

In the above-mentioned article,

1. There are some missing sentences in the section “Background” of the paper. The last two sentences should read as below:

   The prevalence of OBI is not well documented in Indonesia although such information is urgently needed. To explore the extent of this problem, this initial study was performed with aims to evaluate the prevalence of occult hepatitis B in blood donors from two cities in Indonesia, to analyze the genetic characteristics of HBV, and to study the effect of the genetic alteration of HBV DNA on the predicted antigenicity of HBsAg.

1. Table 1: In the column "References", the numbers of the references were incorrectly stated. The correct Table 1 should have appeared as shown below.

Table 1.

HBV DNA-specific primers used in nested PCR, clone analysis, and sequencing

Primer	Nucleotide sequence (5′ → 3′)	Nucleotide positiona	Polarity	References
S2-1	CAAGGTATGTTGCCCGTTTG	455–474	Sense	[11]
S088	TGTTGCCCGTTTGTCCTCTA	462–471	Sense	[12]
S1-2	GCCATTTGTTCAGTGGTTCG	685–704	Antisense	[11]
S2-2	TGGCTCAGTTTACTAGTGCC	668–687	Antisense	[11]
PS8-1	GTCACCATATTCTTGGGAAC	2817–2836	Sense	[13]
HS6-2	GCCAAGTGTTTGCTGACGCA	1175–1194	Antisense	[13]
HS4-2	CCTATTGATTGGAAGGTGTG	970–989	Antisense	[13]
T728	GGAATCAAACCTTATTATCC	2688–2707	Sense	[13]
T703	CAGAGTCTAGACTCGTGGTG	242–261	Antisense	[13]
PS5-2	CTCGTGTTACAGGCGGGGTT	191–210	Antisense	[13]
M13F	GCCAGGGTTTTCCCAGTCACGAC	2949–2972	Sense
M13R	GTCATAGCTGTTTCCTGTGTGA	176–197	Antisense

^aBased on EcoRI site numbering