Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Dec 10.
Published in final edited form as: J Biol Chem. 2007 Oct 17;282(50):36463–36473. doi: 10.1074/jbc.M705789200

SHP2E76K MUTANT CONFERS CYTOKINE-INDEPENDENT SURVIVAL OF TF-1 MYELOID CELLS BY UP-REGULATING BCL-XL

Yuan Ren 1, Zhengming Chen 1, Liwei Chen 1, Nicholas T Woods 2, Gary W Reuther 1,3, Jin Q Cheng 1,2,3, Hong-gang Wang 2,3, Jie Wu 1,2,3,*
PMCID: PMC3000740  NIHMSID: NIHMS212669  PMID: 17942397

Abstract

Shp2 has been known to mediate growth factor-stimulated cell proliferation but its role in cell survival is less clear. Gain-of-function Shp2 mutants such as Shp2E76K are associated with myeloid leukemias. We found that Shp2E76K could transform cytokine-dependent human TF-1 myeloid cells into cytokine-independence and further characterized the Shp2E76K-induced cell survival mechanism in this study. Expression of Shp2E76K suppressed the cytokine withdrawal-induced intrinsic/mitochondrial apoptosis pathway, which is controlled by the Bcl-2 family proteins. Analysis of Bcl-2 family proteins showed that Bcl-XL and Mcl-1 were up-regulated in Shp2E76K-transformed TF-1 (TF-1/Shp2E76K) cells. Knockdown of Bcl-XL but not Mcl-1 with shRNAs prevented Shp2E76K-induced cytokine-independent survival. Roscovitine, which down-regulated Mcl-1, also did not prevent cytokine-independent survival of TF-1/Shp2E76K cells whereas the Bcl-XL inhibitor HA14-1 did. Ras and mitogen-activated protein (MAP) kinases Erk1 and Erk2 (Erk1/2) were constitutively activated in TF-1/Shp2E76K cells whereas little active Akt was detected under cytokine-free conditions. Shp2E76K-induced Bcl-XL expression was suppressed by Mek inhibitors and by a dominant-negative Mek1 mutant but not by the phosphoinositide-3-phosphate (PI3K) inhibitor LY294002 and the Akt inhibitor API-2. Inhibition of Erk1/2 blocked cytokine-independent survival of TF-1/Shp2E76K cells whereas inhibition of Akt had minimal effect on cytokine-independent survival of TF-1/Shp2E76K cells. These results show that Shp2E76K can evoke constitutive Erk1/2 activation in TF-1 cells. Furthermore, Shp2E76K induces cytokine-independent survival of TF-1 cells by a novel mechanism involving up-regulation of Bcl-XL through the Erk1/2 pathway.


Shp2 is a non-receptor protein tyrosine phosphatase (PTP) encoded by the PTPN11 gene (1). It contains two Src homology-2 (SH2) domains (N-SH2, C-SH2), a PTP domain, and a carboxyl-terminal region. In resting cells, Shp2 PTP has a low basal PTP activity due to auto-inhibition by its N-SH2 domain (2). In growth factor-stimulated cells, Shp2 binds to tyrosine-phosphorylated docking proteins such as Gab1 and Gab2 through its SH2 domains (3). Binding of Shp2 SH2 domains to these docking proteins relieves the auto-inhibition, resulting in activation of Shp2 PTP activity (1,4). Growth factor-activated Shp2 is known to play a positive role in activation of the Erk1 and Erk 2 (Erk1/2) mitogen-activated protein (MAP) kinases (1,5,6) and to mediate growth factor-stimulated cell proliferation (710). While few study has addressed the role of Shp2 in cell survival, a recent study (11) provided evidence that Shp2 is involved in fibroblast growth factor-4 (FGF4)-regulated survival of murine trophoblast stem cells.

In addition to being activated transiently by growth factors, Shp2 can be activated constitutively through point mutations (1214). These gain-of-function Shp2 mutants have been found in Noonan syndrome, juvenile myelomonocytic leukemia (JMML), childhood myelodysplastic syndrome and myeloproliferative disorder, B-cell acute lymphoblastic leukemia, acute myelogenous leukemia, and in some cases of solid tumors (12,13,1518). In particular, PTPN11 is frequently mutated in JMML patients, associating with approximately 35% of JMML cases (19). JMML is an aggressive disease characterized by overproduction of tissue-infiltrating myeloid cells. A hallmark of bone marrow and peripheral blood mononuclear cells from JMML patients is their ability to form granulocyte-macrophage colony-forming units (CFU-GM) in the absence of exogenous cytokines or at very low concentrations of granulocyte-macrophage colony-stimulating factor (GM-CSF) (20,21). Autocrine and paracrine were ruled out in cytokine-independent formation of myeloid colonies (20).

Somatic PTPN11 mutations in hematologic malignancies occur most frequently in exon 3 that encodes amino acid residues of the N-SH2 domain (12,13). It was reported that murine bone marrow or fetal liver cells transduced with retroviruses encoding the leukemia-associated Shp2E76K, Shp2D61Y, or Shp2D61V mutant could evoke cytokine-independent myeloid colonies and display hypersensitivity to GM-CSF in methylcellulose cultures (2224), suggesting that these Shp2 mutants have oncogenic potential. However, attempts to transform murine cytokine-dependent cell lines such as Ba/F3 cells with Shp2E76K and other Shp2 mutants have been unsuccessful (22,25,26).

TF-1 is a CD34+ human myeloid precursor cell line that requires GM-CSF or interleukin-3 (IL-3) for cell survival and proliferation. We report here that the leukemia-associated Shp2E76K mutant can transform TF-1 cells into cytokine-independence. We further analyzed Shp2E76K-induced cytokine-independent cell survival mechanism and found that up-regulation of Bcl-XL via the Erk1/2 pathway plays a critical role in the Shp2 mutant-induced cytokine-independent survival.

EXPERIMENTAL PROCEDURES

Antibodies and reagents

Monoclonal (M2) and polyclonal anti-Flag antibodies, antibody to active Bax (6A7), and α-tubulin were from Sigma. Antibodies to following proteins were from Santa Cruz Biotechnology: β-actin, Shp2, phospho-Erk1/2, Erk1/2, Akt, Ras, Stat5, Mcl-1, and Bax. Antibodies to poly(ADP-ribose) polymerase (PARP), cytochrome C and Hsp60 were from BD Pharmingen. Other antibodies were from Cell Signaling Technology. GM-CSF was from Immunex. Roscovitine was from Calbiochem. HA14-1 was from Tocris Bioscience. U0126 and PD98059 were from Biomol. Doxorubicin and etoposide were from Sigma. API-2 (27) was obtained from National Cancer Institute.

Shp2 retroviruses and generation of stable TF-1 cell lines

MSCV-P is a bicistronic retroviral vector derived from MigR1 (28), in which the green fluorescence protein (GFP) coding region has been replaced with a puromycin-resistance gene. MSCV-Shp2 and MSCV-Shp2E76K retroviral vectors were made by subcloning Flag-tagged human wildtype Shp2 and Shp2E76K coding sequences into MSCV-P. MSCV, MSCV-Shp2 and MSCV-Shp2E76K retroviruses were prepared with Phoenix AmphoPack293 cells by transient transfection. Viruses containing supernatants were collected and filtered through a 0.45-μm filter.

TF-1 cells were cultured in RPMI-1640/10% fetal bovine serum (FBS)/2–5 ng/ml human GM-CSF. For viral infection, TF-1 cells (3 × 106) were incubated with retrovirus (8 ml) in the presence of polybrene (5 μg/ml) and GM-CSF (5 ng/ml) for 24 h. After infection, cells were cultured in RPMI-1640/10% FBS/5 ng/ml GM-CSF for another 24 h before puromycin (0.5 μg/ml) was added to the medium. Puromycin selection for retrovirus transduced cells (TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K) cells were performed in the presence of GM-CSF.

Knockdown of Bcl-XL and Mcl-1

The retroviral vector for human Bcl-XL shRNA (SINeG-XRi) and the control vector SINeG-Ri were kindly provided by Dr. Jirong Bai (29). VSV-G pseudotyped retroviral particles were prepared by co-transfection Phoenix293 packaging cells with pVPack-GP, pVPack-VSV-G, and SINeG-XRi or SINeG-Ri. Supernatants (10 ml/each) were collected, filtered, and centrifuged at 25,000 rpm for 2 h with a Beckman SW41 rotor to concentrate the viral particles. Each pellet was resuspended in 0.5 ml RPMI-1640/10%FBS.

Two retroviral Mcl-1 shRNAs, Mcl1-RNAi692 and Mcl1-RNAi908, were prepared using the MSCV-LMP shRNA vector (Open Biosystems) that carries a GFP gene. The targeting sequences were GCTTCGGAAACTGGACATCAAA (for Mcl1-RNAi692) and GGGACTGGCTAGTTAAACAAAG (for Mcl1-RNAi908). The Mcl1-RNAi908 targeting sequence was the same as that used by others (30). VSV-G pseudotyped viruses were prepared as above.

For retrovirus infection, 0.5 ml TF-1/Shp2E76K cells (1 × 106 cells/ml) in RPMI-1640/10%FBS/10 ng/ml GM-CSF/6 μg/ml polybrene were incubated with 0.5 ml retrovirus in a 12-well plate and centrifuged at 2,500 rpm at 30 °C for 1.5 h. After centrifugation, cells were transferred to 6-well plates containing 1 ml RPMI-1640/10%FBS/5 ng/ml GM-CSF medium in each well and incubated for 24 h. For selection of GFP+ cells, cells were cultured in 10 ml RPMI-1640/10%FBS/5 ng/ml GM-CSF for 48 h and then processed for cell sorting with a flow cytometer. For analysis of apoptosis, cells were washed twice with GM-CSF-free medium and incubated in 10 ml RPMI-1640/10%FBS for 4 days.

pLKO.1-based lentiviral Mcl-1 shRNA vectors, TRCN0000005515 (designated here Mcl1-RNAi5515, targeting sequence: GCAGAAAGTATCACAGACGTT) and TRCN0000005517 (designated Mcl1-RNAi5517, targeting sequence: GCTAAACACTTGAAGACCATA) were obtained from Open Biosystems. The non-target pLKO.1-scrambled shRNA (designated non-target-RNAi) was from Sigma. To prepare viral particles, 293FT cells were co-transfected with 10μg of ViraPower Packaging Mix (Invitrogen) and 5 μg viral vector using the calcium phosphate precipitation method. Supernatants containing lentivirus particles were collected 48–72 hours post-transfection and filtered.

For lentivirus infection, TF-1/Shp2E76K cells (3 × 105 cells/ml) in RPMI-1640/10%FBS/10 ng/ml GM-CSF/3 μg/ml polybrene were incubated with an equal volume of lentivirus for 24 h. After which, cells were washed and diluted with 8 × volume of RPMI-1640/10%FBS without GM-CSF and incubated for 4 days and then analyzed for Mcl-1 knockdown and apoptosis. A paralleled experiment using a GFP-encoding lentivirus indicated that >80% of TF-1/Shp2E76K cells were transduced by the virus in our experiments.

Dominant-negative Mek1K97A retrovirus

cDNA encoding a HA-tagged rat Mek1K97A mutant was subcloned from pCMV-HA vector (31) into MigR1 to make MigR1-Mek1K97A retroviral vector. MigR1 and MigR1-Mek1K97A retroviruses were generated with Phoenix AmphoPack293 cells. TF-1/Shp2E76K cells (2 × 106 cells) were infected with MigR1 or MigR1-Mek1K97A viral supernatants. Forty-eight hours after viral infection, GFP+ cells were selected by cell sorting with a flow cytometer. GFP+ cells were used immediately for methylcellulose colony formation assay in the absence of GM-CSF or used for immunoblotting analyses of cell lysates after starvation of GM-CSF for 24 h.

Immunoblotting and immunoprecipitation

Cells were lysed in lysis buffer A (50 mM Tris-HCl, pH. 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 25 mM NaF, 5 mM Na4P2O7, 1% Triton X-100, 1 mM Na3VO4, 20 mM p-nitrophenyl phosphate, 2 mg/ml leupeptin, 2 mg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride). Immunoprecipiation and immunoblotting were performed as described previously (32). For immunoprecipitation of active Bax, cells were lysed in buffer B (150 mM NaCl, 10 mM Hepes pH7.4, 1% CHAPS, 2 mg/ml leupeptin, 2 mg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride). Active Bax was immunoprecipitated with monoclonal antibody 6A7.

Cytochrome c release assay

Cells were collected by centrifugation, washed with PBS, and homogenized in isotonic mitochondrial buffer (210 mM sucrose, 70 mM mannitol, 10 mM Hepes, pH 7.4, 1 mM EDTA, and protease inhibitor cocktail). Cell homogenates were centrifuged at 1,000 × g for 10 min to discard nuclei and unbroken cells. The resulting supernatant was centrifuged at 10,000 × g for 15 min to pellet the mitochondria-enriched heavy membrane fraction. The supernatant was centrifuged further at 100,000× g for 30 min to obtain the cytosolic fraction. Whole cell lysate was obtained in 0.5% NP-40 lysis buffer. Protein concentration was determined and 50 μg of total protein/each was used for immunoblot analysis for the release of cytochrome c into the cytosol. Hsp60 and α-tubulin were used as markers for mitochondria and cytosol, respectively.

Active Ras pull down assay

Active Ras was measured by means of Ras-GTP bound to a GST fusion protein of the Ras-GTP binding domain of Raf fragment (GST-Raf-RBD) (33) followed by immunoblotting with an anti-Ras antibody.

Shp2 PTP assay

TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were incubated in RPMI-1640/10%FBS without GM-CSF for 16h. Cells were collected by centrifugation and lysed in ice-cold PTP lysis buffer [25 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 1:50 diluted protease inhibitor cocktail (Roche, Indianapolis, IN)]. Flag-tagged Shp2 in cell lysate supernatants (0.5 mg/each) was immunoprecipitated with antibody M2 plus protein G-Sepharose at 4 °C for 2 h. Immunoprecipitates were washed twice with the PTP lysis buffer and twice with reaction buffer (20 mM HEPES, pH 7.4, 1 mM EDTA, 5% glycerol, and 1 mM dithiothreitol. Each immunoprecipitate was resuspended in 100 μl of reaction buffer containing 50 μM DiFMUP (Invitrogen) and incubated at room temperature for 15 min. After a brief centrifugation, supernatants were transferred into 96-well plates and the DiFMU fluorescence signal was measured. The remaining immunoprecipitates were used for immunoblotting analysis of Shp2.

Apoptosis analysis by flow cytometry

TF-1/V, TF-1/WT and TF-1/Shp2E76K cells cultured in RPMI-1640/10% FBS/2 ng/ml GM-CSF were washed twice with RPMI-1640/10% FBS and incubated at 12.5 × 104 cells/ml in RPMI-1640/10% FBS without GM-CSF at 37 °C/5% CO2. For experiments involving chemical inhibitors, inhibitors or the equal volume of solvent was added. In all cases, inhibitors or solvent volume were kept ≤0.1% of the total medium volume. Seventy-two h after incubation, cells were harvested, washed with phosphate buffered saline, resuspended in 1 × binding buffer [10mM Hepes (pH7.4), 140mM NaCl, 2.5mM CaCl2] at 1 × 106 cells/ml. 1 × 105 cells were incubated with 5μl Annexin-V-APC and 5μl 7-AAD (BD Pharmingen) for 15 min and then diluted with 400μl 1 × binding buffer. Flow cytometric data were acquired from 1 × 104 cells with a FACSCalibur cytometer (BD Pharmingen) and data were analyzed by the Flowjo software. For analysis of apoptosis of retroviral-based shRNA knockdown cells, GFP+ cells (1 × 104) were gated and analyzed for annexin-V-APC and 7-AAD staining.

Bcl-XL-promoter-luciferase reporter assay

A Bcl-XL promoter-luciferase reporter plasmid (Bcl-XL-Luc) was provided by Dr. Zuoming Sun (34). TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were co-transfected with 1.8 μg Bcl-XL-Luc and 0.2 μg pCMV-βgal using FuGENE6 transfection reagent (Roche). Twenty-four hours after transfection, cells were washed and incubated in RPMI-1640/10%FBS without or with 10 μM U0126, 50μM PD98059, 50 μM LY294002 or 10 μM API-2 for 24 h. Cell lysates were prepared for determination of luciferase and β-galactosidase activities as described (35).

Cell growth assay

TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were maintained in RPMI-1640/10%FBS/5 ng/ml GM-CSF/0.5 μg/ml puromycin. To determine cytokine-independent and cytokine-dependent cell growth, cells were washed with RPMI-1640 and plated at 2 × 104 cell/ml in RPMI-1640/10%FBS without or with indicated amounts of GM-CSF in 6-well plates. Viable cell number was determined by trypan-blue exclusion assay every 24 h.

Methylcellulose colony formation assay

Methylcellulose medium was prepared using MethoCult H4100 (StemCell Technologies) and RPMI 1640/10% FBS/0.5 μg/ml puromycin without or with indicated amounts of GM-CSF according to the supplier’s instruction. Cells (500 or 1,000 cells in 0.1 ml) were mixed with 1 ml methylcellulose medium and plated in 6-well plates. On day 7, cell colonies were stained with thiazolyl blue tetrazolium bromide and enumerated.

RESULTS

Shp2E76K mutant transforms human cytokine-dependent TF-1 cells

TF-1 is a human myeloid cell line that requires GM-CSF or IL-3 for survival and proliferation. To determine if the leukemia-associated Shp2E76K mutant (Fig. 1A) could confer cytokine independence transformation of TF-1 cells, we expressed the wildtype Shp2 (as a control) and Shp2E76K in TF-1 cells through retroviral transduction. TF-1 cells were infected with bicistronic retrovirus MSCV-P or the virus encoding Flag-tagged wildtype Shp2 or Shp2E76K. Puromycin-resistant cells (TF-1/V, TF-1/Shp2, TF-1/Shp2E76K) were selected in cell culture medium containing puromycin and GM-CSF. Immunoblot analysis of these retrovirus-transduced cells showed that a similar amount of Flag-tagged Shp2 and Shp2E76K were expressed in TF-1/Shp2 and TF-1/Shp2E76K cells, respectively (Fig. 1B). Immunoprecipitation of Flag-tagged Shp2 and Shp2E76K from GM-CSF-starved cells followed by PTP assay indicated that Shp2E76K had constitutively elevated PTP activity, which was approximately 25-times of that detected in the wildtype Shp2 (Fig. 1C).

Fig. 1. Expression of Shp2 and Shp2E76K in TF-1 cells.

Fig. 1

A, Schematic representation of Shp2. Glu-76 (E76) located in the N-SH2 domain is mutated to Lys (K) in the Shp2E76K mutant. B, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cell lysate supernatants (10 μg/each) were analyzed by immunoblotting with anti-Flag or anti-β-actin antibody. C, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were deprived of GM-CSF for 16 h. Flag-tagged Shp2 or Shp2E76K were immunoprecipitated from cell lysate supernatants and PTP activity was determined in the immunocomplexes. After the PTP assay, a portion of immunoprecipitates was analyzed by immunoblotting with an anti-Flag antibody (inset). V, TF-1/V cells; WT, TF-1/Shp2 cells; EK and E76K, TF-1/Shp2E76K cells (these designators apply to subsequent figures).

We next incubated these cells in the absence or the presence of various concentrations of GM-CSF and measured viable cell number by the trypan blue exclusion assay. Viable TF-1/V and TF-1/Shp2 cell numbers started to decrease after 2 days in GM-CSF-free medium that contained 10% FBS (Fig. 2A). This property was the same as that of the parental cells (not shown). In contrast, the viable TF-1/Shp2E76K cell number continued to increase in the absence of GM-CSF (Fig. 2A). GM-CSF caused concentration-dependent stimulation of proliferation of these cell lines. At low concentrations of GM-CSF (≤0.01 ng/ml), TF-1/Shp2E76K was more sensitive to GM-CSF than that of TF-1/V and TF-1/Shp2 (Fig. 2).

Fig. 2. Shp2E76K confers cytokine-independence transformation of TF-1 cells.

Fig. 2

A, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells (2 × 104 cells/ml) were incubated in RPMI-1640/10%FBS/0.5 μg/ml puromycin without or with indicated concentrations of GM-CSF. Viable cell numbers were determined every day (left panel) or on day 4 (right panel) by the trypan blue exclusion assay. B, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells (500 cells/well) were incubated in methylcellulose medium in the absence or the presence GM-CSF for 7 days and cell colonies were enumerated (left panel). The data were from two separate experiments performed in duplicates. GM-CSF-independent colonies of TF-1/Shp2E76K cells were randomly isolated from the methylcellulose culture. After expansion of cell number in RPMI-1640/10%FBS/0.5 μg/ml puromycin, cell lysates were prepared and analyzed by immunoblotting with antibodies to Flag-tag and β-actin (right panel).

To determine if cytokine independence of TF-1/Shp2E76K cells was mediated by autocrine secretion of cytokine(s), we tested if conditional medium from TF-1/Shp2E76K cells could support survival and growth of TF-1 cells. The result was negative (not shown). Thus, similar to that reported in human JMML cells (20), transformation of TF-1 cells by Shp2E76K is not mediated by an autocrine mechanism.

In methylcellulose culture, TF-1/Shp2E76K cells formed GM-CSF-independent colonies and displayed hypersensitivity to low concentrations of GM-CSF (Fig. 2B, left panel). Cytokine-independent methylcellulose colony was not observed with TF-1/V or TF-1/Shp2 cells. To determine if Shp2E76K was expressed in GM-CSF-independent TF-1/Shp2E76K cell colonies, we randomly isolated GM-CSF-independent TF-1/Shp2E76K colonies from methylcellulose culture and analyzed the presence of Shp2E76K in these cells by immunoblotting. As shown in Fig. 2B (right panel), all GM-CSF-independent colonies were Shp2E76K positive. This result and the observation that cytokine-independent colonies were never observed with TF-1/V and TF-1/Shp2 cells indicate that cytokine-independence transformation of TF-1/Shp2E76K cells is due to Shp2E76K expression.

Shp2E76K induces cytokine-independent survival of TF-1 cells

To assess if Shp2E76K supports cytokine-independent survival of TF-1 cells, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were cultured in the presence or absence of GM-CSF for 3 days. Cell death was then analyzed by annexin-V/7-AAD binding assay. Approximately 10–15% cells were stained annexin-V-positive (annexin-V+/7AAD plus annexin-V+/7AAD+ cells) in the presence of GM-CSF (Fig. 3A). Three days after GM-CSF withdrawal, ~70% of TF-1/V and TF-1/Shp2 cells became annexin-V positive, whereas no increase in annexin-V-binding was observed in TF-1/Shp2E76K cells (Fig. 3A).

Fig. 3. TF-1/Shp2E76K cells are resistant to cytokine withdrawal-induced apoptosis.

Fig. 3

A, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were cultured in RPMI-1640/10%FBS/0.5 μg/ml puromycin with 5 ng/ml GM-CSF (upper panels) or without GM-CSF for 3 days (lower panels). Annexin-V/7-AAD stainings were analyzed by flow cytometry. The data were from two independent experiments performed in duplicates. B, Cells were cultured in the presence of GM-CSF or in the absence of GM-CSF for 2 days. Cell lysates were prepared with buffer B. Activated Bax was immunoprecipitated with monoclonal antibody 6A7 and immunoprecipitates were analyzed by immunoblotting with a polyclonal anti-Bax antibody (upper panel). Cell lysate supernatants were also subject to immunoblot analysis with the polyclonal anti-Bax antibody (lower panel). C. Cells were cultured as in B and cytosolic fraction or cell lysate was prepared and analyzed by immunoblots for the presence of cytochrome c, α-tubulin (a cytosolic protein), or Hsp60 (a mitochondrial protein).

Bax activation mediates the intrinsic/mitochondrial apoptosis pathway (36). The monoclonal antibody 6A7 specifically recognizes the active form of Bax (37,38). Active Bax was not detected in TF-1/V, TF-1/Shp2, or TF-1/Shp2E76K cells when they were cultured in the presence of GM-CSF (Fig. 3B). After deprivation of GM-CSF for 1–2 days, active Bax was readily detectable in TF-1/V and TF-1/Shp2 cells, indicating that cytokine withdrawal triggered the intrinsic apoptosis pathway in these cells. In contrast, no active Bax was observed in TF-1/Shp2E76K cells after GM-CSF withdrawal even though there was no decrease in the amount of total Bax protein in the cell lysate (Fig. 3B). Consistent with the Bax activation data, cytosolic cytochrome c was detected in TF-1/V and TF-1/Shp2 cells, but not in TF-1/Shp2E76K cells, after deprivation of GM-CSF for 2 days (Fig. 3C). These results show that TF-1/Shp2E76K cells have acquired the cytokine-independent survival activity by preventing cytokine withdrawal-induced intrinsic apoptosis pathway.

Up-regulation of Bcl-XL is essential for cytokine-independent survival of TF-1/Shp2E76K cells

The intrinsic/mitochondrial apoptosis pathway is controlled by the interplay between pro-survival and pro-apoptotic Bcl-2 family proteins (36). To understand how Shp2E76K induces cytokine-independent survival of TF-1 cells, we examined expression of pro-survival Bcl-2 family proteins (Bcl-2, Bcl-XL, Bcl-w, Mcl-1, and A1) and a number of BH3-only pro-apoptotic Bcl-2 family proteins (Bad, Bim, Noxa, Puma) in TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells. Bcl-2 and Bcl-w were not detectable in these TF-1 cells (data not shown). A weak A1 protein band was detected in TF-1 cell lysates but no difference in the A1 protein level was observed among TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells cultured in the presence or the absence of GM-CSF. TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells had a similar amount of Bcl-XL in the presence of a high concentration of GM-CSF (Fig. 4). After GM-CSF withdrawal, the Bcl-XL level in TF-1/V and TF-1/Shp2 cells was decreased by 5-fold. However, TF-1/Shp2E76K cells continued to maintain a high level of Bcl-XL. TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells contained a similar amount of Mcl-1 in the presence of GM-CSF (Fig. 4). A smaller, 2-fold decrease in Mcl-1 protein level was detected after GM-CSF deprivation in TF-1/V and TF-1/Shp2 cells but not in TF-1/Shp2E76K cells.

Fig. 4. Expression of Bcl-2 family proteins in TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells.

Fig. 4

Cells were cultured in RPMI-1640/10%FBS/0.5 μg/ml puromycin with 5 ng/ml GM-CSF or without GM-CSF for 24 h. Cell lysate supernatants were analyzed by immunoblotting with antibodies to pro-survival or pro-apoptotic Bcl-2 family proteins or to β-actin (loading control) as indicated.

No difference in pro-apoptotic Bcl-2 family proteins BimEL, Noxa, and Puma was observed among the three cell lines in the presence or absence of GM-CSF (Fig. 4). The amount of pro-apoptotic Bad protein was markedly decreased in TF-1/V and TF-1/Shp2 cells after GM-CSF withdrawal, while a lesser reduction in Bad protein was observed in TF-1/Shp2E76K cells (Fig. 4). Since Bad is a pro-apoptotic Bcl-2 family protein, the lower amount of Bad in TF-1/V and TF-1/Shp2 cells under GM-CSF-free conditions could not be a contributing mechanism for TF-1/V and TF-1/Shp2 cell death while TF-1/Shp2E76K cell survival in GM-CSF-free medium.

To determine if up-regulation of Bcl-XL and Mcl-1 play a critical role in cytokine-independent survival of TF-1/Shp2E76K cells, we analyzed the effects of Bcl-XL and Mcl-1 knockdown on cytokine-independent survival of TF-1/Shp2E76K cells. TF-1/Shp2E76K cells were infected with a retrovirus (SINeG-XRi) that encodes Bcl-XL shRNA and GFP or with the control virus (SINeG-Ri) (29). Immunoblot analysis of GFP+ cells indicated Bcl-XL was knocked down by the shRNA in infected cells (Fig. 5A). The effect of Bcl-XL knockdown on cytokine-independent survival of TF-1/Shp2E76K cells was then determined by flow cytometric analysis of annexin-V/7-AAD staining in GFP-gated cell population after these cells were incubated in GM-CSF-free medium. As shown in Fig. 5B, TF-1/Shp2E76K cells infected with the control SINeG-Ri virus were stained 11.2% positive for annexin-V, whereas TF-1/Shp2E76K cells infected with the SINeG-RXi Bcl-XL shRNA virus were stained 39.1% positive for annexin-V. Thus, knockdown of Bcl-XL prevented cytokine-independent survival of TF-1/Shp2E76K cells.

Fig. 5. Effects of Bcl-XL and Mcl-1 knockdown on cytokine-independent survival of TF-1/Shp2E76K cells.

Fig. 5

A and B, TF-1/Shp2E76K cells were infected with a retrovirus encoding Bcl-XL shRNA and GFP (SINeG-XRi) or the control virus (SINeG-Ri). Cells lysates were prepared before (−) or after (+) flow cytometric sorting of GFP+ cells and analyzed by immunoblotting with antibodies to Bcl-XL or β-actin (A). After 4 days in GM-CSF-free medium, cells were processed for annexin-V/7-AAD binding. GFP+ cells were gated and analyzed by flow cytometry for annexin-V/7-AAD binding (B). C and D, Cells were infected with two lentiviruses encoding Mcl-1 shRNAs or with a lentivirus containing non-target scrambled shRNA. Cell lysate supernatants were analyzed by immunoblotting with indicated antibodies (C). After deprivation of GM-CSF for 4 days, cells were analyzed for annexin-V/7-AAD binding activity (D). E and F, TF-1/Shp2E76K cells were infected with two retroviruses encoding Mcl-1 shRNAs or with a control retrovirus. After infection, cells were sorted to select GFP+ cells, cell lysate supernatants were prepared, and analyzed by immunoblotting (E). After GM-CSF deprivation for 4 days, cells were analyzed for annexin-V/7-AAD binding in the GFP+-gated cell population (F). Flow cytometric data were from two independent experiments performed in duplicates (n = 4)

To knock down Mcl-1 in TF-1/Shp2E76K cells, we employed two lentiviral shRNAs (Mcl1-RNAi5515 and Mcl1-RNAi5517) obtained from a commercial source. As shown in Fig. 5C, knockdown of Mcl-1 was apparent in non-selected cell population after lentivirus infection, indicating that most of cells were infected by these shRNA-encoding lentiviruses. However, flow cytometric analysis of apoptosis showed that knockdown of Mcl-1 by these two lentiviral shRNAs did not cause apoptosis of TF-1/Shp2E76K cells cultured in GM-CSF-free medium (Fig. 5D).

To rule out the possibility that a small fraction of cells not infected by lentiviruses might obscure the result of our apoptosis analysis, we prepared two retroviral Mcl-1 shRNAs (Mcl1-RNAi692 and Mcl1-RNAi908) using the MSCV-LMP vector. MSCV-LMP is a shRNA vector that carries a GFP gene, so that infected cells can be selected for flow cytometric analysis. Fig. 5E shows that both Mcl1-RNAi692 and Mcl1-RNAi908 were able to knock down Mcl-1 in GFP+ TF-1/Shp2E76K cells. Apoptotic analysis of GFP-gated TF-1/Shp2E76K cells showed that knockdown of Mcl-1 with Mcl1-RNAi692 or Mcl1-RNAi908 did not resulted in apoptosis of TF-1/Shp2E76K cells cultured in GM-CSF-free medium (Fig. 5F).

HA14-1 but not roscovitine induces apoptosis of TF-1/Shp2E76K cells cultured in GM-CSF-free medium

Roscovitine is a cyclin-dependent kinase inhibitor known to down regulate Mcl-1 expression (30,39). HA14-1 was discovered originally as a Bcl-2 inhibitor (4043). Recent data indicated that it cross-inhibited Bcl-XL and Bcl-w (44). Consistent with previous reports (30,39), treatment of TF-1/Shp2E76K cells with roscovitine resulted in down regulation of Mcl-1, whereas it had no effect on Bcl-XL (Fig. 6A). To further analyze the requirement of Bcl-XL and Mcl-1 in Shp2E76K-induced cytokine-independent survival of TF-1 myeloid cells, we examined the effects of roscovitine and HA14-1 on apoptosis of TF-1/Shp2E76K cells cultured in GM-CSF free medium. As shown in Fig. 6B, incubation of TF-1/Shp2E76K cells with roscovitine at concentrations sufficient to down regulate Mcl-1 did not lead to cleavage of PARP. This result indicates that down regulation of Mcl-1 does not prevent Shp2E76K-induced cytokine-independent survival of TF-1 cells. In the parallel experiment, treatment of TF-1/Shp2E76K cells with HA14-1 resulted in PARP cleavage. Since Bcl-2 and Bcl-w are not expressed in TF-1 cells, data from the HA14-1 experiment suggest that inhibition of Bcl-XL is sufficient to block cytokine-independent survival of TF-1/Shp2E76K cells.

Fig. 6. Effects of HA14-1 and Roscovitine on cytokine-independent survival of TF-1/Shp2E76K cells.

Fig. 6

TF-1/Shp2E76K cells were incubated in GM-CSF-free medium containing indicated concentrations of roscovitine or HA14-1 for 24 h. Cell lysates were analyzed for down regulation of Mcl-1 (A) or PARP cleavage (B) by immunoblotting.

The Ras-Erk1/2 pathway is constitutively activated in Shp2E76K-transformed TF-1 myeloid cells

To determine which signaling pathway(s) are activated by Shp2E76K in GM-CSF-free medium, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were starved of GM-CSF for 18 h and then left untreated or stimulated with GM-CSF (1 ng/ml) for 10–60 min. Active Erk1/2, Akt, and Stat5 in cell lysates were analyzed by immunoblotting with phospho-specific antibodies. Active Erk1/2 was readily detected in TF-1/Shp2E76K cells in the absence of GM-CSF whereas active Akt and Stat5 were not (Fig. 7A). The amount of constitutively active Erk1/2 in TF-1/Shp2E76K cells under GM-CSF-free conditions was similar to that detected in GM-CSF-stimulated TF-1/V and TF-1/Shp2 cells. Consistent with Erk1/2 activation in TF-1/Shp2E76K cells, Ras was constitutively activated in TF-1/Shp2E76K cells (Fig. 7B). To increase the sensitivity of detecting active Akt and Stat5 under GM-CSF-free conditions, we immunoprecipitated Akt and Stat5 and analyzed the presence of phosphorylated Akt and Stat5 in these immunoprecipitates. A small amount of active Akt was detectable in Akt immunoprecipitates from TF-1/V and TF-1/Shp2 cells (Fig. 7C). The amount of active Akt was increased marginally in Akt immunoprecipitates from TF-1/Shp2E76K cells. Similarly, a small amount of active Stat5 was detected after immunoprecipiation of Stat5 from TF-1/Shp2E76K cells (Fig. 7D). However, this did not result in an increase in Stat5 luciferase reporter activity (data not shown).

Fig. 7. Comparison of Ras-Erk1/2 and Akt activation in TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells.

Fig. 7

A, TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were deprived of GM-CSF in RPMI-1640/10%FBS for 18 h and then left untreated or stimulated with GM-CSF (1 ng/ml) for 10–60 min as indicated. Cell lysate supernatants were analyzed by immunoblotting with antibodies to phospho-Erk1/2 (p-Erk1/2), total Erk1/2 (t-Erk1/2), pS473-Akt (p-Akt), total Akt (t-Akt), pY694-Stat5 (p-Stat5), and total Stat5 (t-Stat5). B, Cells were starved of GM-CSF for 18 h and cell lysate supernatants were prepared. Active Ras was pulled down with GST-RBD and analyzed by immunoblotting with an anti-Ras antibody (upper panel). Cell lysate supernatants were also analyzed directly by immunoblotting with an anti-Ras antibody (lower panel). C and D, Cells were starved of GM-CSF for 18 h. Akt or Stat5 were immunoprecipitated from cell lysate supernatants and analyzed by immunoblotting with anti-pS473-Akt (upper panel) or total Akt (lower panel) (C) or with anti-phosphotyrosine (upper panel) or total Stat5 (lower panel) (D).

Stimulation of cells with GM-CSF markedly activated Erk1/2, Akt and Stat5 in TF-1/V and TF-1/Shp2 cells (Fig. 7A). A higher level of active Erk1/2 was observed in GM-CSF-stimulated TF-1/Shp2E76K cells than that in TF-1/V and TF-1/Shp2 cells at a late time point (30 min). In contrast, GM-CSF-stimulated Akt activation was suppressed by Shp2E76K. These results indicate that the Ras-Erk1/2 MAP kinase pathway is the major signaling pathway activated by Shp2E76K in TF-1 cells.

Shp2E76K up-regulates Bcl-XL via the Erk1/2 pathway

To evaluate the contribution of Erk1/2 and Akt pathways in Shp2E76K-induced Bcl-XL expression in TF-1 cells, we determined effects of Mek1/2 inhibitors U0126 and PD98059, the PI3K inhibitor LY294002, and the Akt inhibitor API-2 on Bcl-XL expression in TF-1/Shp2E76K cells. TF-1/Shp2E76K cells were incubated in GM-CSF-free medium containing U0126 (10 μM), PD98059 (50μM), LY294002 (50 μM), API-2 (10 μM) or the solvent for 24 h. Cell lysates were analyzed by immunoblotting for Bcl-XL. U0126 and PD98059 effectively reduced the Bcl-XL protein level in TF-1/Shp2E76K cells, whereas LY294002 and API-2 did not (Fig. 8A). The Shp2E76K-regulated Mcl-1 expression was also reduced by U0126, PD98059, and LY294002 but not by API-2 treatment (Fig. 8A)

Fig. 8. Inhibition of Bcl-XL expression by Mek inhibitors.

Fig. 8

A, TF-1/Shp2E76K cells were incubated in GM-CSF-free medium plus U0126 (10 μM), PD98059 (50 μM), LY294002 (50 μM), API-2 (10 μM), or the solvent (DMSO) for 24 h. Cell lysates were prepared and analyzed by immunoblotting with indicated antibodies. B, Cells were co-transfected with Bcl-XL-promoter-Luc and pCMV-β-gal plasmids in medium containing GM-CSF. Twenty-four h after transfection, cells were incubated in GM-CSF-free medium without or with indicated inhibitors for another 24 h. Luciferase activity was determined and normalized to β-galactoside activity (n = 3). C, TF-1/Shp2E76K cells were incubated in GM-CSF-free medium plus U0126 (10 μM), PD98059 (50 μM), LY294002 (50 μM), API-2 (10 μM), or the solvent (DMSO) for 3 days. Apoptosis were determined by flow cytometric analysis of annexin-V/7-AAD binding (n ≥ 4). Annexin-V-positive cells include both 7-AAD-negative and 7-AAD-positive cell population.

We compared Bcl-XL-promoter activity in TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells using a Bcl-XL-promoter-Luc reporter. Under GM-CSF-free conditions, Bcl-XL-promoter transcription activity was similar in TF-1/V and TF-1/Shp2 cells, whereas the Bcl-XL-promoter activity was elevated >3-fold in TF-1/Shp2E76K cells (Fig. 8B). U0126 and PD98059 treatments reduced Bcl-XL-promoter activity in TF-1/Shp2E76K cells to a level similar to that detected in TF-1/V and TF-1/Shp2 cells. In contrast, LY294002 and API-2 treatments did not reduce the Bcl-XL-promoter activity in TF-1/Shp2E76K cells (Fig. 8B). These results indicate that up-regulation of Bcl-XL by Shp2E76K in TF-1 cells is mediated primarily by the Erk1/2 pathway.

If Bcl-XL is essential for Shp2E76K-induced cytokine-independent survival of TF-1 cells and if Erk1/2 mediates Shp2E76K-induced Bcl-XL expression, blocking Erk1/2 activation should prevent Shp2E76K-induced cytokine-independent survival of TF-1 cells. Consistent with this prediction, Fig. 8C shows that marked increases in apoptotic cells were detected after TF-1/Shp2E76K cells were treated with Mek inhibitors U0126 or PD98059 in GM-CSF-free medium. Inhibition of Akt, on the other hand, had minimal effect on cytokine-independent survival of TF-1/Shp2E76K cells.

Shp2E76K-induced TF-1 cell transformation is blocked by a dominant-negative Mek1 mutant

To further evaluate the requirement of Erk1/2 in Shp2E76K-induced TF-1 cell transformation, we transiently expressed a kinase-dead Mek1 mutant (Mek1K97A) in TF-1/Shp2E76K cells using a bicistronic GFP retrovirus. TF-1/Shp2E76K cells were infected with MigR1 and Mig-R1-Mek1K97A retroviruses, respectively. GFP+ cells were selected and analyzed. As shown in Fig. 9A, Mek1K97A effectively blocked Shp2E76K-induced Erk1/2 activation under GM-CSF-free conditions. Consistent with data obtained with U0126 and PD98059, Shp2E76K-regulated Bcl-XL and Mcl-1 expression in TF-1/Shp2E76K cells was inhibited by Mek1K97A (Fig. 9A). In methylcellulose colony formation assay, GM-CSF-independent colonies were observed with MigR1-infected TF-1/Shp2E76K cells similar to that seen with TF-1/Shp2E76K cells, whereas no GM-CSF-independent colony was found with MigR1-Mek1K97A-infected cells (Fig. 9B). These results support the notion that the Erk1/2 pathway is required for up-regulation of Bcl-XL and cytokine-independence transformation of TF-1 cells by Shp2E76K.

Fig. 9. Effects of a dominant-negative Mek1 mutant (Mek1K97A) on TF-1/Shp2E76K cells.

Fig. 9

TF-1/Shp2E76K cells were infected with MigR1 or MigR1-Mek1K97A retroviruses and selected by cell sorting. GFP+ cells were used immediately for GM-CSF-independent methylcellulose colony formation assay (1,000 cells/well) (A) (n = 6). The rest of cells were starved of GM-CSF for 24 h. Cell lysate supernatants (15 μg/each) were analyzed by immunoblotting with an anti-HA antibody (for detection of Mek1K97A) or with indicated antibodies.

In another experiment, we expressed a constitutively active Mek1 mutant (Mek1S218/222D) (31) in TF-1 cells using the MigR1 retroviral vector. However, although Mek1S218/222D was readily detectable in retroviral-infected cells, these cells could not form cytokine-independent colony in methylcellulose culture, suggesting that Mek1 activation alone may not be sufficient to cause TF-1 cell transformation (data not shown).

TF-1/Shp2E76K cells are less sensitive to doxorubicin- and etoposide-induced apoptosis than TF-1/V and TF-1/Shp2 cells

When TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells were incubated with an intermediate amount of GM-CSF (1 ng/ml), the Bcl-XL level was higher in TF-1/Shp2E76K cells while all three cell lines had minimal amount of cleaved PARP (Fig. 10). To further assess the role of Bcl-XL in apoptosis of TF-1 cells, we treated TF-1/V, TF-1/Shp2, and TF-1/Shp2E76K cells under the above conditions with increasing concentrations of doxorubicin or etoposide for 24 h. Apoptosis was measured by PARP cleavage. PARP cleavage was induced in TF-1/V and TF-1/Shp2 cells at the lowest concentrations of doxorubicin (3 μM) and etoposide (5 μM) used (Fig. 10). At the highest concentrations of doxorubicin (27 μM) and etoposide (45 μM) tested, TF-1/Shp2E76K cells had less cleaved PARP than that detected in TF-1/V and TF-1/Shp2 cells treated with the lowest drug concentrations (Fig. 10). Thus, TF-1/Shp2E76K cells are resistant to doxorubicin- and etoposide-induced apoptosis. Interestingly, Mcl-1 protein became undetectable in these cells when they were treated with ≥ 9 μM doxorubicin, whereas no change was observed in etoposide-treated cells. Thus, the change in Mcl-1 did not correlate with apoptosis. In particular, depletion of Mcl-1 in doxorubicin-treated TF-1/Shp2E76K cells did not lead to apoptosis. These data again are in agreement with the hypothesis that Bcl-XL, but not Mcl-1, is a critical determinant of the survival of TF-1/Shp2E76K cells.

Fig. 10. TF-1/Shp2E76K cells are resistant to doxorubicin- and etoposide-induced apoptosis.

Fig. 10

Cells were incubated in medium containing 1 ng/ml GM-CSF with indicated concentrations of doxorubicin or etoposide for 24 h. Cell lysates were prepared and analyzed by immunoblotting with indicated antibodies.

DISCUSSION

Shp2E76K is the most frequently observed Shp2 mutant in human leukemias (16,25,45). We found here that Shp2E76K could transform cytokine-dependent human TF-1 myeloid cells into cytokine-independence. This represents the first cytokine-dependent cell line that can be transformed by a leukemia-associated Shp2 mutant and opens a new avenue for mechanistic studies of Shp2 mutant-associated leukemogenesis.

Cytokine-independence transformation involves bypassing the requirement for cytokine-dependent cell survival and proliferation. In the present study, we addressed the mechanism by which Shp2 mutant-induced cytokine-independent cell survival. Data from our Bax activation and cytochrome c release experiments indicate that Shp2E76K suppressed the intrinsic/mitochondrial apoptosis pathway caused by cytokine withdrawal in TF-1 cells. The intrinsic/mitochondrial apoptosis pathway is controlled by Bcl-2 family proteins. We found no decrease in pro-apoptotic Bcl-2 family proteins in TF-1/Shp2E76K cells among those that we have analyzed, suggesting that Shp2E76K is unlikely to cause cytokine-independent survival of TF-1 cells by suppressing expression of pro-apoptotic Bcl-2 family proteins.

A recent report found that Shp2 mediates FGF4-induced survival of murine trophoblast stem cells by degradation of the pro-apoptotic protein Bim in these cells (11). In murine trophoblast stem cells, deprivation of FGF4 results in Bim accumulation. Activation of Erk1/2 through Shp2 by FGF4 causes degradation of Bim and thus cell survival (11). Unlike these cells where Bim is minimal in the presence of FGF4 (11), TF-1 cells contain a high level of Bim even in the presence of GM-CSF (Fig. 4). We found no decrease in Bim protein level in TF-1/Shp2E76K cells, indicating that the gain-of-function Shp2E76K mutant does not utilize the same mechanism as the wildtype Shp2 in FGF4-stimulated murine trophoblast stem cells to suppress apoptosis of TF-1 myeloid cells.

Among pro-survival Bcl-2 family proteins, Bcl-XL and Mcl-1 were up-regulated by Shp2E76K in TF-1 cells. Interestingly, knockdown of Bcl-XL by shRNAs was sufficient to prevent cytokine-independent survival of TF-1/Shp2E76K cells, whereas knockdown of Mcl-1 by shRNAs did not affect TF-1/Shp2E76K cell survival in cytokine-free medium. These data indicate that Bcl-XL and Mcl-1 are not functionally equivalent and that up-regulation of Bcl-XL is essential for cytokine-independent survival of TF-1/Shp2E76K cells.

This notion is supported by data from our experiments using pharmacological inhibitors. Consistent with previous observation in other cell lines (30,39), roscovitine reduced Mcl-1 expression in TF-1/Shp2E76K cells. However, inhibition of Mcl-1 expression by roscovitine did not result in apoptosis of TF-1/Shp2E76K cells under GM-CSF-free conditions. In contrast, treatment of these cells with the Bcl-XL inhibitor HA14-1 led to apoptosis of TF-1/Shp2E76K cells. HA14-1 has been reported to inhibit Bcl-2, Bcl-XL, and Bcl-w (44), among which only Bcl-XL is expressed in TF-1 cells. Whether HA14-1 can cross inhibit Mcl-1 is currently unknown. However, since down regulation of Mcl-1 with shRNAs and roscovitine did not result in apoptosis of TF-1/Shp2E76K cells in cytokine-free medium, the apoptotic activity of HA14-1 is unlikely due to Mcl-1 inhibition even if HA14-1 could cross inhibit Mcl-1. Moreover, we found that doxorubicin could deplete Mcl-1 in TF-1 cells. However, depletion of Mcl-1 by doxorubicin in TF-1/Shp2E76K cells did not result in apoptosis. Together, these molecular and pharmacological data indicate that Bcl-XL plays an essential role in the gain-of-function Shp2E76K mutant-induced cytokine-independent survival of TF-1 myeloid cells. Furthermore, these data suggest that Bcl-XL is a molecular target for therapeutic intervention of Shp2 mutant-associated leukemias.

Similar to that observed in Shp2E76K-transduced murine bone marrow cells (22,24), Erk1/2 was constitutively activated in GM-CSF-starved TF-1/Shp2E76K cells to a level similar to that in GM-CSF-stimulated TF-1/V and TF-1/Shp2 cells. This property is consistent with the fact that Shp2 is a positive regulator of the Ras-Erk1/2 pathway. Importantly, it demonstrates that Shp2E76K is able to cause constitutive activation of the Ras-Erk1/2 pathway in TF-1 cells. Inhibition of Erk1/2 activation with Mek inhibitors or a dominant-negative Mek1 mutant blocked Shp2E76K-induced Bcl-XL expression and prevent cytokine-independent survival and transformation of TF-1/Shp2E76K cells. These data indicate the Erk1/2 activity is essential for Bcl-XL-dependent survival of Shp2E76K-transformed TF-1 cells in cytokine-free medium.

Akt was weakly activated in TF-1/Shp2E76K cells cultured in GM-CSF-free RPMI-1640/10%FBS. Inhibition of Akt did not interfere with Bcl-XL expression in TF-1/Shp2E76K cells in GM-CSF-free medium and had a minimal effect on cytokine-independent survival of TF-1/Shp2E76K cells. These results suggest that Akt does not play a major role in Shp2E76K-induced cytokine-independent survival of TF-1 myeloid cells.

GM-CSF (1 ng/ml) markedly activated Akt in TF-1/V and TF-1/Shp2 cells but not in TF-1/Shp2E76K cells in RPMI-1640/10%FBS medium. This result demonstrates that Shp2E76K could have dual effects on Akt activation. In the absence of GM-CSF, Shp2E76K could weakly activate Akt, but at higher concentrations of GM-CSF, Shp2E76K could negatively affect the GM-CSF-stimulated Akt activation. The suppressive effect of Shp2E76K on GM-CSF-stimulated Akt activity (Fig. 7A) may account for the slower growth rate of TF-1/Shp2E76K cells than that of TF-1/V and TF-1/Shp2 cells in the presence of higher concentrations of GM-CSF (≥1 ng/ml) (Fig. 2A, right panel).

Leukemia-associated Shp2 mutants such as Shp2E76K have been reported to induce cytokine-independent methylcellulose colonies in murine bone marrow and fetal liver cells (2224). However, previous attempts (22,25) have found that Shp2 mutants could not transform murine cytokine-dependent Ba/F3 and 32D cells into cytokine-independence. Although leukemic oncogenes such as Bcr-Abl readily transforms cytokine-dependent Ba/F3 and 32D cells, the inability of a leukemic oncogene to transform Ba/F3 and 32D cells into cytokine independence is not unprecedented. Jak2V617F, which causes polycythemia vera and several other types of myeloid malignancies, also cannot transform Ba/F3 and 32D cells (46).

The reason that Shp2E76K cannot transform Ba/F3 or 32D cells is currently unknown. However, this may be due to a) insufficiency of Shp2E76K to activate intracellular signaling pathways in these cells or b) that the Shp2E76K-activated Ras-Erk1/2 signaling pathway is not sufficient to support cytokine-independent survival/proliferation of these cells. Interestingly, no increased level of active Erk1/2, Akt, or STAT5 was detected under GM-CSF/IL-3-free conditions in Ba/F3 cells that expressed Shp2E76K (25,26). Thus, like Jak2V617F (46), Shp2E76K appears unable to trigger activation of survival/proliferative signaling in Ba/F3 cells. Conversely, similar to what we observed in TF-1 cells in this study, in murine macrophage progenitors in which Shp2E76K could evoke cytokine-independent colonies, a constitutively elevated level of active Erk1/2 was observed in the absence of GM-CSF/IL-3 (24). Therefore, it appears that leukemia-associated Shp2 mutants require specific cellular context in order to activate intracellular signaling, which is present in TF-1 cells and in murine macrophage progenitor cells. Identification of the cellular basis required for Shp2E76K to activate intracellular signaling in future study should shed light on leukemogenic mechanism of Shp2 mutants.

In summary, we have found that the leukemia-associated Shp2E76K mutant can transform the cytokine-dependent TF-1 cells into cytokine-independence, which is dependent upon the ability of Shp2E76K to cause constitutive Erk1/2 activation in TF-1 cells. Furthermore, our study has revealed that Shp2E76K confers cytokine-independent survival of TF-1 cells through a novel mechanism involving up-regulation of the anti-apoptotic Bcl-XL protein via the Erk1/2 signaling pathway.

Acknowledgments

We thank Drs. Jirong Bai, Zuoming Sun, and Michael Weber for reagents. This work was supported in part by NIH grants R01CA077467 and P01CA118210 and a research grant from Children’s Leukemia Research Association. We also acknowledge the Moffitt Cancer Center core facilities.

The abbreviations used are

GM-CSF

granulocyte-macrophage colony-stimulating factor

IL-3

interleukin-3

Erk1/2

Erk1 and Erk2

MAP kinase

mitogen-activated protein kinase

SH2

Src homology-2

PTP

protein tyrosine phosphatase

JMML

juvenile myelomonocytic leukemia

PI3K

phosphoinositide-3-kinase

FGF4

fibroblast growth factor 4

GFP

green fluorescence protein

7-AAD

7-amino-actinomycin D

PARP

poly(ADP-ribose) polymerase

FBS

fetal bovine serum

References

  • 1.Neel BG, Gu H, Pao L. Trends Biochem Sci. 2003;28(6):284–293. doi: 10.1016/S0968-0004(03)00091-4. [DOI] [PubMed] [Google Scholar]
  • 2.Hof P, Pluskey S, Dhe-Paganon S, Eck MJ, Shoelson SE. Cell. 1998;92(4):441–450. doi: 10.1016/s0092-8674(00)80938-1. [DOI] [PubMed] [Google Scholar]
  • 3.Gu H, Neel BG. Trends Cell Biol. 2003;13(3):122–130. doi: 10.1016/s0962-8924(03)00002-3. [DOI] [PubMed] [Google Scholar]
  • 4.Cunnick JM, Mei L, Doupnik CA, Wu J. J Biol Chem. 2001;276(26):24380–24387. doi: 10.1074/jbc.M010275200. [DOI] [PubMed] [Google Scholar]
  • 5.Cunnick JM, Dorsey JF, Munoz-Antonia T, Mei L, Wu J. J Biol Chem. 2000;275(18):13842–13848. doi: 10.1074/jbc.275.18.13842. [DOI] [PubMed] [Google Scholar]
  • 6.Deb TB, Wong L, Salomon DS, Zhou G, Dixon JE, Gutkind JS, Thompson SA, Johnson GR. J Biol Chem. 1998;273(27):16643–16646. doi: 10.1074/jbc.273.27.16643. [DOI] [PubMed] [Google Scholar]
  • 7.Xiao S, Rose DW, Sasaoka T, Maegawa H, Burke TR, Jr, Roller PP, Shoelson SE, Olefsky JM. J Biol Chem. 1994;269(33):21244–21248. [PubMed] [Google Scholar]
  • 8.Rivard N, McKenzie FR, Brondello JM, Pouyssegur J. J Biol Chem. 1995;270(18):11017–11024. doi: 10.1074/jbc.270.18.11017. [DOI] [PubMed] [Google Scholar]
  • 9.Bennett AM, Hausdorff SF, O’Reilly AM, Freeman RM, Neel BG. Mol Cell Biol. 1996;16(3):1189–1202. doi: 10.1128/mcb.16.3.1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yu M, Luo J, Yang W, Wang Y, Mizuki M, Kanakura Y, Besmer P, Neel BG, Gu H. J Biol Chem. 2006;281(39):28615–28626. doi: 10.1074/jbc.M603742200. [DOI] [PubMed] [Google Scholar]
  • 11.Yang W, Klaman LD, Chen B, Araki T, Harada H, Thomas SM, George EL, Neel BG. Dev Cell. 2006;10(3):317–327. doi: 10.1016/j.devcel.2006.01.002. [DOI] [PubMed] [Google Scholar]
  • 12.Gelb BD, Tartaglia M. Hum Mol Genet. 2006;15(Spec No 2):R220–226. doi: 10.1093/hmg/ddl197. [DOI] [PubMed] [Google Scholar]
  • 13.Bentires-Alj M, Paez JG, David FS, Keilhack H, Halmos B, Naoki K, Maris JM, Richardson A, Bardelli A, Sugarbaker DJ, Richards WG, Du J, Girard L, Minna JD, Loh ML, Fisher DE, Velculescu VE, Vogelstein B, Meyerson M, Sellers WR, Neel BG. Cancer Res. 2004;64(24):8816–8820. doi: 10.1158/0008-5472.CAN-04-1923. [DOI] [PubMed] [Google Scholar]
  • 14.Keilhack H, David FS, McGregor M, Cantley LC, Neel BG. J Biol Chem. 2005;280(35):30984–30993. doi: 10.1074/jbc.M504699200. [DOI] [PubMed] [Google Scholar]
  • 15.Tartaglia M, Mehler EL, Goldberg R, Zampino G, Brunner HG, Kremer H, van der Burgt I, Crosby AH, Ion A, Jeffery S, Kalidas K, Patton MA, Kucherlapati RS, Gelb BD. Nat Genet. 2001;29(4):465–468. doi: 10.1038/ng772. [DOI] [PubMed] [Google Scholar]
  • 16.Tartaglia M, Niemeyer CM, Fragale A, Song X, Buechner J, Jung A, Hahlen K, Hasle H, Licht JD, Gelb BD. Nat Genet. 2003;34(2):148–150. doi: 10.1038/ng1156. [DOI] [PubMed] [Google Scholar]
  • 17.Chan RJ, Feng GS. Blood 2006 [Google Scholar]
  • 18.Lauchle JO, Braun BS, Loh ML, Shannon K. Pediatr Blood Cancer. 2006;46(5):579–585. doi: 10.1002/pbc.20644. [DOI] [PubMed] [Google Scholar]
  • 19.Mohi MG, Neel BG. Curr Opin Genet Dev. 2007;17:1–8. doi: 10.1016/j.gde.2006.12.011. [DOI] [PubMed] [Google Scholar]
  • 20.Emanuel PD, Shannon KM, Castleberry RP. Mol Med Today. 1996;2(11):468–475. doi: 10.1016/1357-4310(96)10044-7. [DOI] [PubMed] [Google Scholar]
  • 21.Arico M, Biondi A, Pui CH. Blood. 1997;90(2):479–488. [PubMed] [Google Scholar]
  • 22.Mohi MG, Williams IR, Dearolf CR, Chan G, Kutok JL, Cohen S, Morgan K, Boulton C, Shigematsu H, Keilhack H, Akashi K, Gilliland DG, Neel BG. Cancer Cell. 2005;7(2):179–191. doi: 10.1016/j.ccr.2005.01.010. [DOI] [PubMed] [Google Scholar]
  • 23.Schubbert S, Lieuw K, Rowe SL, Lee CM, Li X, Loh ML, Clapp DW, Shannon KM. Blood. 2005;106(1):311–317. doi: 10.1182/blood-2004-11-4207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chan RJ, Leedy MB, Munugalavadla V, Voorhorst CS, Li Y, Yu M, Kapur R. Blood. 2005;105(9):3737–3742. doi: 10.1182/blood-2004-10-4002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Loh ML, Vattikuti S, Schubbert S, Reynolds MG, Carlson E, Lieuw KH, Cheng JW, Lee CM, Stokoe D, Bonifas JM, Curtiss NP, Gotlib J, Meshinchi S, Le Beau MM, Emanuel PD, Shannon KM. Blood. 2004;103(6):2325–2331. doi: 10.1182/blood-2003-09-3287. [DOI] [PubMed] [Google Scholar]
  • 26.Yu WM, Daino H, Chen J, Bunting KD, Qu CK. J Biol Chem. 2006;281(9):5426–5434. doi: 10.1074/jbc.M507622200. [DOI] [PubMed] [Google Scholar]
  • 27.Yang L, Dan HC, Sun M, Liu Q, Sun XM, Feldman RI, Hamilton AD, Polokoff M, Nicosia SV, Herlyn M, Sebti SM, Cheng JQ. Cancer Res. 2004;64(13):4394–4399. doi: 10.1158/0008-5472.CAN-04-0343. [DOI] [PubMed] [Google Scholar]
  • 28.Pear WS, Miller JP, Xu L, Pui JC, Soffer B, Quackenbush RC, Pendergast AM, Bronson R, Aster JC, Scott ML, Baltimore D. Blood. 1998;92(10):3780–3792. [PubMed] [Google Scholar]
  • 29.Bai J, Sui J, Demirjian A, Vollmer CM, Jr, Marasco W, Callery MP. Cancer Res. 2005;65(6):2344–2352. doi: 10.1158/0008-5472.CAN-04-3502. [DOI] [PubMed] [Google Scholar]
  • 30.Chen S, Dai Y, Harada H, Dent P, Grant S. Cancer Res. 2007;67(2):782–791. doi: 10.1158/0008-5472.CAN-06-3964. [DOI] [PubMed] [Google Scholar]
  • 31.Catling AD, Schaeffer HJ, Reuter CW, Reddy GR, Weber MJ. Mol Cell Biol. 1995;15(10):5214–5225. doi: 10.1128/mcb.15.10.5214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ren Y, Meng S, Mei L, Zhao ZJ, Jove R, Wu J. J Biol Chem. 2004;279(9):8497–8505. doi: 10.1074/jbc.M312575200. [DOI] [PubMed] [Google Scholar]
  • 33.Cunnick JM, Meng S, Ren Y, Desponts C, Wang HG, Djeu JY, Wu J. J Biol Chem. 2002;277(11):9498–9504. doi: 10.1074/jbc.M110547200. [DOI] [PubMed] [Google Scholar]
  • 34.Xie H, Huang Z, Sadim MS, Sun Z. J Immunol. 2005;175(12):7981–7988. doi: 10.4049/jimmunol.175.12.7981. [DOI] [PubMed] [Google Scholar]
  • 35.Dorsey JF, Cunnick JM, Mane SM, Wu J. Blood. 2002;99(4):1388–1397. doi: 10.1182/blood.v99.4.1388. [DOI] [PubMed] [Google Scholar]
  • 36.Adams JM, Cory S. Oncogene. 2007;26(9):1324–1337. doi: 10.1038/sj.onc.1210220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hsu YT, Youle RJ. J Biol Chem. 1997;272(21):13829–13834. doi: 10.1074/jbc.272.21.13829. [DOI] [PubMed] [Google Scholar]
  • 38.Takahashi Y, Karbowski M, Yamaguchi H, Kazi A, Wu J, Sebti SM, Youle RJ, Wang HG. Mol Cell Biol. 2005;25(21):9369–9382. doi: 10.1128/MCB.25.21.9369-9382.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.MacCallum DE, Melville J, Frame S, Watt K, Anderson S, Gianella-Borradori A, Lane DP, Green SR. Cancer Res. 2005;65(12):5399–5407. doi: 10.1158/0008-5472.CAN-05-0233. [DOI] [PubMed] [Google Scholar]
  • 40.Wang JL, Liu D, Zhang ZJ, Shan S, Han X, Srinivasula SM, Croce CM, Alnemri ES, Huang Z. Proc Natl Acad Sci U S A. 2000;97(13):7124–7129. doi: 10.1073/pnas.97.13.7124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.An J, Chervin AS, Nie A, Ducoff HS, Huang Z. Oncogene. 2007;26(5):652–661. doi: 10.1038/sj.onc.1209830. [DOI] [PubMed] [Google Scholar]
  • 42.Pei XY, Dai Y, Grant S. Mol Cancer Ther. 2004;3(12):1513–1524. [PubMed] [Google Scholar]
  • 43.Manero F, Gautier F, Gallenne T, Cauquil N, Gree D, Cartron PF, Geneste O, Gree R, Vallette FM, Juin P. Cancer Res. 2006;66(5):2757–2764. doi: 10.1158/0008-5472.CAN-05-2097. [DOI] [PubMed] [Google Scholar]
  • 44.Doshi JM, Tian D, Xing C. J Med Chem. 2006;49(26):7731–7739. doi: 10.1021/jm060968r. [DOI] [PubMed] [Google Scholar]
  • 45.Kratz CP, Niemeyer CM, Castleberry RP, Cetin M, Bergstrasser E, Emanuel PD, Hasle H, Kardos G, Klein C, Kojima S, Stary J, Trebo M, Zecca M, Gelb BD, Tartaglia M, Loh ML. Blood. 2005;106(6):2183–2185. doi: 10.1182/blood-2005-02-0531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lu X, Levine R, Tong W, Wernig G, Pikman Y, Zarnegar S, Gilliland DG, Lodish H. Proc Natl Acad Sci U S A. 2005;102(52):18962–18967. doi: 10.1073/pnas.0509714102. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES