Skip to main content
Journal of Assisted Reproduction and Genetics logoLink to Journal of Assisted Reproduction and Genetics
. 2010 Aug 19;27(11):629–639. doi: 10.1007/s10815-010-9459-7

Association of creatin kinase B and peroxiredoxin 2 expression with age and embryo quality in cumulus cells

Maw-Sheng Lee 1,2,3,4, Chung-Hsien Liu 4, Tsung-Hsien Lee 1,3,4, Hui-Mei Wu 3, Chun-Chia Huang 3,5, Lii-Shung Huang 1,3, Chuan-Mu Chen 6, En-Hui Cheng 3,7,
PMCID: PMC2995433  PMID: 20721618

Abstract

Purpose

The purpose of this study was to identify age-related oocyte or embryo markers suitable for non-invasive analysis, as women over 38 years of age experience diminished pregnancy and ovulation rates.

Methods

We used real-time quantitative PCR to examine the gene expression profiles in cumulus cells acquired from older and younger age groups. We selected 11 genes involved in three functions that directly affect cellular aging: cell cycle control, apoptosis, and metabolism.

Results

CKB and PRDX2 were up-regulated in women older than 38 years, and the expression of these genes in cumulus cells was associated with embryo quality. In good-quality embryos, CKB expression was higher in the cumulus cells acquired from both older and younger age groups than in poor-quality embryos.

Conclusions

These potential relationships among cumulus cell gene expression, oocyte quality, and age may expand our understanding of oogenesis and embryo development. CKB and PRDX2 may serve as biomarkers or therapeutic targets for the developmental potential of oocytes.

Keywords: Aging, Creatin kinase B (CKB), Cumulus cells, Embryo quality, Peroxiredoxin 2 (PRDX2)

Introduction

Most in vitro fertilization (IVF) clinics rely on noninvasive examination of developmental and morphological aspects of oocytes and in vitro cultured embryos for embryo selection [13]. Since cumulus cells surround the oocyte inside the follicle, a close relationship or communication between cumulus cells and the oocyte has been proposed. Indeed, the role of the surrounding cumulus cells in oocyte maturation, ovulation, and fertilization has been extensively studied [46], yet little is known about their contributions to oocyte aging.

Mammalian oocyte development is coordinated with follicular development and complex interactions with granulosa cells [7]. Granulosa cells have been shown to be involved in the regulation of murine ovarian oocyte metabolism and maturation [8], supporting the concept that oocyte development is dependent upon communication with cumulus cells. Mural granulosa cells are associated with the follicle wall, while the cumulus cell population is associated with the oocyte. Oocytes control their environment by suppressing differentiation of the mural granulosa cell phenotype and promoting differentiation of the cumulus cell phenotype through secretion of labile paracrine signaling factors [9]. Cumulus expansion plays an essential role in normal oocyte development, ovulation, and fertilization, as well as embryo development and implantation [10, 11]. Errors in this regulatory mechanism may result in the production of oocytes unable to undergo embryo development.

The follicle pool declines exponentially with age, and begins to disappear at a marked rate approximately at age 37–38 [12, 13]; along the same lines, IVF for women over 38 years of age was not as efficient as for women younger than 30 years old [14]. Alterations in cumulus expansion may occur as women age and may be responsible for their reproductive disadvantage [15]. As most multicellular organisms or cells age, gene expression profiles change; therefore, a comparative molecular analysis of follicles, such as the cumulus cells or the oocytes derived from younger and older age groups, may generate information necessary for a better understanding of embryogenesis. This process may also aid in the identification of age-related factors of biological capacity of women, reflecting the developmental potential of their gametes and their biological environments.

In order to elucidate the interplay between cumulus cells and embryogenesis during the process of oocyte aging, we used microarrays to investigate the associations among the expression profiles in older and younger women. Eleven cumulus cell genes were selected for further study based on their putative aging functions as well as on the results of the microarray analysis. The expression of selected cumulus cell genes related to cell cycle, apoptosis, and metabolism were surveyed in cells acquired from older and younger women, and relationships with embryo quality and subject age were investigated in an effort to elaborate the processes underpinning embryo development.

Materials and methods

Collection of cumulus cells from IVF patients

Complete institutional review board approval and written consents were obtained from the 44 patients prior to the retrieval of cumulus cells. For microarray analysis, we collected oocyte-cumulus complexes from six donors: three young patients (≦28 years old) and three older patients (≧38 years old). The relationships between embryo quality and gene expression were evaluated from another 38 patients undergoing IVF programs in the Division of Infertility Clinic, Lee Womens’ Hospital, Taichung, Taiwan. A total of 178 embryos were collected for study on day 3 after in vitro insemination and culture. Analyzed embryos (a subset from each patient) were selected on a random basis.

Controlled ovarian stimulation

The female partner of the infertile couples participating in this study followed a stimulation protocol that began with daily subcutaneous injections of leuprolide acetate (LA Lupron, Takeda Pharmaceutics, Germany), 0.1 mg on day 21 of their pre-stimulation cycle (long protocol); the injections were continued until human chorionic gonadotrophin (hCG) was administered. Subcutaneous gonadotropin administration (Gonal-F; Serono, Bari, Italy), 225 IU/day, was performed to stimulate follicular development. The resulting ovarian response was monitored by transvaginal ultrasound and serum estradiol levels. When two or more follicles reached a maximum diameter of 18 mm and the serum estradiol levels exceeded 600 pg/ml, 10,000 IU hCG (Profasi; Serono) was administered. Transvaginal oocyte retrieval was performed 32–34 h after hCG injection. The cumulus cells were removed from the oocyte, washed separately with phosphate-buffered saline (PBS, Invitrogen Corp, Carlsbad, CA, USA), and total RNA or mRNA was extracted.

Mature oocytes were identified by the presence of the first polar body after removal of the cumulus cells in the IVF cycles at the fertilization check, which was performed 16–18 h after insemination. Unfertilized oocytes and diploid zygotes (2PN) were identified and counted during the fertilization check. Diploid zygotes were cultured individually into 15 μl microdroplets of G2.1 medium (Scandinavian IVF Science/Vitrolife, Gothenburg, Sweden) overlaid with 2.5 ml mineral oil in Falcon 3002 culture dishes (Becton Dickinson Labware, Franklin Lakes, NJ, USA). Embryo developmental states were recorded from day 0 to day 3.

Microarray with fluorescence detection

We collected and pooled 12 oocyte-cumulus complexes from three young patients (<28 years old) and 12 oocyte-cumulus complexes from three older patients (>38 years old). All oocyte-cumulus complexes were separated by fire-polished solid glass pipette and removed to tubes. Total RNA was isolated with TRIzol (Life Technologies, Rockville, MD, USA) from cumulus samples of three patients undergoing IVF and loaded onto a Qiagen RNeasy column (Qiagen Inc, Valencia, CA, USA) for purification according to the manufacturer’s instructions. Electrophoresis on a 1% agarose formaldehyde gel was utilized to determine the integrity of the RNA preparation. Total RNA (1.5–3 μg) was reverse transcribed with Superscript II RNase H-reverse transcriptase (Gibco BRL, Long Island, NY, USA) to generate Cy3- and Cy5-labeled complementary DNA (cDNA) probes. The labeled probes were hybridized to the ABC Human UniversoChip 20 (eGenomix Technology Corp, Taipei, Taiwan), a commercial cDNA microarray containing 19,844 immobilized cDNA fragments. Fluorescence intensities of Cy3 and Cy5 targets were measured and scanned separately using a GenePix 4000B Array Scanner (Axon Instruments, Molecular Devices Corp, Sunnyvale, CA, USA) and eGenomix V1.0 software (eGenomix). The results were normalized, first to detect the labeling efficiencies of the two fluorescent dyes, then to determine differential gene expression between samples from older and younger women.

Microarray data analyses

Differentially expressed genes were identified when the absolute value of the Cy5/Cy3 was greater than two-fold (up-regulated) or less than 0.5-fold (down-regulated), and the signal value of the fluorescence intensity of either Cy3 or Cy5 were greater than 1,000.

Gene selection and real-time quantitative PCR

Gene expression profiles were determined from the cumulus cells acquired from women either older than 38 years of age or younger than 28 years of age (see above). The expression of genes whose functional roles encompassed cell cycle regulation, metabolism, and apoptosis were studied. Of these genes, 11 varied dependent on the subject’s age, and thus were considered as candidate genes for further study (Table 1).

Table 1.

The 11 genes with age-dependent differential expression, as quantified by microarray analysis

Gene function Gene name Gene symbol Up or down regulation in the older group
Cell cycle Cullin 1 CUL1 up
Cysteine-rich-angiogenic inducer-61 CYR61 up
Metallothionein 1E MT1E up
Creatine kinase B CKB up
Cyclin-dependent kinase 4 CDK4 up
Adducin 3 (gamma) ADD3 down
Apoptosis Immediate early response 3 IER3 up
*Cullin 1 CUL1 up
FBJ murine osteosarcoma viral oncogene homolog B FOSB up
*Cyclin-dependent kinase 4 CDK4 up
Metabolism Peroxiredoxin 2 PRDX2 up
Ribosomal protein S28 RPS28 up
*Creatine kinase CKB up
Procollagen-proline, 2-oxoglutarate (proline 4-hydroxylase)-beta polypeptide P4HB up

*Repeat gene in this list

Messenger RNA was extracted with the Dynabeads mRNA DIRECT Kit (Dynal Biotech ASA, Oslo, Norway) according to the manufacturer’s protocol. Briefly, we added 120 μl Lysis/Binding Buffer to the cumulus cells and inverted the tube repeatedly to obtain complete lysis. We transferred the lysate to a tube containing 10 μl Dynabeads Oligo (dT) 25. The beads were mixed with the sample lysate and incubated with continuous mixing for 3–5 min at room temperature to allow the poly (A) tail of the mRNA to anneal to the Oligo-dT on the beads. This vial was placed on a magnet for 2 min, and then the supernatant was removed. The bead/mRNA complexes were washed twice with 240 μl Washing Buffer A and once with 120 μl Washing Buffer B at room temperature. The magnet was used to separate the beads from the solution between each washing step. The beads containing mRNA were then ready for reverse transcription into cDNA.

The following reagents were added to a tube containing the bead/mRNA complex for a final reaction volume of 30 μl: 17 μl diethyl pyrocarbonate (DEPC)-treated water, 1 μl RNaseOUT recombinant RNase inhibitor (40 U/μl, Invitrogen), 1 μl dNTPs (10 mM each dATP, dGTP, dCTP, and dTTP), 1 μl Oligo (dT) 20 primer (50 μM, Invitrogen), 4 μl of 5X First-Strand Buffer (Invitrogen), 2 μl DTT (0.1 M), and 1 μl SuperScript III Reverse Transcriptase (200 U/μl). The reaction was carried out at 50°C for 1 h, 70°C for 15 min, 4°C for 2 min, and 37°C for 20 min. The resulting single-stranded cDNA was used as template for quantitative real-time polymerase chain reaction (qPCR).

Plasmid DNA previously cloned from the PCR product corresponding to β-actin cDNA (primers Forward-1 and Reverse-1, Table 2) was used as a standard. Standard DNA was amplified in duplicate as 5- or 10-fold serial dilutions. A reaction mixture with no template cDNA served as the negative control for each gene.

Table 2.

Primer sets used for quantitative real-time PCR

Gene Primer sequence (5′ to 3′)
β-actin Forward-1 CTGAGGCACTCTTCCAGCCTT
Reverse-1 CACATCTGCTGGAAGGTGGAC
Forward CTGGCACCCAGCACAATG
Reverse GCCGATCCACACGGAGTACT
ADD3 Forward CAGTCTTGGCATGGTCACACCT
Reverse CTACAAGTCTGTACAGGCTGGC
CDK4 Forward CTTGCCAGCCGAAACGA
Reverse GATGCAATTGGCATGAAGGAA
CKB Forward GATACTACGCGCTCAAGAGCA
Reverse TCTCATTGTGCCAGATACCG
CUL1 Forward ACAATGACGCTGGCTTTGTG
Reverse CTTGGTAACCGCGTTGTTGTT
CYR61 Forward GAATTGATTGCAGTTGGAAAAGG
Reverse GTATAGGATGCGAGGCTCCATT
FOSB Forward GTCTGGAGTTTGTGCTGGTGG
Reverse CTTCCTTAGCCGGTGCTGAGC
IER3 Forward GAGCCTCGACCTGACCTGTCT
Reverse TGGCTGGGTTCGGTTCCT
MT1E Forward TCCTGCAAGTGCAAAGAGTGC
Reverse AGAAGGATGCACTCAGGG
P4HB Forward TGCACAGCTTCCCCACACT
Reverse CGTTCCCCGTTGTAATC
PRDX2 Forward GTCCTTCGCCAGATCACTGTTA
Reverse CATGCTCGTCTGTGTACTGGAAGGC
RPS28 Forward GAATTCATGGACGACACGAG
Reverse GACATCCAAGACCCAGCGAG

Reaction volumes of 25 μl contained 1 μl cDNA, 12.5 μl 2x HotSybr PCR Reaction Mix (NuStar Laboratory, USA), 5 μl each gene-specific primer (0.2–0.5 μM, depending on the gene), and 6.5 μl sterile distilled water. Primers used in this study are listed in Table 2. The tubes were subjected to thermal cycling using the 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The amplification program consisted of heating at 95°C for 5 min, followed by 95°C for 5 s and 60°C for 30 s for 50 cycles. Each cumulus sample was tested in triplicate for each gene in this study. The amplification curve is shown in Fig. 1. We added a dissociation stage to determine whether there was any contamination.

Fig. 1.

Fig. 1

Amplification curves of the 11 studied genes in cumulus cells

Embryo grading

To analyze the relationship between embryo quality and gene expression in cumulus cells, we characterized cleavage-stage embryos on day 3. Embryos were graded according to previously described criteria [16, 17], with a slight modification. Grade 1 embryos were considered to be top-quality embryos, with evenly shaped blastomeres, uniform cytoplasms, and no visible cytoplasmic fragments. Grade 2 embryos displayed either unequal blastomeres or cytoplasmic fragments taking up less than 20% of the embryonic perivitelline space. Grade 3 embryos were comprised of 20–50% cytoplasmic fragments by volume, and in Grade 4 embryos, cytoplasmic fragments made up more than 50% of the perivitelline space.

According to the developmental states, we graded day 3 embryos as “good” or “poor” embryos. On day 3 we defined “good quality” embryos as Grade 1 and Grade 2, with at least eight blastomeres and less than 20% cytoplasmic fragmentation. Embryos with unequal blastomere size and 20–50% fragmentation (Grades 3 and 4) were classified as “poor-quality” embryos.

Data analysis

Data were expressed as mean ± standard error (SE), and statistical analysis was carried out using the Mann-Whitney test (U-test). All analyses were performed using the Statistical Package for the Social Sciences (version 14.0; SPSS Inc, Chicago, IL). A confidence level of P < 0.05 was the limit for statistical significance.

Results

Gene expression profiles in older (Cy3-labeled) and younger (Cy5-labeled) age groups were visualized with a scatterplot of Cy5 versus Cy3 intensity (Fig. 2). Analysis was conducted of 1879 genes, excluding genes that were absent, not found, or that had bad features. Most genes exhibited similar expression patterns between the two sample groups, but genes from certain functional groups were specific to either up- or down-regulation. There were 35 genes up-regulated (Table 3) and 32 genes down-regulated in the older age group women. We identified genes with intensity changes greater than two-fold for further study; as a result, 11 genes were selected and grouped according to their function in cell cycle, apoptosis, and metabolism pathways (Table 1).

Fig. 2.

Fig. 2

Scatter plot representation of gene expression changes in older versus younger age group women. Cy3 intensity (samples from older women) is shown on the horizontal axis, and Cy5 intensity (samples from younger women) is represented on the vertical axis

Table 3.

Thirty-five up-regulated genes in cumulus cell samples from older women, as determined by microarray analysis

No Name Gene_Symbol Ratio of mean
1 serine (or cysteine) proteinase inhibitor- clade A (alpha-1 antiproteinase- antitrypsin)- member 3 SERPINA3 4.199
2 immediate early response 3 IER3 3.359
3 Simlarte a-actinin cytoskeletal isoform 2.916
4 hypothetical protein BC013995 LOC91663 2.748
5 Homo sapiens mRNA; cDNA DKFZp564K133 (from clone DKFZp564K133) 2.742
6 peroxiredoxin 2 PRDX2 2.699
7 eukaryotic translation initiation factor 5A EIF5A 2.574
8 tubulin- beta- 5 TUBB5 2.499
9 ribosomal protein S28 RPS28 2.434
10 hydroxy-delta-5-steroid dehydrogenase- 3 beta- and steroid delta-isomerase 1 HSD3B1 2.320
11 cullin 1 CUL1 2.317
12 peptidylprolyl isomerase F (cyclophilin F) PPIF 2.315
13 hypothetical protein BC013995 LOC91663 2.257
14 cysteine-rich- angiogenic inducer- 61 CYR61 2.253
15 cysteine-rich- angiogenic inducer- 61 CYR61 2.248
16 hypothetical protein BC013995 LOC91663 2.246
17 transforming growth factor- beta 1 (Camurati-Engelmann disease) TGFB1 2.231
18 cytochrome P450- family 19- subfamily A- polypeptide 1 CYP19A1 2.215
19 major histocompatibility complex- class I- A HLA-A 2.177
20 FBJ murine osteosarcoma viral oncogene homolog B FOSB 2.123
21 interferon induced transmembrane protein 3 (1-8U) IFITM3 2.100
22 metallothionein 1E (functional) MT1E 2.099
23 Human HepG2 3′ region cDNA- clone hmd1f06. 2.090
24 hypothetical protein MGC4368 MGC 4368 2.088
25 non-metastatic cells 1- protein (NM23A) expressed in NME1 2.072
26 creatine kinase- brain CKB 2.056
27 cyclin-dependent kinase 4 CDK4 2.055
28 Homo sapiens mRNA; cDNA DKFZp666J2410 (from clone DKFZp666J2410) 2.049
29 peptidylprolyl isomerase B (cyclophilin B) poly(rC) binding protein 1 PCBP1 2.040
30 protein translocation complex beta SEC61B 2.037
cytochrome c oxidase subunit VIII COX8 2.037
31 malate dehydrogenase 2- NAD (mitochondrial) MDH2 2.033
32 stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein) STIP1 2.032
33 DKFZP586A0522 protein DKFZP586A0522 2.028
34 ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) UCHL1 2.027
35 procollagen-proline- 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase)- beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55) P4HB 2.020

Total oocyte number and embryo number

Cumulus-oocyte complexes were collected from 38 women (see Materials and methods). The patients were divided into two groups according to age: ≤28 years old (younger age group, 12 patients) and ≥38 years old (older age group, 26 patients). The mean age, oocyte number, day 3 embryo number, and day 3 good-quality embryo number from these two groups are listed in Table 4. Younger patients had an average of 4.3 ± 2.6 good-quality embryos on day 3, compared to 2.1 ± 2.1 good-quality embryos in older patients.

Table 4.

Patient information and oocyte/embryo characteristics

Age group Patients (no.) Age (yr) Retrieved oocytes (no.) Day 3 embryos (no.) Day 3 good-quality embryos (no.) Pregnancy rate
≤28 years 12 *24.42 ± 0.66 15.67 ± 1.3 8.58 ± 1.17 4.3 ± 2.6 66.7%
≥38 years 26 40.08 ± 0.26 7.92 ± 0.89 3.96 ± 0.64 2.1 ± 2.1 34.6%

*Mean ± SE

Gene expression

According to the developmental states, we graded day 3 embryos as “good” or “poor” in accordance with previous methods (see Materials and methods) [17]. Good-quality embryos included grade 1, grade 2, and morula embryos, and the other grades of embryo were defined as poor-quality embryos. We did not directly assay gene expression levels in the embryo; we measured gene expression levels in cumulus cells retrieved from the corresponding oocyte that developed into the embryo. The expression levels of 11 genes, differentially expressed in cumulus cells of younger and older women, are shown in Fig. 3. Both CKB and PRDX2 were significantly up-regulated in the older age group; there were no significant differences in the expression levels of the other 10 genes.

Fig. 3.

Fig. 3

Gene expression levels in cumulus cells from young (≦28 years) and advanced-age women (≧38 years). Data shown are (the quantities of gene expression/the quantity of β-actin expression) × 10000. *Significant differences between age groups (P < 0.05, Mann-Whitney U-test)

Expression of CKB and PRDX2 was significantly different between good-quality and poor-quality embryos. We also analyzed cumulus cell gene expression levels with reference to the grade of the associated embryo within each age group. CKB was expressed at a higher level by cumulus cells associated with good-quality embryos in both younger and older women. In addition, PRDX2 was expressed at a higher level by cumulus cells associated with the good quality embryos in both younger and older women, but there was no significant difference. A higher level in PRDX2 gene expression of cumulus cell was evident for samples acquired from older age group women than younger women for the gene (Fig. 4).

Fig. 4.

Fig. 4

CKBa and PRDX2b expression levels in cumulus cells compared with embryo development on day 3. Embryos were graded as described in Materials and methods. Results are divided into good-quality (black) and poor-quality (gray) embryos on day 3. *Significant difference between good- and poor-quality embryos in the same age group. (P < 0.05, Mann-Whitney U-test)

Discussion

The role of the surrounding cumulus cells in maturation, ovulation, and fertilization of oocytes has been extensively studied [4, 6], yet little is known about their role in oocyte aging. In order to potentially elucidate the interplay among cumulus cells and embryogenesis and oocyte aging, we have identified associations between the gene expression of selected cumulus cell genes, embryo quality, and the subject’s age. Sperm quality and efficiency, super-ovulation, and gene expression may be influenced by environmental factors and/or ancillary genes that may have not been described or fully controlled in this study. We also have not accounted for the potential influence of secreted hormones.

Cumulus cell gene expression analysis may be useful in oocyte or embryo selection. Human cumulus and granulosa cells have been studied to identify biomarkers for oocyte quality and competence [18, 19], or for early embryo development [3, 20] or embryo quality and pregnancy outcome [21]. We randomly collected a subset of the cumulus cells from the subjects in this study, and some transferred embryos did not have their corresponding cumulus cells analyzed. Therefore, the pregnancy rates in this study (Table 4) cannot be compared directly to gene expression.

Previously, the expression of several genes in cumulus cells, particularly pentraxin-3, was indicative of oocyte and embryo quality [18]. In addition, the expression of cyclooxygenase 2 (COX2), gremlin (GREM), and hyaluronic acid synthase 2 (HAS2) were also positively correlation with embryo quality [20]. Oocyte factors such as growth and differentiation factor-9 (GDF-9) were necessary for cumulus expansion [3, 22], and the following cumulus cell-expressed genes were likely indicative of hypoxic conditions or delayed oocyte maturation: CCND2, CXCR4, GPX3, CTNND1, DHCR7, DVL3, HSPB1, and TRIM28. In the present study, we did not identify the same candidate genes as previous studies on embryo viability [3] or competent oocytes [19]. CKB catalyzes the reversible phosphorylation of creatine for cellular maintenance of the energy reservoir and transport. Cells that require high energy, such as spermatozoa, possess high CKB activity [23], and CKB expression was shown to be significantly altered in age-related-macular degeneration retinal tissue [24]. CKB expression was up-regulated in hormonally responsive tumors, including breast, prostate, and ovarian epithelial cancers [25, 26]. There may be a high level of estrogen response in the older age group following IVF treatment; CKB transcription and translation has been shown to be rapidly and specifically induced by estrogen [27, 28]. CKB was observed in the brain and uterus, and in the uterus its synthesis was increased by estrogen [29]. We observed a gnificant relationship between CKB expression and the age of the tested cumulus cells (Figs. 3 and 4). Follicular levels of estrogen tend be higher in older patients [30], and our older patients required higher dosages of exogenous gonadotropin for ovulation induction in IVF treatment cycles than the younger women. It is therefore likely that higher expression of CKB resulted from aging, perhaps mediated through estrogen responses.

CKB expression levels in cumulus cells were higher in samples acquired from older women, independent of whether these cumulus cells were associated with oocytes that developed into good-quality or poor-quality embryos (Fig. 4). CKB activity occurs in growing mouse oocytes and in preimplantation embryos [31], and higher creatine kinase activities were associated with lower production of transferable embryos in dairy cattle [32]. Oxidative damage to the structure of oocytes and granulose cells, such as ruptured mitochondrial membranes and dilated smooth endoplasmic reticulum, was described in primordial follicles in a cohort of women of advanced age [33]. Increased CKB and superoxide dismutase (SOD) activities were observed in the presence of oxidative damage in spermatozoa, and SOD activities was highly correlated with creatine kinase in human sperm suspensions [34]. The female reproductive system may employ a similar mechanism to protect oocyte maturation and embryogenesis from oxygen damage. If the CKB genes are necessary to process oxidative stress or damage in cumulus cells, then older women would likely require higher levels of CKB to repair the oxidative damage. The higher CKB levels within each age group may be associated with a better capability to defend against oxidative stress, resulting in good-quality embryos.

The PRDX2 gene encodes a member of the peroxiredoxin family of antioxidant enzymes that reduces hydrogen peroxide (H2O2) and alkyl hydroperoxides [35]. PRDX2 modulates intracellular H2O2 production and H2O2 -mediated apoptosis [36]. H2O2 production can therefore reduce the specific carbonyl level of PRDX2, suggesting that more active PRDX2 may be available in cumulus cells to strengthen the antioxidant system. Recent studies have demonstrated that the PRDX family of genes has varying patterns of gene expression in bovine oocytes and embryos [37]. Oxidative stress plays a role in multiple physiological processes, from oocyte maturation to fertilization and embryo development [38]; human granulosa cells and luteal cells respond to H2O2 by abolishing gonadotropin action and inhibiting progesterone [39]. Since PRDX2 modulates intracellular H2O2 production, it is possible that PRDX2 is responsible for elimination of H2O2 production in the follicle. The role of PRDX2 as an antioxidant may improve the biological function of cumulus cells and oocytes in older women. Cumulus cell gene expression was somewhat related to the age of the subject and the quality of the associated embryos. Since the functions of the CKB and PRDX2 genes have not been fully elucidated, particularly regarding oogenesis and embryo development, it is difficult to interpret the gene expression patterns without further investigation.

Many studies exist regarding the relationship between embryo morphology and cumulus cell gene expression. A previous study identified CCND2, CXCR4, GPX3, CTNND1, DHCR7, DVL3, HSPB1, and TRIM28 as differentially expressed genes, possibly reflecting hypoxic conditions or delayed oocyte maturation in non-early cleavage samples [40]. Three other genes expressed in cumulus cells were significantly associated with embryo quality, low fragmentation, or with seven cells [41]. These perspectives on new molecular embryo or oocyte selection parameters may be useful in countries where the selection has to be made at the oocyte stage before fertilization, instead of at the embryonic stage. The identification of biomarkers for noninvasive assessment of oocytes and embryos may also be aided by these findings.

As many failures in assisted reproduction may be related to oocyte aging, we measured gene expression levels in cumulus cells, anticipating that the cumulus cells may reflect the developmental potential of the oocyte. A study of nuclear transfer procedures revealed that aged oocytes showed low developmental potential as indicated by significantly lower fusion rates, cleavage rates, and subsequent development [42]. Indeed, it is well established that oocyte quality determines the embryo’s post-fertilization development potential [43].

CKB and PRDX2 expression in cumulus cells of older women was lower, and oocytes developed into poor-quality embryos on day 3 (Fig. 4). In good-quality embryos acquired from members of the same age group, CKB levels were higher in cumulus cells from older women than from younger women. Perhaps decreased PRDX2 expression is associated with a decrease in antioxidant processes, thereby promoting apoptosis. The incidence of cumulus cell apoptosis has been used to predict the oocyte quality outcome of IVF-ET, as well as age-related declines in fertility [44]. These differences may affect oogenesis, which is responsible for the capacity to undergo normal fertilization and subsequent embryonic development, leading to the poor quality of the developing embryos.

In conclusion, we have observed variable expression of certain cumulus cell genes that, upon further study, may elucidate issues of human embryo development, possibly leading to the identification of markers of poor embryo development and potential therapeutic targets for improving embryo development, particularly in older women. CKB and PRDX2, which were expressed at higher levels in the cumulus cells of older women, may be candidates for evaluating embryo quality in the aging reproductive system.

Acknowledgements

We thank Chung-I Chen, Chiu-Ping Chen, Hsiu-Hui Chen, and Ming-Chou Hung for their assistance in laboratory techniques. This study was supported by a research grant from National Science Council, Taiwan (NSC 93-2314-B -039-017 and NSC 97-2314-B-040-018) to Maw-Sheng Lee.

Financial support This study was supported by a research grant from National Science Council, Taiwan (NSC 93-2314-B-039-017 and NSC 97-2314-B-040-018) to Maw-Sheng Lee.

Footnotes

Capsule

In cumulus cell gene expression, Creatin kinase B and peroxiredoxin 2 may serve as biomarkers or therapeutic targets for the developmental potential of oocytes.

Where the work was done: Division of Infertility Clinic, Lee Women’s Hospital, Taichung, Taiwan.

Capsule In cumulus cell gene expression, Creatin kinase B and peroxiredoxin 2 may serve as biomarkers or therapeutic targets for the developmental potential of oocytes.

References

  • 1.Borini A, Lagalla C, Cattoli M, Sereni E, Sciajno R, Flamigni C, Coticchio G. Predictive factors for embryo implantation potential. Reprod Biomed Online. 2005;10:653–68. doi: 10.1016/S1472-6483(10)61675-6. [DOI] [PubMed] [Google Scholar]
  • 2.Gerris JM. Single embryo transfer and IVF/ICSI outcome: a balanced appraisal. Hum Reprod Update. 2005;11:105–21. doi: 10.1093/humupd/dmh049. [DOI] [PubMed] [Google Scholar]
  • 3.Montfoort AP, Geraedts JP, Dumoulin JC, Stassen AP, Evers JL, Ayoubi TA. Differential gene expression in cumulus cells as a prognostic indicator of embryo viability: a microarray analysis. Mol Hhum Reprod. 2008;14:157–68. doi: 10.1093/molehr/gam088. [DOI] [PubMed] [Google Scholar]
  • 4.Eppig JJ. The relationship between cumulus cell-oocyte coupling, oocyte meiotic maturation, and cumulus expansion. Dev Biol. 1982;89:268–72. doi: 10.1016/0012-1606(82)90314-1. [DOI] [PubMed] [Google Scholar]
  • 5.Eppig JJ. Intercommunication between mammalian oocytes and companion somatic cells. Bioessays. 1991;13:569–74. doi: 10.1002/bies.950131105. [DOI] [PubMed] [Google Scholar]
  • 6.Tanghe S, Soom A, Nauwynck H, Coryn M, Kruif A. Functions of the cumulus oophorus during oocyte maturation, ovulation, and fertilization. Mol Reprod Dev. 2002;61:414–24. doi: 10.1002/mrd.10102. [DOI] [PubMed] [Google Scholar]
  • 7.Thomas FH, Vanderhyden BC. Oocyte-granulosa cell interactions during mouse follicular development: Regulation of kit ligand expression and its role in oocyte growth. Reprod Biol Endocrinol. 2006;4:19–26. doi: 10.1186/1477-7827-4-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cecconi S, Tatone C, Buccione R, Mangia F, Colonna R. Granulosa cell-oocyte interactions: the phosphorylation of specific proteins in mouse oocytes at the germinal vesicle stage is dependent upon the differentiative state of companion somatic cells. J Exp Zool. 1991;258:249–54. doi: 10.1002/jez.1402580216. [DOI] [PubMed] [Google Scholar]
  • 9.Eppig JJ, Chesnel F, Hirao Y, O’Brien MJ, Pendola FL, Watanabe S, Wigglesworth K. Oocyte control of granulosa cell development: how and why. Hum Reprod. 1997;12:127–32. [PubMed] [Google Scholar]
  • 10.Chang H, Brown CW, Matzuk MM. Genetic analysis of the mammalian transforming growth factor-beta superfamily. Endocr Rev. 2002;23:787–823. doi: 10.1210/er.2002-0003. [DOI] [PubMed] [Google Scholar]
  • 11.Vanderhyden BC, Macdonald EA, Nagyova E, Dhawan A. Evaluation of members of the TGF beta superfamily as candidates for the oocyte factors that control mouse cumulus expansion and steroidogenesis. Reprod. 2003;61:55–70. [PubMed] [Google Scholar]
  • 12.Faddy MJ, Gosden RG, Gougeon A, Richardson SJ, Nelson JF. Accelerated disappearance of ovarian follicles in mid-life: implications for forecasting menopause. Hum Reprod. 1992;7:1342–6. doi: 10.1093/oxfordjournals.humrep.a137570. [DOI] [PubMed] [Google Scholar]
  • 13.Velde E, Pearson P. The variability of female reproductive aging. Hum Reprod Update. 2002;8:141–54. doi: 10.1093/humupd/8.2.141. [DOI] [PubMed] [Google Scholar]
  • 14.Janny L, Menezo YJ. Maternal age effect on early human embryonic development and blastocyst formation. Mol Reprod Devel. 1996;45:31–7. doi: 10.1002/(SICI)1098-2795(199609)45:1&#x0003c;31::AID-MRD4&#x0003e;3.0.CO;2-T. [DOI] [PubMed] [Google Scholar]
  • 15.Navot D, Bergh PA, Williams MA, Garrisi GJ, Guzman I, Sandler B, Grunfeld L. Poor oocyte quality rather than implantation failure as a cause of age-related decline in female fertility. Lancet. 1991;337:1375–7. doi: 10.1016/0140-6736(91)93060-M. [DOI] [PubMed] [Google Scholar]
  • 16.Bassil S, Wyns C, Toussaint-Demylle D, Abdelnour W, Donnez J. Predictive factors of multiple pregnancy in in vitro fertilization. J Reprode Med. 1997;42:761–6. [PubMed] [Google Scholar]
  • 17.Lin DP, Huang CC, Wu HM, Cheng TC, Chen CI, Lee MS. Comparison of mitochondrial DNA contents in human embryos with good or poor morphology at the 8-cell stage. Fertil Steril. 2004;81:73–9. doi: 10.1016/j.fertnstert.2003.05.005. [DOI] [PubMed] [Google Scholar]
  • 18.Zhang X, Jafari N, Barnes RB, Confino E, Milad M, Kazer RR. Studies of gene expression in human cumulus cells indicate pentraxin 3 as a possible marker for oocyte quality. Fertil Steril. 2005;83:1169–79. doi: 10.1016/j.fertnstert.2004.11.030. [DOI] [PubMed] [Google Scholar]
  • 19.Hamel M, Dufort I, Robert C, Gravel C, Leveille MC, Leader A, Sirard MA. Identification of differentially expressed markers in human follicular cells associated with competent oocytes. Hum Reprod. 2008;23:1118–27. doi: 10.1093/humrep/den048. [DOI] [PubMed] [Google Scholar]
  • 20.McKenzie LJ, Pangas SA, Carson SA, Kovanci E, Cisneros P, Buster JE, Amato P, Matzuk MM. Human cumulus granulosa cell gene expression: a predictor of fertilization and embryo selection in women undergoing IVF. Hum Reprod. 2004;19:2869–74. doi: 10.1093/humrep/deh535. [DOI] [PubMed] [Google Scholar]
  • 21.Assou S, Haouzi D, Mahmoud K, Aouacheria A, Guillemin Y, Pantesco V, Rème T, Dechaud H, Vos J, Hamamah S. A non-invasive test for assessing embryo potential by gene expression profiles of human cumulus cells: a proof of concept study. Mol Hum Reprod. 2008;14:711–9. doi: 10.1093/molehr/gan067. [DOI] [PubMed] [Google Scholar]
  • 22.Sutton ML, Gilchrist RB, Thompson JG. Effects of in-vivo and in-vitro environments on the metabolism of the cumulus-oocyte complex and its influence on oocyte developmental capacity. Hum Reprod Update. 2003;9:35–48. doi: 10.1093/humupd/dmg009. [DOI] [PubMed] [Google Scholar]
  • 23.Rolf C, Behre HM, Cooper TG, Koppers B, Nieschlag E. Creatine kinase activity in human spermatozoa and seminal plasma lacks predictive value for male fertility in in vitro fertilization. Fertil Steril. 1998;69:727–34. doi: 10.1016/S0015-0282(97)00570-0. [DOI] [PubMed] [Google Scholar]
  • 24.Yoshida S, Yashar BM, Hiriyanna S, Swaroop A. Microarray analysis of gene expression in the aging human retina. Invest Ophthalmol Vis Sci. 2002;4:2554–60. [PubMed] [Google Scholar]
  • 25.Zarghami N, Yu H, Diamandis EP, Sutherland DJ. Quantification of creatine kinase BB isoenzyme in tumor cytosols and serum with an ultrasensitive time-resolved immunofluorometric technique. Clin Biochem. 1995;28:243–53. doi: 10.1016/0009-9120(95)00010-7. [DOI] [PubMed] [Google Scholar]
  • 26.Huddleston HG, Wong KK, Welch WR, Berkowitz RS, Mok SC. Clinical applications of microarray technology: creatine kinase B is an up-regulated gene in epithelial ovarian cancer and shows promise as a serum marker. Gyneol Oncol. 2005;96:77–83. doi: 10.1016/j.ygyno.2004.08.047. [DOI] [PubMed] [Google Scholar]
  • 27.Wu-Peng XS, Pugliese TE, Dickerman HW, Pentecost BT. Delineation of sites mediating estrogen regulation of the rat creatine kinase B gene. Mol Endocri. 1992;6:231–40. doi: 10.1210/me.6.2.231. [DOI] [PubMed] [Google Scholar]
  • 28.Zarghami N, Giai M, Yu H, Roagna R, Ponzone R, Katsaros D, Sismondi P, Diamandis EP. Creatine kinase BB isoenzyme levels in tumour cytosols and survival of breast cancer patients. Br J Cancer. 1996;73:386–90. doi: 10.1038/bjc.1996.66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bergen HT, Pentecost BT, Dickerman HW, Pfaff DW. In situ hybridization for creatine kinase-B messenger RNA in rat uterus and brain. Mol Cellular Endocrinol. 1993;92:111–9. doi: 10.1016/0303-7207(93)90081-T. [DOI] [PubMed] [Google Scholar]
  • 30.Welt CK, Jimenez Y, Sluss PM, Smith PC, Hall JE. Control of estradiol secretion in reproductive ageing. Hum Reprod. 2006;21:2189–93. doi: 10.1093/humrep/del136. [DOI] [PubMed] [Google Scholar]
  • 31.Iyengar MR, Iyengar CW, Chen HY, Brinster RL, Bornslaeger E, Schultz RM. Expression of creatine kinase isoenzyme during oogenesis and embryogenesis in the mouse. Dev Biol. 1983;96:263–8. doi: 10.1016/0012-1606(83)90327-5. [DOI] [PubMed] [Google Scholar]
  • 32.Chorfi Y, Lanevschi A, Dupras R, Girard V, Tremblay A. Serum biochemical parameters and embryo production during superovulatory treatment in dairy cattle. Res Vet Sci. 2007;83:318–21. doi: 10.1016/j.rvsc.2007.01.010. [DOI] [PubMed] [Google Scholar]
  • 33.Bruin JP, Dorland M, Spek ER, Posthuma G, Haaften M, Looman CW, Velde ER. Age-related changes in the ultrastructure of the resting follicle pool in human ovaries. Biol Reprod. 2004;70:419–24. doi: 10.1095/biolreprod.103.015784. [DOI] [PubMed] [Google Scholar]
  • 34.Aitken RJ, Buckingham DW, Carreras A, Irvine DS. Superoxide dismutase in human sperm suspensions: relationship with cellular composition, oxidative stress, and sperm function. Free Radic Biol Med. 1996;21:495–504. doi: 10.1016/0891-5849(96)00119-0. [DOI] [PubMed] [Google Scholar]
  • 35.Wood ZA, Schröder E, Robin HJ, Poole LB. Structure, mechanism and regulation of peroxiredoxins. Trends Biochem Sci. 2003;28:32–40. doi: 10.1016/S0968-0004(02)00003-8. [DOI] [PubMed] [Google Scholar]
  • 36.Kim H, Lee TH, Park ES, Suh JM, Park SJ, Chung HK, Kwon OY, Kim YK, Ro HK, Shong M. Role of peroxiredoxins in regulating intracellular hydrogen peroxide and hydrogen peroxide induced apoptosis in thyroid cells. J Biol Chem. 2000;275:18266–70. doi: 10.1074/jbc.275.24.18266. [DOI] [PubMed] [Google Scholar]
  • 37.Leyens G, Knoops B, Donnay I. Expression of peroxiredoxins in bovine oocytes and embryos produced in vitro. Mol Reprod Dev. 2004;69:243–51. doi: 10.1002/mrd.20145. [DOI] [PubMed] [Google Scholar]
  • 38.Agarwal A, Gupta S, Sharma RK. Role of oxidative stress in female reproduction. Reprode Biol Endocrnol. 2005;14:28–49. doi: 10.1186/1477-7827-3-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Vega M, Carrasco I, Castillo T, Troncoso JL, Videla LA, Devoto L. Functional luteolysis in response to hydrogen peroxide in human luteal cells. J Endocrinol. 1995;147:177–82. doi: 10.1677/joe.0.1470177. [DOI] [PubMed] [Google Scholar]
  • 40.Montfoort APA, Geraedts JPM, Dumoulin JCM, Stassen APM, Johannes LH, Evers JLH, Ayoubi TAY. Differential gene expression in cumulus cells as a prognostic indicator of embryo viability: a microarray analysis. MHR-Basic Science of Reproductive Medicine. 2008;14:157–68. doi: 10.1093/molehr/gam088. [DOI] [PubMed] [Google Scholar]
  • 41.Adriaenssens T, Wathlet S, Segers I, Verheyen G, Vos A, Elst J, Coucke W, Devroey P, Smitz J. Cumulus cell gene expression is associated with oocyte developmental quality and influenced by patient and treatment characteristics. Hum Reprod. 2010;1:1–12. doi: 10.1093/humrep/deq049. [DOI] [PubMed] [Google Scholar]
  • 42.Hall VJ, Compton D, Stojkovic P, Nesbitt M, Herbert M, Murdoch A, Stojkovic M. Developmental competence of human in vitro aged oocytes as host cells for nuclear transfer. Hum Reprod. 2007;22:52–62. doi: 10.1093/humrep/del345. [DOI] [PubMed] [Google Scholar]
  • 43.Wang Q, Sun QY. Evaluation of oocyte quality: morphological, cellular and molecular predictors. Reprod Fertil Dev. 2007;19:1–12. doi: 10.1071/RD06103. [DOI] [PubMed] [Google Scholar]
  • 44.Lee KS, Joo BS, Na YJ, Yoon MS, Choi OH, Kim WW. Cumulus cells apoptosis as an indicator to predict the quality of oocytes and the outcome of IVF-ET. J Assist Reprod Genet. 2001;18:490–8. doi: 10.1023/A:1016649026353. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Assisted Reproduction and Genetics are provided here courtesy of Springer Science+Business Media, LLC

RESOURCES