Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jan 1.
Published in final edited form as: Cancer. 2010 Aug 24;117(1):86–95. doi: 10.1002/cncr.25522

Putative tumor suppressor miR-145 inhibits colon cancer cell growth by targeting oncogene Friend leukemia virus integration 1

Jianjun Zhang 1,*, Haiyan Guo 1,*, He Zhang 1,2, Haibo Wang 1,2, Guanxiang Qian 1, Xianqun Fan 1, Andrew R Hoffman 2, Ji-Fan Hu 2, Shengfang Ge 1,3
PMCID: PMC2995010  NIHMSID: NIHMS218117  PMID: 20737575

Abstract

Tumor suppressor microRNA miR-145 is commonly down-regulated in colon carcinoma tissues, but its specific role in tumors remains unknown. In this study, we identify the Friend leukemia virus integration 1 gene (Fli-1) as a novel target of miR-145. Fli-1 is involved in t(11;22)(q24:q12) reciprocal chromosomal translocation in Ewing sarcoma, and its expression appears to be associated with biologically more aggressive tumors. We demonstrate that miR-145 targets a putative microRNA regulatory element (MRE) in the 3′-UTR of Fli-1, and its abundance is reversely associated with Fli-1 expression in colon cancer tissues and cell lines. Using a luciferase/Fli-1 3′-UTR reporter system, we found that miR-145 down-regulated the reporter activity, and this down-regulation was reversed by anti-miR-145. Mutation of the miR-145 MRE sequence in the Fli-1 3′-UTR abolished the activity of miR-145. miR-145 decreased Fli-1 protein but not the Fli-1 mRNA, suggesting a mechanism of translational regulation. Furthermore, we demonstrate that miR-145 inhibited cell proliferation and sensitized LS174T cells to 5-fluorouracil-induced apoptosis. Taken together, these results suggest that miR-145 functions as a tumor suppressor by down-regulating oncogenic Fli-1 in colon cancer.

Keywords: miR-145, Fli-1, microRNA, colon cancer, cell proliferation, tumor suppressor

INTRODUCTION

MicroRNAs (miRNAs) are endogenously expressed noncoding RNAs, 18–25 nucleotides in length, that play important regulatory functions by targeting specific mRNAs 1-3 and/or gene promoters 4, 5. They have been implicated as regulatory elements in many cellular processes, including development, heterochromatin formation, and genomic stability in eukaryotes. Most notably, each miRNA may control hundreds of gene targets 6, 7 that are involved in disease development. Although the number of verified human miRNAs is still expanding, physiological functions have been determined for only a few of these molecules.

Emerging evidence suggests potential roles of miRNA as either tumor suppressors or oncogenes 8-12. miR-145, a putative tumor suppressing miRNA, is down-regulated in a variety of solid tumors, including lung cancer, colorectal cancer, breast cancer, prostate cancer, ovarian cancer, hepatocellular carcinoma, corticotropinoma, and cervical cancer 13-18. Down-regulation of miR-145 has been demonstrated in the lungs of animals exposed to cigarette smoking 19, supporting its involvement in cancer pathogenesis. miR-145 has been associated with inhibition of tumor cell growth both in vitro and in vivo by specifically silencing c-Myc or IRS-1 20, 21. In addition, mir-145 has been implicated in the exertion of antineoplastic effects in the lung 22 and the inhibition of cell proliferation of a wide range of tumor cells 14, 16, 20, 23, including DLD-1, SW480, HCT116, and LS174T.

Elucidation of the genes targeted by miR-145 has been examined using bioinformatic and proteomic techniques. The insulin receptor substrate-1 (IRS-1) gene was first evaluated as a potential miR-145 target based on its well-characterized role in tumor biology 21. IRS-1, a docking protein for both the type 1 insulin-like growth factor receptor and the insulin receptor, delivers mitogenic, anti-apoptotic, and anti-differentiation signals 24-26. As a direct functional mediator of p53, miR-145 also downregulates proto-oncogene c-Myc 20, whose aberrant expression is associated with aggressive and poorly differentiated tumors 27.

In this study, we identified the Friend leukemia virus integration 1 gene (Fli-1) as a clinically significant target for miR-145. Fli-1 has been shown to play an oncogenic role in the promotion of the malignant phenotype. Aberrant expression of Fli-1 has been recognized as a seminal event in the initiation of certain types of malignant transformation. The etiology of a number of virally induced leukemias and of Ewing’s sarcoma has been associated with Fli-1 overexpression 28, 29. Using reporter and functional assays, we demonstrate that miR-145 down-regulates Fli-1 by targeting its 3′-UTR, specifically at the microRNA regulatory element (MRE) of Fli-1. By decreasing Fli-1 protein levels, miR-145 inhibits cell proliferation in human colon cancer cells and sensitizes LS174T colon cancer cells to 5-FU-induced apoptosis.

RESULTS

Identification of a MRE in the 3′UTR of Fli-1 as a novel target of miR-145

To study the role of miR-145 in tumors, we initiated a screening of its putative gene targets using three different computational methods: Target Scan program, Miranda program and PicTar (4-way) program. Using these bioinformatics prediction models, we initially obtained over 977 miR-145 targets from the Miranda target search program, over 396 targets from the Target Scan program, and over 326 targets from the PicTar (4-way) (data not shown), which was far more than the average prediction of about 100 target genes per single miRNA7. Only a small fraction of predicted targets are true miR-145 targets. Thus, we attempted to improve the prediction accuracy by integrating the data acquired from all three of the above mentioned programs using miRGen Target program, obtaining roughly 47 targets for miR-145 (data not shown). Among them, five genes containing seven putative binding sites (MREs, Table 1) in the gene structure were chosen for further study, including C11orf9, Fli-1, CPEB4, FZD7, and CBFB.

Table 1.

Potential miR-145 gene candidates as predicted by three computational methods

Gene Description Putative binding site (MRE)*
C11orf9 chromosome 11 open reading
frame 9		 ACCCGAGACUGGUGAAACUGGAA
|||| |||||||		 143
UUCCCUAAGGACCCUUUUGACCUG miR-145
GGGCCCUCAGUCCUUAACUGGAA
|||  |||||||		 1746
UUCCCUAAGGACCCUU---UUGACCUG miR-145
Fli-1 Friend leukemia virus
integration 1		 UUGAAGGGAAGACAA----AACUGGAU
||||||  |||||||		 94
UUCCCUAAGGACCCUUUUGACCUG miR-145
GUGAAGUUUUCACCC---AACUGGAA
|||  |||||||		 519
UUCCCUAAGGACCCUUUUGACCUG miR-145
CPEB4 cytoplasmic polyadenylation
element binding protein 4		 UACACUUGUAGCCAAAACUGGAA
||  |||||||		 1078
UUCCCUAAGGACCCUU---UUGACCUG miR-145
FZD7 Frizzled-7 precursor (Fz-7)
(hFz7) (FzE3)		 UUUUCACUGGGGCCAAACUGGAG
||||| |||||||		 525
UUCCCUAAGGACCCUU--UUGACCUG miR-145
CBFB Core-binding factor subunit beta
(CBF-beta)		 UGUAACAGCAUAUUAAACUGGAG
|||||||		 999
UUCCCUAAGGACCCUUUUGACCUG miR-145
Open in a new tab
*

Putative MREs are shown 5′–3′ in uppercase with the last nucleotide numbered as in GenBank; miR-145 is shown in lowercase from 3′–5′.

Among these five selected genes, C11orf9 belongs to a previously uncharacterized family of transcription factors and is strongly induced in invasive or metastatic tumor cells30. Fli-1 is overexpressed in virally induced leukemias and in Ewing’s sarcoma as a result of a characteristic t(11;22)(q24:q12) reciprocal chromosomal translocation31, 32. CPEB is a sequence-specific RNA-binding protein that mediates many processes including germ-cell development, cell division and cellular senescence33. Up-regulated FZD7 leads to activation of the WNT-beta-catenin-TCF pathway in human gastric cancer34. Similarly, the over-expressed transcription factor CBFB is an independent predictor of tumor survival in colorectal cancer patients35.

We chemically synthesized these seven microRNA regulatory elements (MREs) and tested their functions by cloning them into the Xba1 site of pGL3 reporter vector (Fig.1A), downstream of the reporter gene luciferase. To test the response of each MRE to miR-145, luciferase/MRE constructs were co-transfected with miR-145 into 293T cells. Using this reporter system, miR-145-responsive MREs were identified by simply measuring luciferase activity. Two MREs were located in Fli-1 mRNA: an upstream (−94) and a downstream (−519) sites. As shown in Figure 1B, only the downstream Fli-1 MRE (Fli-1-519) responded to miR-145. Notably, luciferase reporter activity decreased more than 50% when the Fli-1 MRE was inserted at the 3′UTR of the reporter gene in Luc-Fli-1-519 construct. The upstream Fli-1 MRE (Fli-1-94), however, did not respond to miR-145. The Fli-1-519, referred as Fli-1 MRE, was thus used for further study.

Figure 1.

Figure 1

Open in a new tab

Identification of Fli-1 as a novel gene target of miR-145.

A. Schematic diagram of luciferase/Fli-1 reporter construct. Putative microRNA regulatory elements (MREs) predicted by bioinformatics were cloned into the 3′UTR of luciferase gene at Xba1 site.

B. Regulation of reporter gene expression by miR-145 MRE. 293T cells were cotransfected with a luciferase reporter containing miR-145 MRE. Twenty-four hours later, luciferase activity was measured. Renilla luciferase was used as an internal control. The experiments were performed in triplicates and are shown as mean ± SD, *: P < 0.05.

Specific targeting of the Fli-1 MRE by miR-145

Using a luciferase reporter system, we then assessed whether the putative binding sites for miR-145 altered the activity of the upstream luciferase reporter gene. With the luciferase/Fli-1 MRE system, we found that the inhibition of the luciferase activity by miR-145 was dose-dependent (Fig.2A). To test the specificity of miR-145, we co-transfected cells with an RNAi inhibitor (anti-miR-145) that is an authentic blocker of miR-145. We showed that anti-miR-145 specifically abolished the miR-145 induced-inhibition of luciferase activity (Fig.2B).

Figure 2.

Figure 2

Open in a new tab

Specificity of Fli-1 microRNA regulatory element for miR-145.

A. Dose-dependent suppression of Luc-Fli-1-519 by miR-145. 293T cells were transfected with various amounts of miR-145 precursor.

B. Effectiveness of miR-145 inhibitor on luciferase activity of Luc-Fli-1-519. As show, miR-145 inhibitor increased the luciferase activity.

C. Schematic diagram of Luc-Fli-1-3′UTR-Mutation. For Luc-Fli-1-3′UTR-M, eight nucleotides (AACUGGAA) were changed with GGTGATCG. W: Wild; M: Mutation.

D. Reporter mutation analysis. Downregulation of reporter gene with full-length 3′UTR from Fli-1 was apparent, whereas no effect on the Luc-Fli-1-3′UTR-Mutation was detected.

All experiments were performed in triplicates and are shown as mean ± SD. *: P<0.05.

To further demonstrate the importance of the Fli-1 MRE, a substitution mutation was generated to test its activity. In the Fli-1-3′UTR-M vector, eight nucleotides (AACUGGAA) were replaced with GGTGATCG (Fig.2C). We cloned the full-length of the Fli-1 3′-UTR downstream of the reporter. As expected, down-regulation of reporter activity was detected in the construct that contains the full length of the Fli-1 3′-UTR. Correspondingly, we demonstrated that the mutation in the MRE abolished the miR-145-mdieated inhibition of the reporter gene (Fig.2D). Taken together, these data suggest that the miR-145 binding site present in the Fli-1 3′UTR is critical for miR-145-mediated gene regulation.

Fli-1 is reversely expressed with miR-145 in colon tumor tissues

To seek the link between miR-145 and Fli-1, we measured the endogenous expression of mirR-145 and Fli-1 in colon cancer tissues and LS174T cells. We used Northern blotting to examine the expression of miR-145 in paired colon tumors and adjacent normal tissues collected from the same patients. Expression of miR-145 was also examined in three human colon cancer cell lines, LS174T, SW620, and HCT116 cells. As seen in typical samples in Figure 3A, colon cancer tissues showed a significant decrease in mature miR-145 abundance in comparison with the paired adjacent non-tumor tissues. Three colon cancer cell lines also showed down-regulation of miR-145, especially in LS174T cells. The low abundance of miR-145 in colon tumor tissues is consistent with a potential suppressor role of the miRNA in cancer development.

Figure 3.

Figure 3

Figure 3

Open in a new tab

Reverse expression of endogenous miR-145 (A) and Fli-1 (B) in colon tumor tissues and colon cancer cell lines. Northern blotting was performed to quantitate miR-145 from seven pairs of adjacent colon and colon tumor tissues and three human colon cancer cell lines: LS174T, SW620 and HCT116 cells. The abundance of Fli-1 mRNA was measured by RT-PCR. S = samples, T = tumors, N = adjacent non-tumor tissues. GAPDH and U2snRNA were used as the quantitation control.

In contrast, the Fli-1 was over-expressed in same colon tumor tissues and LS174T cells (Fig.3B), where miR-145 was down-regulated. The inverse correlation suggests that miR-145 and Fli-1 are coordinately regulated in the development of tumors.

miR-145 regulates Fli-1 at the translational level

Translational repression is a major mechanism of miRNAs to regulate gene expression in mammalian36. To determine whether miR-145 utilizes the same mechanism, LS174T cells that express very little miR-145 but overexpress Fli-1 were tranfected with miR-145 or its inhibitor. The ectopic expression of miR-145 was confirmed by Hairpin-it™ miRNAs Real-Time PCR Quantitation Assay. As expected, about 3-fold increase in mature miR-145 was detected in the miR-145 precursor-transfected cells (Fig.4A). In contrast, transfection with anti-miR-145 reduced miR-145 by almost 50% in LS174T cells (Fig.4B).

Figure 4.

Figure 4

Figure 4

Open in a new tab

Regulation of endogenous Fli-1 expression by miR-145

A-B: Detection of mature miR-145 in LS174T cells transfected with miR-145 precursor and inhibitor. Expression of mature miR-145 in LS174T cells was quantitated 48 hours after transfection of miR-145 precursor (A) or inhibitor (B) by Hairpin-it™ miRNAs Real-Time PCR Quantitation Assay. Assays were performed in triplicates and are shown as mean ± SD. *: P<0.05.

C. The Fli-1 expression in protein levels is changed significantly by miR-145. LS174T cells were transfected with miR-145 precursor or inhibitor. Fli-1 protein levels were analyzed by western blotting. At 48 hours after transfection, Fli-1 protein level was significantly decreased in cells transfected with miR-145 precursor.

D-E. The Fli-1 mRNA levels in LS174T cells transfected with miR-145 precursor (D) or inhibitor (E). Fli-1 mRNA levels were analyzed by real-time PCR. Transcript levels did not change significantly at either 24 h or 48 h after transfection. All experiments were performed in triplicates and are shown as mean ± SD.

We then measured the miR-145 target gene Fli-1 in the transfected LS174T cells. Ectopic expression of miR-145 significantly reduced Fli-1 protein at 48 hours (Fig.4C, lane 2). This inhibition was abolished in naïve cells by the antagonism of miR-145 using miR-145 inhibitor (Fig.4C, lane 4). However, we did not detect the inhibition of Fli-1 at the mRNA level as measured by real-time PCR (Fig.4D). Similarly, neither was Fli-1 mRNA affected by miR-145 inhibitor (Fig.4E). These results suggest that miR-145 targets Fli-1 by functioning on translational regulation.

miR-145 sensitizes LS174T cells to apoptosis

We were then interested in whether this down-regulation of Fli-1 by miR-145 was able to affect tumor cell growth. miR-145 and Fli-1 siRNA were transfected in LS174T cells that expressed low miR-145 but high Fli-1. The cell growth was determined at different time point after transfection by WST-8 assays. As shown in Figure 5A, tranfection with miR-145 inhibited cell proliferation as compared with control cells. Similarly, blockage of the miR-145 target gene Fli-1 using siRNA also deceased tumor cell growth. In general, tumor cells transfected with miR-145 grew much more slowly than those with control miRNA in parallel with the down-regulation of Fli-1 proteins (Fig.5B).

Figure 5.

Figure 5

Open in a new tab

Effect of miR-145 and siRNA/Fli-1 on the Growth of LS174T Cells.

A. Growth inhibition of LS174T cells cultured under miR-145 precursor or siRNA/Fli-1–deprived conditions in vitro. Experiments were performed in triplicates and data are shown as mean ± SD. The cell growth was determined at different time point after transfection by WST-8 assays. As show, miR-145 was even better than the siRNA in inhibiting cell proliferation. No tx: non transfection.

B. Western blotting showing that Rb and Bcl-2 protein level is changed by transfecting LS174T cells with miR-145 precursor or siRNA for Fli-1 (siRNA/Fli-1) as compared with control precursor or control siRNA.

C. Effect of miR-145 on sensitizing LS174T cells to 5-FU-induced apoptosis. Enhanced apoptosis were assessed by FACS at 48 hours. Note that miR-145 was as effectively as siRNA in sensitizing cells to 5-FU-induced apoptosis. Blank: only with DMEM medium containing 10% FBS; Ctrl pre: control precursor; miR-145 pre: miR-145 precursor; Ctrl siRNA: control siRNA; siRNA: siRNA/Fli-1. Assays were performed in triplicates and are shown as mean ± SD. *: P<0.05.

As an initial step to delineate the role of miR-145, we also measured additional two genes, RB and Bcl-2, which are commonly involved in the regulation of cell growth. We found that decreased expression of Fli-1 by miR-145 and Fli-1 siRNA was also associated with upregulated Rb and downregulated Bcl-2 (Fig.5B). Altered expression of Rb and Bcl-2 protein may contribute to the inhibition of LS174T cell proliferation.

We speculated that down-regulation of the anti-apoptotic Bcl-2 would enhance apoptosis and would sensitize tumor cells to colon cancer chemotherapy drugs, such as 5-Fluorouracil (5-FU). We thus assessed apoptosis by FACS following the co-treatment of miR-145 and 5-FU. As shown in Figure 5C, inhibition of Fli-1 by either miR-145 or Fli-1 siRNA sensitized cells to 5-FU-induced apoptosis. We detected a about 2-fold increase in apoptosis induction by miR-145 as compared with the 5-FU alone. These data further support miR-145 as a tumor suppressor by participating in apoptosis regulation.

DISCUSSION

Aberrant expression of miR-145 tumor suppressor has been implicated in a variety of cellular pathways involved in carcinogenesis. However, the exact role of miR-145 in tumorigenesis is still unclear, largely due to limited knowledge about miR-145 targets. In this study, we used bioinformatics prediction models to identify Fli-1 as a novel target of miR-145 in tumors. In our colon cancer samples, the increased expression of the Fli-1 gene in colon tumors was in parallel with the decreased miR-145. Using a luciferase reporter system, we showed that the miR-145 binding site present in the Fli-1 3′UTR region is critical for miR-145-mediated regulation.

Fli-1 has been well studied to act as an oncogene in the tumor development, especially in Ewing’s sarcoma. The etiology of a number of virally induced leukemias as well as human Ewing′s sarcoma has been associated with Fli-1 overexpression37, 38. The rate-limiting oncogenic mutation in Ewing’s sarcoma has been identified as a chromosomal translocation, t(11;22)(q24;q12), that leads to the expression of a chimeric transcription factor, EWS-Fli128, 29. Ectopic expression of Fli-1 has also been shown to be associated with decreased expression of Rb, decreased expression of GATA-1 and increased expression of Bcl-2, possibly leading to a block in apoptosis and differentiation 31, 37-40. Aberrant expression of the Fli-1 has been recognized as a seminal event in the initiation of certain types of malignant transformation. Indeed, the etiology of a number of virally induced leukemias, including Friend virus-induced erythroleukemia, has been associated with Fli-1 overexpression37. The clinical relevance of Fli-1 becomes apparent in human Ewing’s sarcoma in which Fli-1 is the target of a characteristic chromosomal translocation38. Fli-1 is expressed at high levels in F-MuLV-induced erythroleukemias41, malignant melanoma, small cell carcinomas of the lung and adenocarcinomas42, 43.

However, the role of Fli-1 in colon cancer, especially its link with miR-145, has not been explored. We wished to examine how Fli-1 was regulated by miR-145. Ectopic expression of miR-145 significantly reduced Fli-1 protein at 48 hours in LS174T cells (Fig.4C) and this inhibition was equally efficient to those by using Fl1-1 siRNA (Fig.5B). However, we did not observe any effects on the Fli-1 mRNA level (Figs.4D, 4E). Although miRNAs may regulate protein expression by accelerating messenger RNA degradation2, miR-145 is presumably acting to block translation of Fli-1, which is believed to be the most common mechanism of miRNA targeting44.

It was also important to note that miR-145 was more effective than Fli-1 siRNA in inhibiting LS174T cell proliferation (Fig.5A), in spite of the fact that the downregulation of Fli-1 protein levels by miR-145 was not more effective than the siRNA (Fig.5B). In addition, miR-145 and siRNA have similar effects on sensitizing the LS174T cells to 5-FU-induced apoptosis (Fig.5C). These findings suggest that other miR-145 targets may also play an important role in inhibiting cellular proliferation. In addition, as shown in Figure 5B, decreased expression of Fli-1 by miR-145 is associated with increased expression of Rb and decreased expression of Bcl-2. The altered expression of Rb and Bcl-2 protein may in part account for the role of miR-145 in inhibiting tumor cell growth.

In summary, this study identified Fli-1 as a novel gene target of miR-145 in colon cancers. These results demonstrate that miR-145 acts as a tumor suppressor, targeting the 3′-UTR of Fli-1 mRNA. Down-regulation of Fli-1 has a profound effect on the growth of human colon cancer cells. Its inhibition of growth in colon cancer cells is compatible with the well known ability of Fli-1 in stimulating cell proliferation and transformation. miR-145 regulates Fli-1 at the protein expression level although the specific mechanism requires a further investigation. These studies extend our knowledge concerning Fli-1 as an oncogene involved in colon tumorigenesis, although the specific role needs further investigation. Given that a single miRNA may have multiple targets, we believe that miR-145 also has many other unknown targets. It is our expectation that more miR-145 targets will be identified in the near future to better understand the molecular basis of miR-145-mediated tumorigenesis. In addition, miR-145 as a potential therapeutic molecular in colon cancer and other tumors, like Ewing’s sarcoma , may merit further investigation.

EXPERIMENTAL PROCEDURES

Materials and reagents

Three human colon carcinoma cell lines were used for this study, including LS174T (Dukes’ type B colon cancer), SW620 (Dukes’ type C colon cancer), and HCT116 (Dukes’ type D colon cancer). All cell lines were obtained from American Type Culture Collection (ATCC, VA). Cells were maintained in DMEM (Invitrogen, CA) supplemented with 10% fetal bovine serum. All cells were incubated at 37°C in a humidified chamber supplemented with 5% CO2. Colon carcinoma specimens and adjacent nontumorous tissues were collected at Renji hospital, Shanghai, China. Patients, aged 44 to 75 years, were diagnosed as Duke’s stage C colon cancers. Fresh tissues were obtained after surgical resection and immediately placed in liquid nitrogen.

All miRNA and RNAi constructs used for cell transfection, including miR-145 precursor, RNAi inhibitor (anti-miR-145), and control RNAi (miR-CT, anti-miR-CT), were purchased from Ambion (Austin, TX) and sequences were listed in website: http://www.ambion.com/techlib/resources/miRNA/index.html). Hairpin-it™ miRNAs Real-Time PCR Quantitation Kits were obtained from GenePharma (Shanghai, China). SYBR Premix Ex Taq™ (perfect Real Time) was purchased from Takara Bio (Madison, WI). Fli-1 antibody, Bcl2 antibody and Rb antibody were purchased from ProteinTech Group Inc (Chicago, IL). Cell Counting Kit (CCK-8) was purchased from Dojindo Laboratories (Kumamoto, Japan), and 5-fluorouracil (5-FU) was from Sigma (Milwaukee, WI).

Cell transfection

Transfection of cells was performed with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. Briefly, the cells were seeded in 6-well plates at 30% confluence the day before transfection. miR-145 precursor, miR-145 inhibitor, and microRNA control (50 nM each), were used for each transfection.

Northern blotting assay of miR-145

We collected tumor and adjacent non-tumor samples from colon cancer patients. Total microRNA was extracted with mirVana™ miRNA Isolation kit (Ambion, Austin, TX) using the microRNA enrichment protocol. Mature miR-145 was measured by Northern blotting using a NorthernMax-Gly Kit (Ambion, Austin, TX), following the protocol provided by the manufacturer. Briefly, after RNA electrophoresis, the transferred membrane was prehybridized with ULTRAhyb, and detected with a miR-145-specific oligonucleotide probe labeled with digoxigenin-ddUTP using DIG Oligonucleotide 3′-End Labeling Kit (Roche Diagnostics, Indianapolis, IN).

Quantitation by Real-Time PCR

Hairpin-it™ miRNAs Real-Time PCR Quantitation Kit uses a stem loop approach to detect expression of mature miR-145. For the reverse transcript reaction, 200 ng of total RNA was used and mixed with the miR-145 RT primer. The reaction was carried out at the following conditions: 30 min at 16°C, 30 min at 42°C, 5 min at 85°C, and then held on 4°C. For the PCR reaction, 2 μl cDNA products were used along with miR-145 specific primer set. The PCR reaction was conducted at 94°C for 3 min, followed by 45 cycles of 94°C for 20 sec, 50°C for 25 sec and 72°C for 20 sec in Rotogene 3000 real time PCR system. U6 RNA was used for normalization.

To detect relative levels of Fli-1 mRNA, Real-Time PCR was performed using the SYBR method at the following conditions: 95°C 30 s, 1 cycle; 95 °C 5 s, 60 °C 20s, 72 °C 15 s, 40 cycles. PCR primers were Fli-1 sense, 5′-CAG TCG CCT AGC CAA CCC TG and antisense, 5′-GCA ATG CCG TGG AAG TCA AAT.

Bioinformatic prediction of miR-145 targets

Putative miR-145 targets were predicted by the Target Scan program (http://www.targetscan.org), the miRanda program (http://microrna.sanger.ac.uk), and PicTar (4-way) program (http://pictar.bio.nyu.edu)45-47. The data obtained from above mentioned three programs was integrated with miRGen Target program (http://www.diana.pcbi.upenn.edu/miRGen.html)48.

Plasmid construction

Following bioinformatic analysis, the putative microRNA regulatory element (MREs, Table 1) of miR-145 was chemically synthesized and cloned into pGL3 control vector (Promega) at Xba1 site. To construct the Luc-Fli-1-3′UTR-Full vector, full length 3′UTR of Fli-1 was amplified from the cDNA of LS174T cells using Fli-1 PCR primers: sense 5′ CTA GAG AAG CCC ATC CTG CAC ACT 3′ and antisense 5′ CTA GAC GTT GTT TTT CCC AGA GCT 3′, and then cloned into the pGL3 control vector at Xba1 site. To create the mutated Fli-1-3′UTR vector, eight nucleotides (GUG AAG UUU UCA CCC ggt gat cg) were changed for the reporter construct.

Luciferase assay

293T cells were seeded in 24-well plates and transfected with luciferase reporters containing the putative MRE for miR-145, miR-145 precursor, and miR-145 inhibitor. Transfection efficiency was corrected by a renilla luciferase vector (pRL-CMV, Promega). The cells were harvested for luciferase assays 24 hour after transfection. A luciferase assay kit (Promega, Madison, WI) was used to measure the reporter activity according the manufacturer’s protocol.

Western blotting assay

Total protein was isolated from LS174T cells transfected with miR-145 precursor or inhibitor. Protein concentration was measured using Pierce BCA Protein Assay Reagent (Thermo-Fisher Scientific, Rockford, IL). Cell lysates (50μg) were electrophoresed through 10% polyacrylamide gels and transferred to a NC membrane. The membrance was incubated with Fli-1 antibody, Bcl2 antibody or Rb antibody. Secondary antibodies were labeled with IRDyes. Signals were visualized using an Odyssey Infrared Imaging System.

Cell proliferation assay

Measurement of viable cell mass was performed with Cell Counting Kit that counts living cells using WST-8. According to the protocol, one hundred microliters of LS174T cells treated with 50 nM miR-145 precursor or 100 nM siRNA/Fli-1 were plated on 96-well plates. Ten microliters of Cell Counting Assay Kit-8 solution was added to each well, and the absorbance was measured at 450 nm using a microplate reader. The amount of the formazan dye, generated by the activities of dehydrogenases in cells, is directly proportional to the number of living cells.

Cell apoptosis assay

LS174T cells were transfected with 50 nM miR-145 precursor or 100 nM siRNA/Fli-1 for 24 h, and then treated with 10 μmol/L 5-fluorouracil for 24 h. Cells were harvested and re-suspended with 500 μl of binding buffer. The cell suspension (100 μl) was incubated with 5 μl annexin-V and propidium iodide (PI) at room temperature for 20 min. The stained cells were analyzed with FACS using BD-LSR flow cytometry (BD Biosciences, CA)

ACKNOWLEDGMENTS

This work was supported by The National Key Program for Basic Research of China (2004CB518804), The Science and Technology Commission of Shanghai (08ZR1412500 and 07JC14034) to G.Q.; The Collaborative Grant for basic and applied research of Basic Medical school and Renji Hospital (ZD0702), The Innovation Program of Shanghai Municipal Education Commission (jdy08054, 09ZZ110, S30201) to S.G.; and NIH grant (1R43 CA103553-01), The Department of Defense Grant (W81XWH-04-1-0597) to J.F.H.

Footnotes

G.Q., S.G., and J.F.H. are corresponding and senior authors of this report.

REFERENCES

  • 1.Petersen CP, Bordeleau ME, Pelletier J, Sharp PA. Short RNAs repress translation after initiation in mammalian cells. Mol Cell. 2006;21:533–42. doi: 10.1016/j.molcel.2006.01.031. [DOI] [PubMed] [Google Scholar]
  • 2.Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 2006;20:515–24. doi: 10.1101/gad.1399806. [DOI] [PubMed] [Google Scholar]
  • 3.Zamore PD, Haley B. Ribo-gnome: the big world of small RNAs. Science. 2005;309:1519–24. doi: 10.1126/science.1111444. [DOI] [PubMed] [Google Scholar]
  • 4.Cannell IG, Kong YW, Bushell M. How do microRNAs regulate gene expression? Biochem Soc Trans. 2008;36:1224–31. doi: 10.1042/BST0361224. [DOI] [PubMed] [Google Scholar]
  • 5.Barroso-del Jesus A, Lucena-Aguilar G, Menendez P. The miR-302-367 cluster as a potential stemness regulator in ESCs. Cell Cycle. 2009;8:394–98. doi: 10.4161/cc.8.3.7554. [DOI] [PubMed] [Google Scholar]
  • 6.Wu W, Sun M, Zou GM, Chen J. MicroRNA and cancer: Current status and prospective. Int J Cancer. 2007;120:953–60. doi: 10.1002/ijc.22454. [DOI] [PubMed] [Google Scholar]
  • 7.Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005;3:e85. doi: 10.1371/journal.pbio.0030085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cho WC. OncomiRs: the discovery and progress of microRNAs in cancers. Mol Cancer. 2007;6:60–67. doi: 10.1186/1476-4598-6-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen CZ. MicroRNAs as oncogenes and tumor suppressors. N Engl J Med. 2005;353:1768–71. doi: 10.1056/NEJMp058190. [DOI] [PubMed] [Google Scholar]
  • 10.Cowland JB, Hother C, Gronbaek K. MicroRNAs and cancer. Apmis. 2007;115:1090–106. doi: 10.1111/j.1600-0463.2007.apm_775.xml.x. [DOI] [PubMed] [Google Scholar]
  • 11.Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer. 2006;6:259–69. doi: 10.1038/nrc1840. [DOI] [PubMed] [Google Scholar]
  • 12.Zhang W, Dahlberg JE, Tam W. MicroRNAs in tumorigenesis: a primer. Am J Pathol. 2007;171:728–38. doi: 10.2353/ajpath.2007.070070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cho WC, Chow AS, Au JS. Restoration of tumour suppressor hsa-miR-145 inhibits cancer cell growth in lung adenocarcinoma patients with epidermal growth factor receptor mutation. Eur J Cancer. 2009;1 doi: 10.1016/j.ejca.2009.04.039. in press. [DOI] [PubMed] [Google Scholar]
  • 14.Wang Y, Lee CG. MicroRNA and cancer--focus on apoptosis. J Cell Mol Med. 2009;13:12–23. doi: 10.1111/j.1582-4934.2008.00510.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Widespread deregulation of microRNA expression in human prostate cancer. Oncogene. 2008;27:1788–93. doi: 10.1038/sj.onc.1210809. [DOI] [PubMed] [Google Scholar]
  • 16.Schepeler T, Reinert JT, Ostenfeld MS, Christensen LL, Silahtaroglu AN, Dyrskjot L, et al. Diagnostic and prognostic microRNAs in stage II colon cancer. Cancer Res. 2008;68:6416–24. doi: 10.1158/0008-5472.CAN-07-6110. [DOI] [PubMed] [Google Scholar]
  • 17.Sempere LF, Christensen M, Silahtaroglu A, Bak M, Heath CV, Schwartz G, et al. Altered MicroRNA expression confined to specific epithelial cell subpopulations in breast cancer. Cancer Res. 2007;67:11612–20. doi: 10.1158/0008-5472.CAN-07-5019. [DOI] [PubMed] [Google Scholar]
  • 18.Varnholt H, Drebber U, Schulze F, Wedemeyer I, Schirmacher P, Dienes HP, et al. MicroRNA gene expression profile of hepatitis C virus-associated hepatocellular carcinoma. Hepatology. 2008;47:1223–32. doi: 10.1002/hep.22158. [DOI] [PubMed] [Google Scholar]
  • 19.Izzotti A, Calin GA, Arrigo P, Steele VE, Croce CM, De Flora S. Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke. FASEB J. 2009;23:806–12. doi: 10.1096/fj.08-121384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sachdeva M, Zhu S, Wu F, Wu H, Walia V, Kumar S, et al. p53 represses c-Myc through induction of the tumor suppressor miR-145. Proc Natl Acad Sci U S A. 2009;106:3207–12. doi: 10.1073/pnas.0808042106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shi B, Sepp-Lorenzino L, Prisco M, Linsley P, deAngelis T, Baserga R. Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007;282:32582–90. doi: 10.1074/jbc.M702806200. [DOI] [PubMed] [Google Scholar]
  • 22.Liu X, Sempere LF, Galimberti F, Freemantle SJ, Black C, Dragnev KH, et al. Uncovering growth-suppressive MicroRNAs in lung cancer. Clin Cancer Res. 2009;15:1177–83. doi: 10.1158/1078-0432.CCR-08-1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Akao Y, Nakagawa Y, Naoe T. MicroRNA-143 and -145 in colon cancer. DNA Cell Biol. 2007;26:311–20. doi: 10.1089/dna.2006.0550. [DOI] [PubMed] [Google Scholar]
  • 24.La Rocca G, Badin M, Shi B, Xu SQ, Deangelis T, Sepp-Lorenzinoi L, et al. Mechanism of growth inhibition by MicroRNA 145: The role of the IGF-I receptor signaling pathway. J Cell Physiol. 2009;23:23. doi: 10.1002/jcp.21796. [DOI] [PubMed] [Google Scholar]
  • 25.White MF. The IRS-signaling system: a network of docking proteins that mediate insulin and cytokine action. Recent Prog Horm Res. 1998;53:119–38. [PubMed] [Google Scholar]
  • 26.Gatzka M, Prisco M, Baserga R. Stabilization of the Ras oncoprotein by the insulin-like growth factor 1 receptor during anchorage-independent growth. Cancer Res. 2000;60:4222–30. [PubMed] [Google Scholar]
  • 27.Pelengaris S, Khan M. The many faces of c-MYC. Arch Biochem Biophys. 2003;416:129–36. doi: 10.1016/s0003-9861(03)00294-7. [DOI] [PubMed] [Google Scholar]
  • 28.Uren A, Toretsky JA. Ewing’s sarcoma oncoprotein EWS-FLI1: the perfect target without a therapeutic agent. Future Oncol. 2005;1:521–28. doi: 10.2217/14796694.1.4.521. [DOI] [PubMed] [Google Scholar]
  • 29.Ladanyi M. EWS-FLI1 and Ewing’s sarcoma: recent molecular data and new insights. Cancer Biol Ther. 2002;1:330–36. [PubMed] [Google Scholar]
  • 30.Kiemer AK, Takeuchi K, Quinlan MP. Identification of genes involved in epithelial-mesenchymal transition and tumor progression. Oncogene. 2001;20:6679–88. doi: 10.1038/sj.onc.1204872. [DOI] [PubMed] [Google Scholar]
  • 31.Yi H, Fujimura Y, Ouchida M, Prasad DD, Rao VN, Reddy ES. Inhibition of apoptosis by normal and aberrant Fli-1 and erg proteins involved in human solid tumors and leukemias. Oncogene. 1997;14:1259–68. doi: 10.1038/sj.onc.1201099. [DOI] [PubMed] [Google Scholar]
  • 32.Riggi N, Suva ML, Suva D, Cironi L, Provero P, Tercier S, et al. EWS-FLI-1 expression triggers a Ewing’s sarcoma initiation program in primary human mesenchymal stem cells. Cancer Res. 2008;68:2176–85. doi: 10.1158/0008-5472.CAN-07-1761. [DOI] [PubMed] [Google Scholar]
  • 33.Richter JD. CPEB: a life in translation. Trends Biochem Sci. 2007;32:279–85. doi: 10.1016/j.tibs.2007.04.004. [DOI] [PubMed] [Google Scholar]
  • 34.Kirikoshi H, Sekihara H, Katoh M. Up-regulation of Frizzled-7 (FZD7) in human gastric cancer. Int J Oncol. 2001;19:111–15. [PubMed] [Google Scholar]
  • 35.Andersen CL, Christensen LL, Thorsen K, Schepeler T, Sorensen FB, Verspaget HW, et al. Dysregulation of the transcription factors SOX4, CBFB and SMARCC1 correlates with outcome of colorectal cancer. Br J Cancer. 2009;100:511–23. doi: 10.1038/sj.bjc.6604884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Engels BM, Hutvagner G. Principles and effects of microRNA-mediated post-transcriptional gene regulation. Oncogene. 2006;25:6163–69. doi: 10.1038/sj.onc.1209909. [DOI] [PubMed] [Google Scholar]
  • 37.Pereira R, Quang CT, Lesault I, Dolznig H, Beug H, Ghysdael J. FLI-1 inhibits differentiation and induces proliferation of primary erythroblasts. Oncogene. 1999;18:1597–608. doi: 10.1038/sj.onc.1202534. [DOI] [PubMed] [Google Scholar]
  • 38.Peter M, Magdelenat H, Michon J, Melot T, Oberlin O, Zucker JM, et al. Sensitive detection of occult Ewing’s cells by the reverse transcriptase-polymerase chain reaction. Br J Cancer. 1995;72:96–100. doi: 10.1038/bjc.1995.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tamir A, Howard J, Higgins RR, Li YJ, Berger L, Zacksenhaus E, et al. Fli-1, an Ets-related transcription factor, regulates erythropoietin-induced erythroid proliferation and differentiation: evidence for direct transcriptional repression of the Rb gene during differentiation. Mol Cell Biol. 1999;19:4452–64. doi: 10.1128/mcb.19.6.4452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Athanasiou M, Mavrothalassitis G, Sun-Hoffman L, Blair DG. FLI-1 is a suppressor of erythroid differentiation in human hematopoietic cells. Leukemia. 2000;14:439–45. doi: 10.1038/sj.leu.2401689. [DOI] [PubMed] [Google Scholar]
  • 41.Akao Y, Nakagawa Y, Naoe T. MicroRNAs 143 and 145 are possible common onco-microRNAs in human cancers. Oncol Rep. 2006;16:845–50. [PubMed] [Google Scholar]
  • 42.Torlakovic EE, Slipicevic A, Florenes VA, Chibbar R, DeCoteau JF, Bilalovic N. Fli-1 expression in malignant melanoma. Histol Histopathol. 2008;23:1309–14. doi: 10.14670/HH-23.1309. [DOI] [PubMed] [Google Scholar]
  • 43.Mhawech-Fauceglia P, Herrmann FR, Bshara W, Odunsi K, Terracciano L, Sauter G, et al. Friend leukaemia integration-1 expression in malignant and benign tumours: a multiple tumour tissue microarray analysis using polyclonal antibody. J Clin Pathol. 2007;60:694–700. doi: 10.1136/jcp.2006.039230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Lee RC, Ambros V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 2001;294:862–64. doi: 10.1126/science.1065329. [DOI] [PubMed] [Google Scholar]
  • 45.Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Res. 2008;36:D154–58. doi: 10.1093/nar/gkm952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005;120:15–20. doi: 10.1016/j.cell.2004.12.035. [DOI] [PubMed] [Google Scholar]
  • 47.Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, et al. Combinatorial microRNA target predictions. Nat Genet. 2005;37:495–500. doi: 10.1038/ng1536. [DOI] [PubMed] [Google Scholar]
  • 48.Megraw M, Sethupathy P, Corda B, Hatzigeorgiou AG. miRGen: a database for the study of animal microRNA genomic organization and function. Nucleic Acids Res. 2007;35:D149–55. doi: 10.1093/nar/gkl904. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES