Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jan 5.
Published in final edited form as: J Immunol Methods. 2010 Sep 24;363(2):210–220. doi: 10.1016/j.jim.2010.09.022

A Flow Cytometry-Based Strategy to Identify and Express IgM from VH1-69+ Clonal Peripheral B Cells

Edgar D Charles 1, Michael I M Orloff 1, Lynn B Dustin 1
PMCID: PMC3003765  NIHMSID: NIHMS245873  PMID: 20875420

Abstract

Pathologic rheumatoid factor (RF) levels are hallmarks of several human diseases. Production of monoclonal RF in vitro is essential for studies of the antigenic specificities of RF, as well as for a dissection of the mechanisms of aberrant RF+ B cell activation. We have expanded upon previous methods to develop a flow cytometry-based method to efficiently clone monoclonal antibodies (mAbs) from humans with expansions of RF-like, immunoglobulin heavy chain variable region (IgVH) 1-69 gene segment-containing B cells. The cloned variable regions are expressed as IgM and produced during culture at concentrations between 5–20 μg/ml. Using this system, we show that clonal Igs from patients with HCV-related mixed cryoglobulinemia, when expressed as IgM, have RF activity. We anticipate that this system will be useful for the cloning and expression of mAbs partially encoded by VH1-69 and for determination of the reactivity patterns of polyspecific, low-affinity IgMs of human pathogenic importance.

Keywords: IgM, Rheumatoid factor, flow cytometry, cloning, expression, mixed cryoglobulinemia

1. Introduction

A high level of circulating IgM rheumatoid factor (RF) is a feature of several human autoimmune diseases, such as rheumatoid arthritis, Sjögren's syndrome, systemic sclerosis, and hepatitis C virus-associated mixed cryoglobulinemia (HCV MC). By definition, RF has reactivity towards IgG Fc; however, Fc specificities vary with disease process and RF mutational status (Bonagura et al., 1998). In vitro production of monoclonal RF has traditionally involved heterohybridomas (Brown et al., 1990) or EBV-transformed lymphocytes (Steinitz et al., 1980); however, both of these are highly selective, low-efficiency processes (Laffly and Sodoyer, 2005). A protocol for the efficient transformation of human memory B cells has more recently been described (Traggiai et al., 2004), but this procedure is limited to memory B cells that can be activated by CpG and transformed by EBV. In HCV MC, however, the clonal B cells are often CD21low/− (Charles et al., 2008), and are resistant to EBV infection in vitro. A relatively nonbiased system for cloning of IgVH from singly-sorted B cells and expression as human IgG1 has been well-described (Wardemann et al., 2003; Tiller et al., 2008). This system is not restricted to particular B cell populations and does not require prior B cell stimulation. However, expression of IgM RF as an IgG1 poses several difficulties for downstream specificity analyses. First, avidity may be lost upon conversion from a decavalent IgM to a bivalent IgG. Second, the expressed IgG1 RF could form immune complexes due to the presence of the antigen-binding domain and its target antigen in the same molecule. Third, heavy chain constant region domain swapping may affect affinity, specificity and V-region structure (reviewed in (Torres and Casadevall, 2008)). Motivated by these considerations, we have built upon this previous system to develop a flow cytometry-based method to clone RF-like Ig from humans with expansions of VH1-69+ B cells and express it as IgM in high yield, in order to more accurately assess the reactivities of the RF-like IgM towards putative antigens.

In HCV MC, pathologic RF is typically monoclonal IgMκ of the cross-reactive WA idiotype, which is frequently encoded by VH1-69 and Vκ3-20 gene segments (Silverman et al., 1988; Gorevic and Frangione, 1991; Knight et al., 1993). We have previously reported that HCV MC is associated with a clonal expansion of modestly hypermutated IgM+κ+ memory B cells that express Ig encoded by VH1-69 and Vκ3-20 gene segments. The G6 mAb, which recognizes the VH1-69 gene product (Potter et al., 1999), has previously been used to identify these clonally-expanded B cells in HCV MC patients (Carbonari et al., 2005). We have singly-sorted G6+ B cells by FACS and performed nonbiased IgVH and IgVκ RT-PCR as previously described (Wardemann et al., 2003); sequencing confirmed the overwhelming majority of these cells to be VH1-69+/JH4+/Vκ3-20+. We next performed a third round of VH1-69/JH4-specific and Vκ3-20-specific PCR to correct for 5' IgV mutations introduced by the unbiased first and second stage PCR primers. IgVH and IgVκ were then ligated into Igμ and Igκ expression vectors. We then co-transfected these constructs into 293T cells expressing human J chain. After 6 days of culture, supernatants typically contained 5–20 μg/ml IgM, which was demonstrated to have RF activity by ELISA.

2. Materials and Methods

2.1 Patients

The studies were approved by the Institutional Review Boards at The Rockefeller University Hospital (RUH) and New York Presbyterian Hospital (NYPH). Volunteers were recruited through the RUH outpatient clinic and the hepatology clinic at NYPH. All donors gave written informed consent according to the principles of Helsinki before enrollment. We enrolled HCV donors and HCV RNA+ subjects with symptoms of MC.

2.2 Blood collection and processing

Blood was collected into ACD tubes before processing. PBMCs were purified by centrifugation (800 × g) over lymphocyte separation medium (ICN). The mononuclear cell layer was washed three times in RPMI supplemented with 1% HEPES and 2% FBS. Cells were resuspended at a final concentration of 107/ml in RPMI 1640 supplemented with 0.5% HEPES, 20% FBS and 7.5% DMSO for cryopreservation. Cells were slowly frozen to −80° C and maintained at −150° C. Viable cell recovery was typically >90% as judged by incorporation of an amine-reactive violet dye (LIVE/DEAD Fixable Dead Cell Stain, Invitrogen). Tissue culture reagents were purchased from Life Technologies (Invitrogen).

2.3 Flow cytometry

For immunophenotypic analysis, cells were stained with Live/Dead Aqua (Invitrogen) and the indicated Abs at room temperature in PBS supplemented with 2% (w/v) BSA (Fraction V; Fisher Biotech, Fair Lawn, NJ) and 0.02% NaN3. All antibodies and reagents were obtained from BD Biosciences, except for G6 (provided by R. Jefferis) and biotinylated anti-Fc receptor-like 4 (FCRL4) F(ab')2 (provided by Götz Ehrhardt). Anti-CD20-PerCp/Cy5.5 (clone L27), IgM-FITC (clone G20-127), kappa-PE (clone G20-193), CD27-Alexa 700 (clone M-T271), and CD21-APC (clone B-ly4) were used. G6 was conjugated to biotin using EZ-Link Micro Sulfo-NHSBiotinylation Kit (Pierce), and to Alexa Fluor 594 using Invitrogen's Alexa Fluor® 594 Antibody Labeling Kit. Cells were incubated with primary and secondary (anti-FITC Alexa 488, streptavidin-APC/Cy7) reagents for 30 min each, and were washed 3 times with incubation buffer. Stained cells were fixed in PBS/2% paraformaldehyde and analysis was performed within one hour on an LSRII flow cytometer equipped with 405, 488, 561, and 640 nm lasers (BD Immunocytometry Systems). Lymphocytes were identified by forward and side-angle light scatter characteristics.

2.4 Single-cell sorting and RT-PCR

PBMCs were stained as above, except staining was performed in the absence of NaN3, and cells were not fixed in paraformaldehyde. G6+ CD20+ B cells were singly-sorted either on a MoFlow (DAKO Cytomation) or FACSAria II (BD) cell sorter equipped with 355, 405, 488, 561, and 640 nm lasers. Single cell unbiased Ig RT-PCR using IgVH and IgVL family-specific primers was performed by a previously-described technique (Wardemann et al., 2003; Tiller et al., 2008) using random hexamer priming, Superscript III reverse transcriptase (Invitrogen), Pfu DNA polymerase (Invitrogen), and modified IgH 3' antisense primers containing an XhoI site (Table 1). As negative controls for RF assays, IgVH and IgVL were also amplified from CBH5 hybridoma cDNA (provided by S. Foung) or mGO IgG1 expression vectors (provided by M. Nussenzweig) and cloned as below. After incubation with Taq polymerase at 72° C for 10 min, products were TA cloned into pCR2.1-TOPO (Invitrogen) and were sent for sequencing. Ig variable region analysis was performed using Joinsolver (Souto-Carneiro et al., 2004). For VH1-69+/Vκ3-20+ clones, an additional round of PCR (94° C 30 sec, 55° C 30 sec., 68° C 1 min, 35 cycles) was then performed using VH1-69- and Vκ3-20-specific primers, in order to correct 5' mutations introduced by primers during the previous two PCR rounds. We sequenced the resulting products, and verified that nucleotides 1–18 and 1–33 corresponded to germline VH1-69 and Vκ3-20 sequences, respectively, and that no mutations beyond the 5' VH1-69 and Vκ3-20 primers had been introduced during this third round of PCR.

Table 1.

Primers used for single cell PCR. Restriction sites are shown in bold.

IgH Sense Antisense
First PCR 5′ L-VH1* ACAGGTGCCCACTCCCAGGTGCAG 3′ Cμ CH1* GGGAATTCTCAGAGGAGACGA
5′ L-VH3* AAGGTGTCCAGTGTGARGTGCAG
5′ L-VH4/6* CCCAGATGGGTCCTGTCCCAGGTGCAG
5′ L-VH5* CAAGGAGTCTGTTCCGAGGTGCA
Second PCR 5′ Agel VH1/5* CTGCAACCGGTGTACATTCCGAGGTGCAGCTGGTGCAG 3′ Xhol JH1/2 TGCGAAGCTCGAGMACAGTGACCAG
5′ Agel VH3* CTGCAACCGGTGTACATTCTGAGGTGCAGCTGGTGGAG 3′ Xhol JH3 TGCGAAGCTCGAGMACGGTGACCAT
5′ Agel VH4* CTGCAACCGGTGTACATTCCCAGGTGCAGCTGCAGGAG 3′ Xhol JH4/5 TGCGAAGCTCGAGACGGTGACCAG
5′ Agel VH3–23* CTGCAACCGGTGTACATTCTGAGGTGCAGCTGTTGGAG 3′ Xhol JH6 TGCGAAGCTCGAGACGGTGACCGT
5′ Agel VH4–34* CTGCAACCGGTGTACATTCCCAGGTGCAGCTACAGCAGTG
Third PCR 5′ Agel VH1–69 CTGCAACCGGTGTACATTCCCAGGTGCAGCTGGTGCAG 3′ Xhol JH4/5 TGCGAAGCTCGAGACGGTGACCAG
Igκ Sense Antisense
First PCR 5′ L Vκ1/2* ATGAGGSTCCCYGCTCAGCTGCTGG 5′ Cκ543* GTTTCTCGTAGTCTGCTTTGCTCA
5′ L Vκ3* CTCTTCCTCCTGCTACTCTGGCTCCCAG
5′ L Vκ4* ATTTCTCTGTTGCTCTGGATCTCTG
Second PCR 5′ Pan Vκ* ATGACCCAGWCTCCABYCWCCCTG 3′ Cκ 494* GTGCTGTCCTTGCTGTCCTGCTC
Third PCR 5′ Agel Vκ3–20 TTGTGCTGCAACCGGTGTACATTCAGAAATTGTGTTGACGCAGTCTCCAGGCACCCTG 3′ BsiWl Jκ1/4* GCCACCGTACGTTTGATYTCCACCTTGGTC
3′ BsiWl Jκ2* GCCACCGTACGTTTGATCTCCAGCTTGGTC
*

primers previously reported (Tiller et al., 2008)

2.5 IgM cloning

Human B cell RNA was reverse-transcribed using random hexamers and the Superscript III First-Strand Synthesis System (Invitrogen). IgCμ1-4 was amplified by nested PCR (94° C 30 sec, 57° C 30 sec., 68° C 90 sec, 35 cycles each round) using XhoI-containing sense and EagI-containing antisense primers (Table 2) for the second round. An internal IgCμ4 AgeI site was subsequently abolished with overlapping PCR using primers containing a silent mutation at T111. For IgM expression vector construction, XhoI/EagI-digested product was ligated into an IgG1 expression vector (Tiller et al., 2008) from which Cγ was removed by XhoI/EagI digestion. For subsequent IgM cloning, AgeI/XhoI-digested IgVH products were ligated into the similarly-digested IgM expression vector. Igκ vector construction was carried out as previously described (Tiller et al., 2008).

Table 2.

Primers used for human IgμC and J chain PCR. Restriction sites are shown in bold.

lgμC Sense Antisense
First PCR 5′ Cμ CH1–4 GAGTGCATCCGCCCCAACCCTT 3′ Cμ CH1–4 GTAGCAGGTGCCAGCTGTGTCGGA
Second PCR 5′ Xhol Cμ CH1-4 TGCGAACTCGAGCGGGAGTGCATCC 3′ Eagl Cμ CH1-4 CGGCCGCTAGTAGCAGGTGCCAGC
J Chain
lgJ 10565 CAAGAAGATGAAAGGATT 10566 TTAGTCAGGATAGCAGGC
Signal peptide 10736 AAGCTTATGGGATGGTCATGTATC 10860 CCTTTCATCTTCTTGGGAATGTACACCGGTTGC
Overlap PCR 11094 AAGCTTACCATGGGATGGTCATGTATCATC 10738 CTCGAGTTAGTCAGGATAGCA

For production of human J chain-secreting 293T cells, J chain was first amplified from human B cell cDNA using sense (10565) and antisense (10566) primers (Table 3) in one round of PCR (94° C 30 sec, 57° C 30 sec., 68° C 45 sec, 35 cycles). After PCR of Kozak and signal sequences from the IgM expression vector (primers 10736 and 10860), Kozak/signal sequence and J chain product was generated using overlapping PCR with 5' HindIII sense (11094) and 3' XhoI antisense (10738) primers (94° C 30 sec, 57° C 30 sec., 68° C 45 sec, 35 cycles). After digestion with HindIII/XhoI, the product was ligated into pcDNA3.1 Zeo (+) (Invitrogen). Plasmid was transfected into 293T cells using Lipofectamine 2000 (Invitrogen). Individual cells were plated by limiting dilution in 96-well dishes, and following Zeocin selection, were expanded into 12-well dishes. Supernatants from each well were screened for IgJ production by ELISA. Cells with the highest level of IgJ secretion were subsequently used for IgM expression.

Table 3.

Analysis Heavy and Light Chain Variable Regions Isolated from Singly-Sorted G6+ Peripheral B Cells from an HCV+MC+ Patient

Clone VH mutations aa Δ VH DH JH Heavy Chain CDR3 Sequence VK mutations aa Δ VK JK Light Chain CDR3 Sequence
A4 1 (0.35%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 12 (4.65%) 8 3–20*01 1*01 CQQYASSRTFGQG
A6 4 (1.57%) 2 1–69*01 3–22*01 4*02 CARGPDTSGFYYYFYWGQG 6 (2.33%) 5 3–20*01 2*01 CQQYGSSPYTFGQG
A7 2 (0.69%) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 3 (1.16%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
B1 2 (0.69%) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 3 (1.16%) 3 3–20*01 2*01 CQQYGSSPYTFGQG
B4 2 (0.69%) 1 1–69*01 3–22*01 4*02 CARGDYYDSSGYYHDAFDIWGQG 3 (1.16%) 3 3–20*01 2*01 CQQYGSSPYTFGQG
B6 1 (0.39) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.87%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
B11 2 (0.69%) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 1 (0.44%) 1 3–20*01 2*01 CQQYGSSPYTFGQG
C1 1 (0.35%) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.87%) 1 3–20*01 2*01 CQQYGSSPYTFGQG
D4 2 (0.69%) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.87%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
D6 1 (0.35%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 1 (0.44%) 1 3–20*01 2*01 CQQYGSSPYTFGQG
D12 15 (5.21%) 10 1–69*01 3–22*01 4*02 CAREFNYDSSGYYYFYWGQG 2 (0.87%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
E3 4 (1.39%) 3 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.78%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
E5 2 (0.69%) 1 1–69*01 3–22*01 4*02 CARGPESSGYYYFYWGQG 2 (0.78%) 1 3–20*01 2*01 CQQYGSSPYTFGQG
F6 1 (0.35%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 5 (1.94%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
F10 1 (0.35%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.78%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
G4 4 (1.39%) 3 1–69*01 6–13*01 4*02 CAREGIAAAVNPFDYWGQG 2 (0.78%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
G7 1 (0.35%) 1 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.87%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
H5 0 (0.00%) 0 1–69*01 3–22*01 4*02 CARGPETSGYYYFYWGQG 2 (0.78%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
H9 1 (0.35%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 1 (0.44%) 1 3–20*01 2*01 CQQYGSSPYTFGQG
H10 2 (0.69%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 2 (0.87%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
NA6 1 (0.03%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 4 (1.64%) 2 3–20*01 2*01 CQQYGSSPYTFGQG
NB2 19 (6.60%) 11 1–69*01 1–01*01 4*02 CAREFNFDTTGYYFLYWGQG 13 (4.87%) 8 3–20*01 1*01 CQQYASSRTFGQG
NB5 13 (4.51%) 10 3–48*01 3–22*01 4*02 CARDLRYYYDRSGPLPPSDYWGQG 3 (1.45%) 2 3–15*01 2*01 CQQYDNWPPYTFGQG
NB10 11 (3.82%) 5 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 7 (3.08%) 6 3–20*01 2*01 CQQYGSSPYTFGQG
NC9 2 (0.69%) 1 3–07*01ns1 3–22*01 3*02 CARGDYYDSSGYYHDAFDIWGQG 4 (1.64%) 3 1–8*01 1*01 CQQYYTYPRTFGQG
NC11 1 (0.35%) 0 1–69*01 3–22*01 4*02 CARGPDSSGYYYFYWGQG 1 (0.44%) 1 3–20*01 2*01 CQQYGSSPYTFGQG
ND2 16 (6.13%) 10 3–72*01 3–09*01 4*02 CARADILTGYSDYWGQG 3 (1.45%) 2 1–16*01 ns1 5*01 CQQYYTYPITFGQG
ND9 7 (2.43%) 3 1–69*01 3–22*01 4*02 CARGPDSSAYYYFYWGQG 7 (3.08%) 3 3–20*01 2*01 CQQYGSSPYTFGQG
ND11 17 (6.61%) 11 3–11*01 6–19*01 3*01 CARGADYSSGWTEVAFDLWGQG 1 (0.44%) 1 4–01*01 4*01 CHQYYRTPLTFGQG
NE3 6 (3.98%) 3 3–07*01ns1 3–22*01 3*02 CARGHYYDSGGYYHDAFDSWGQ 12 (5.29%) 2 1–8*01 1*01 CQQYYTYPRTFGQG
NE7 11 (3.82%) 5 1–69*01 5–05*01 4*02 CVREGFPDTAMVNPFDYWGQG 2 (0.87%) 0 3–11*01 1*01 CQQRSNWPRTFGQG
NH5 2 (0.69%) 1 3–07*01ns1 3–22*01 3*02 CARGDYYDSSGYYHDAFDIWGQG 13 (5.33%) 7 1–8*01 1*01 CQQYYTYPRTFGQG

Clones A4-H10 and NA6-NH5 were isolated from G6+ FCRL4+ and G6+ FCRL4 B cells, respectively, sorted from subject LDU 125.

VH= Ig heavy chain variable region; aa Δ= amino acid changes in IgVH; DH= Ig heavy chain diversity region; JH= Ig heavy chain joining region; CDR3= complementarity determining region 3; Vκ= Ig κ variable region; aa Δ= amino acid changes in IgVκ; Jκ= Ig κ joining region.

2.6 IgM expression

293T cells were grown in 150 mm plates (Falcon, Becton Dickinson) in Dulbecco's modified eagle medium (DMEM) supplemented with ultralow IgG fetal calf serum (Invitrogen) and 1 mM sodium pyruvate (Invitrogen). Transient transfections were performed on exponentially growing 293T cells at 80% confluency. For each plate, equal amounts (12.5 μg) of IgVHμ and IgVκ vector DNA were added to 1.5 ml 150 mM NaCl, to which 200 μl branched polyethylenimine (Sigma) was added. After incubation at RT × 10 min., the DNA/polyethylenimine mixture was added to cells that had been washed twice with DMEM, and the cells and DNA mixture were incubated at RT × 1 h. with 25 ml DMEM supplemented with 1 mM sodium pyruvate and 1% Nutridoma-SP (Roche). Supernatants were harvested on days 2, 4, and 6; fresh media was added to the cells on days 2 and 4. 150 ml total supernatant (representing two 150 mm plates/Ig) was concentrated with Amicon Ultra-15 centrifugal filter units with a 100 kDa molecular weight cutoff (Millipore). After the total volume was reduced to 2 ml, five washes with 12 ml PBS were performed (volume was reduced by centrifugation to 2 ml each time) and 0.05% sodium azide added to a total volume of 2 ml.

2.7 Human IgM ELISA

Nunc MaxiSorp plates were coated overnight at 4° C with capture goat polyclonal anti-human Igμ antibody (Bethyl Labs). After blocking with 1% BSA for 2 h at RT, antibody dilutions were added for 1 h at RT. Bound IgM was detected by addition of HRP-conjugated goat anti-human Igμ and, after stopping the reaction with 1 N HCl, A450 was measured with a FLUOstar Omega microplate reader (BMG Laboratories). Human myeloma IgM (Jackson ImmunoResearch) was used to generate a standard curve.

2.8 Gel Filtration

500 μg of sample was equilibrated in 20 mM sodium phosphate buffer, pH 7.0 and applied to a HiPrep 16/60 Sephacryl S-300 HR column using an AKTA Explorer chromatography system (GE Healthcare Life Sciences). Two column volumes of buffer were run through the column at 0.25 ml/min, A280 nm was measured in the eluate, and 3 ml fractions were collected. Data were analyzed using Unicorn software (GE Healthcare Life Sciences).

2.9 SDS-PAGE and western blotting

For molecular weight estimation of intact IgM, samples were separated on tandem NativePage Novex 3–12% Bis-Tris polyacrylamide gels (Invitrogen) at 150 V for 2 h under non-reducing conditions as previously described (Vorauer-Uhl et al., 2010). The protein marker contained bovine IgM pentamers with a molecular weight of 1048 kDa and hexamers with a molecular weight of 1236 kDa. LDS sample buffer containing Li-dodecylsulfate (NuPAGE LDS 4× sample buffer, pH 8.5, Invitrogen) was used for IgM-SDS-PAGE. Either 7.5 μl of transfected cell culture supernatant or gel filtration eluate, or 100 ng of concentrated IgM mAb were loaded per lane. For controls, IgMλ purified from a human with multiple myeloma (Jackson ImmunoResearch) was loaded at 1 μg/lane. One gel was stained for total protein using Sypro Ruby, and the other was analyzed for IgM content using western blotting.

In order to detect J chain, samples were run under reducing conditions on Novex 4–20% Bis-Tris polyacrylamide gels (Invitrogen) using a Benchmark protein ladder (Invitrogen). Samples were loaded as above, except 100 ng of human IgM was loaded.

2.10 Sypro Ruby Staining

Gels were fixed with 50% methanol and 7% acetic acid twice for 30 min. and then stained with 80 ml Sypro Ruby (Invitrogen) overnight. They were then washed for 30 min. with 10% methanol and 7% acetic acid, and rinsed with water for 10 min. Gels were imaged with a Typhoon 9400 variable mode imager (GE Healthcare Life Sciences) using an excitation laser of 457 nm and an emission filter of 610 nm with a band pass of 30 nm. Photomultiplier tube voltage and pixel size were set on 600 V and 200 μm, respectively.

2.11 Western Blot Analysis

Gels were electroblotted onto a nitrocellulose membrane (GE Life Sciences) for 1.5 h at 300 mA. Blots were blocked overnight with 5% dry milk in PBS/0.05% Tween. For detection of IgM, peroxidase-coupled anti-human Igμ, diluted 1:5000 (Bethyl) was then applied for 1 h. For detection of J chain, 1 μg/ml anti-human J chain (clone Mc 19-9, US Biological) was applied for 1 h, after which the blot was washed and incubated with HRP-conjugated rabbit anti-mouse IgG (1:5000, Pierce) for 1 h. Blots were then washed three times with PBS/0.05% Tween for 20 minutes, developed with ECL Super Signal West Pico (Pierce), and exposed to autoradiograph film (Kodak) for 5–30 sec (for IgM detection) or 1 h (for J chain detection).

2.12 RF assay

For determination of reactivities towards IgG isotypes, 96-well Nunc MaxiSorp plates were coated with 1 μg/well human myeloma IgG1λ, IgG2λ, IgG3λ, or IgG4λ (Sigma), and incubated at RT for 1 h. After washing three times, plates were incubated with 1% BSA/PBS for 1 h at RT. Serial dilutions of IgM mAbs cloned from HCV+MC+ subject LDU 125 or sera isolated from the same patient were then added for 1 h at RT. After washing, HRP-labeled goat anti-human Igμ (Bethyl) was added for 1 h.

To determine if mAb G6 recognized the cloned IgM, microwells were coated with anti-human IgM and, after blocking, 0.5–10 μg/ml LDU 125 A4 IgM (partially encoded by VH1-69) or mGO (partially encoded by VH4-39) were added, followed by detection with G6 mAb (1:5000), and after washing, HRP-conjugated rabbit anti-mouse IgG1 (1:5000, Pierce).

All assays were developed with TMB (BioFX Laboratories). After stopping reactions with 1 N HCl, A450 was measured.

2.13 Data Analysis and Statistics

Data were analyzed using Prism (GraphPad Software). Results are presented as means +/− standard deviation. GenBank accession numbers for the cloned Ig sequences are GQ903484–GQ903547.

3. Results

3.1 The G6 mAb can be used to identify an expanded IgM+κ+ B cell population

We immunophenotyped PBMCs from HCV donors and HCV+MC+ subjects, using G6 to detect B cells expressing the VH1-69 gene product. Results for representative HCV (LDU 148) and HCV+MC+ (ECH 559) subjects are shown in Figure 1. Lymphocytes were identified by forward (FSC) and side light scatter (SSC) characteristics, and dead cells were excluded with a membrane-impermeant fluorescent dye. In contrast to the HCV individual, in whom <3% of B cells were G6+, 41% of CD20+ B cells in the HCV+MC+ patient stained with G6. Further analysis revealed that the G6+ cells in the HCV+MC+ subject were predominantly IgM+ and Igk+ (Fig. 1A). When we examined total B cells and the G6+ and G6 B cell subsets from this patient, we found that IgM+CD27+ memory B cells were overrepresented in the G6+ fraction. Moreover, consistent with our earlier observations (Charles and Dustin, 2009), (Charles et. al., submitted), a preponderance of the G6+ B cells from this HCV+MC+ patient were IgM+κ+ and CD21low, and the majority of the CD21low B cells were CD27+ (Fig. 1B).

Figure 1. The G6 mAb identifies an expanded clonal B cell population.

Figure 1

Flow cytometric analyses of a representative HCVMC (LDU 148) patient and a symptomatic HCV+MC+ patient with elevated serum rheumatoid factor (702 IU/ml) (ECH 559) are shown. Lymphocytes were identified by forward and side light scatter characteristics. After exclusion of dead cells, 2.8% and 41% of CD20+ B cells from LDU 148 and ECH 559, respectively, were G6+. The G6+ B cells from ECH 559 are predominantly IgM+ and Igκ+ (A). Depiction of total B cells and G6+ and G6 B cell subsets from subject ECH 559 (B). Compared to total B and G6 B cells, the G6+ B cell subset is enriched for IgM+CD27+ and IgM+κ+ B cells. The G6+ B cell subset is enriched for CD21low B cells, the majority of which are CD27+.

3.2 Cloning and expression of RF-like IgM

In order to clone RF-like Ig from HCV MC patients, we used FACS to isolate B cells expressing the VH1-69 gene product. The sorting strategy for a representative HCV+MC+ patient (LDU 125) is shown in Figure 2. After gating on live lymphocytes as described above, FSC and SSC doublets were excluded, and G6+ CD20+ B cell subsets were identified (Fig. 2A). G6+ and G6 B cell subsets may be subsequently sorted on the basis of CD27 and CD21 staining (Fig. 2B) or FCRL4 staining (not shown) for either Ig RT-PCR or cell function analysis. For Ig cloning, cells were singly-sorted into individual wells of a 96-well microplate containing lysis buffer and RNase inhibitors (Wardemann et al., 2003). Unbiased IgV RT-PCR was then performed as described in the Materials and Methods. Since clinical tests had revealed subject LDU 125 to have elevated serum RF, a serum monoclonal IgMκ gammopathy, and an expansion of IgM+κ+ peripheral B cells, we performed IgM- and Igκ-specific PCR (primers listed in Table 1). After the first and second rounds of PCR, 58% and 52% of the wells had size-appropriate products for IgVμ and IgVκ, respectively. Paired IgH and IgL products from the same individual cells were TA-cloned and sent for sequencing (Table 3). A majority of clones A4-H10 had very similar IgVH and IgVL, with the same complementarity determining region 3 (CDR3) sequences, whereas there was considerably more variability among clones NA6-NH5. Note that G6+ cells were sorted into one plate (wells A1-H12) based upon expression of FCRL4, and were sorted into another plate (wells NA1-NH12) based upon absence of FCRL4 expression. Overall, 26/32 clones were VH1-69; 24 of these were also DH3-22/JH4+, and 25/26 were Vκ3-20+. Three clones were VH3-07+, and one clone each was VH3-11+, VH3-48+, or VH3-72+. Consistent with our earlier report (Charles et al., 2008), the majority (25/26) of the VH1-69+ clones had IgVH mutations; with four exceptions, all clones had 3 or fewer non-synonymous mutations. All of the 25 Vκ3-20 clones were mutated, with 21 of these having 3 or fewer non-synonymous mutations.

Figure 2. Sorting strategy for single-cell Ig RT-PCR.

Figure 2

PBMCs from an HCV+MC+ patient with a monoclonal IgMκ+ B cell expansion (LDU 125) are shown. Lymphocytes were identified by forward and side light scatter characteristics. After exclusion of dead cells and doublets, G6+ CD20+ B cells were identified (A) and singly-sorted into individual wells of a 96-well microplate. CD27+/−/CD21high/low G6+ and G6 B cell subsets (B) could additionally be bulk-sorted for downstream functional analyses.

We performed a third round of VH1-69- and Vk3-20- specific PCR on selected cloned individual cells in order to correct for non-germline mutations introduced by first and second round 5' primers. We cloned the resultant IgVH and IgVκ into Igμ and Igκ expression vectors. We sequenced these products to verify that nucleotides 1–18 and 1–33 were germline VH1-69 and Vκ3-20 sequences, respectively, and that no mutations beyond the 5' VH1-69 and Vκ3-20 primers had been introduced during this third round of PCR. We then transiently transfected paired IgH and IgL into J chain-secreting 293T cells, as described in Materials and Methods.

IgM yields after 6 days of culture typically ranged from 5–20 μg/ml of supernatant. Before and after concentration via centrifugal filtration through 100 kDa molecular weight cutoff membranes, we calculated IgM concentration by ELISA. We then used gel filtration chromatography to verify that the size of the cloned, concentrated IgM approximated that of IgM isolated from human serum. Figure 3A shows that the elution peaks of human IgM, human IgG, and bovine serum albumin corresponded to 37–42 ml, 57–67 ml, and 67–75. respectively. The elution profile of cloned CBH5 IgM revealed major peaks at 32–37 ml and 37–42 ml, as well as smaller peaks at 62–72 ml and 78–82 ml. We concluded that the 37–42 ml peak correlated with the expected size of human pentameric IgM, and that the 32–37 ml peak represented a higher-order IgM aggregate.

Figure 3. Gel filtration chromatography of expressed IgM.

Figure 3

As sizing standards, 500 μg each of human IgMλ from a patient with multiple myeloma, human IgG1, or bovine serum albumin were separated on a HiPrep 16/60 Sephacryl S-300 HR chromatography column. A280 nm of the eluate is depicted as a function of eluate volume. The horizontal lines represent conductivity and pH (A). CBH5 IgM (500 μg) was similarly applied to the column, and 3 ml elution fractions were collected (B).

We further confirmed the size of the cloned IgM using non-reducing SDS-PAGE (Figure 4 A, B). IgM corresponding to the 1048 kDa bovine pentamer molecular weight marker was detected in the cell culture supernatants (lanes 2–3), and this IgM could be concentrated via centrifugal filtration with 100 kDa cutoff membranes (lanes 4–6). Interestingly, size exclusion fractions 12 and 13 did not show an apparent size difference (lanes 8–9), suggesting that higher-order IgM structures are reversibly concentration- and solvent-dependent. Surprisingly, we did not detect size differences in IgM produced from 293T cells with and without human J chain. However, there were minor clone-dependent migration pattern differences irrespective of the transfected cell line, and the human IgMλ obtained from a commercial source ran at an appreciably lower level between 720–1048 kDa. We did not detect monomeric IgM in cell culture supernatants or concentrated IgM.

Figure 4. SDS-PAGE Analysis of expressed IgM.

Figure 4

Samples run on Native PAGE 3–12% Bis-Tris gels and either stained with Sypro Ruby (A) or electroblotted to nitrocellulose and probed with HRP-conjugated anti-human IgM (B). Lane 1: NativeMark molecular weight marker; lane 2: mGO IgM transfectant supernatant (7.5 μl); lane 3: 1403 IgM transfectant (293T cells without J chain) supernatant (7.5 μl); lane 4: mGO IgM concentrated with a 100 kDa spin filter (100 ng); lane 5: 1403 IgM (produced in 293T cells without J chain) concentrated with a 100 kDa spin filter (100 ng); lane 6: 1403 IgM concentrated with a 100 kDa spin filter (100 ng); lanes 7–9: fractions 11, 12 and 13, respectively, of gel-filtered 1403 IgM concentrated with a 100 kDa spin filter (7.5 μl each); lane 10: IgM from a patient with multiple myeloma (1 μg).

Reduced samples run on 4–20% Bis-Tris gels and stained with either Sypro Ruby (C) or electroblotted to nitrocellulose and probed with mouse anti-human IgJ and HRP-conjugated rabbit anti-mouse IgG (D). Lane 1: Benchmark molecular weight marker; lane 2: 773 IgM transfectant supernatant (7.5 ul); lane 3: 1403 IgM transfectant (293T cells without J chain) supernatant (7.5 ul); lane 4: mGO IgM concentrated with a 100 kDa spin column (100 ng); lane 5: 1403 IgM (produced in 293T cells without J chain) concentrated with a 100 kDa spin filter (100 ng); lane 6: 1403 IgM concentrated with a 100 kDa spin filter (100 ng); lanes 7–8: fractions 12 and 13, respectively, of gel-filtered 1403 IgM concentrated with a 100 kDa spin filter (7.5 μl each); lane 10: IgM from a patient with multiple myeloma (100 ng).

Samples were then subjected to reducing SDS-PAGE, followed by either staining with Sypro Ruby or electroblotting and probing with anti-human J chain. In one sample, we detected a band between 25–30 kDa, which is consistent with the previously-demonstrated retarded migration pattern for human J chain (Symersky et al., 2000; Schrohenloher et al., 1973). This band was discernable in a concentrated IgM that had been produced in 293T cells transfected with J chain, but not in the other samples (Figure 4 C, D).

3.3 IgM expressed from G6+ B cells has RF activity

We assessed whether mAbs cloned and expressed from G6+ B cells possessed RF activity, as measured by their abilities to bind human IgG1, IgG2, IgG3, or IgG4. Data for three clones from patient LDU 125 and the RF negative, VH1-69-encoded control (CBH5) are shown in Figure 5A–D. Clones E3, E5, and H5 demonstrated substantial binding to IgG1, with decreased avidities for IgG2 and IgG4, and markedly decreased avidities for IgG3, consistent with earlier reports regarding isotype specificities of certain RF subclasses (Normansell, 1975; Bonagura et al., 1998). The IgG isotype specificity pattern of these mAbs mirrored that seen in the serum of subject LDU 125 (Fig. 5E), suggesting that the cloned mAbs are a physiological reflection of circulating RF found in this patient in vivo. Finally, we used ELISA to confirm that the cloned IgM could be recognized by the G6 mAb (Fig. 5F). G6 bound to the VH1-69-encoded LDU 125 A4 clone, but not to the VH4-39-encoded mGO clone.

Figure 5. RF ELISA of mAbs.

Figure 5

Assessment of activities of cloned IgM towards IgG isotypes. Microwells were coated with 1 μg/well monoclonal human IgG1λ, IgG2λ, IgG3λ, or IgG4λ. After blocking, serial dilutions of IgM mAbs were added. HRP-labeled goat anti-human Igμ was used as the detection Ab. E3, E5, and H5: IgM mAbs from HCV+MC+ subject LDU 125; CBH5: RF negative control, VH1-69-encoded IgM mAb (A–D). Comparison of reactivities of LDU 125 serum towards IgG isotypes (E). Recognition of cloned IgM by G6 mAb. Microwells were coated with anti-human IgM and after blocking, 0.5–10 μg/ml LDU 125 A4 IgM or mGO were added, followed by detection with G6 mAb (1:5000) and rabbit anti-mouse IgG1 (1:5000) (F).

4. Discussion

We have developed a system to preferentially clone VH1-69-encoded mAbs as IgM from singly-sorted B cells. In particular, the expression of IgM RF+ B cells' mAb as IgM, instead of IgG1, offers the potential advantage of an improved physiologic assessment of these mAbs' reactivities. Modestly hypermutated RF typically has low to moderate affinity for its target antigen, IgG Fc, and the decavalent stoichometry of pentameric IgM confers a substantial increase in avidity. Supporting this, it has been shown that the binding of a low-affinity mouse IgG2a anti-RBC autoantibody is enhanced > 1000 fold when expressed as an IgM, compared to IgG2a, isotype (Fossati-Jimack et al., 1999). Thus, our method may prove to be most beneficial in the determination of the reactivity patterns of polyspecific, low-affinity IgMs. Our procedure can easily be adapted for the analysis of RF expressing non-G6 cross-reactive epitopes, synthesis of germline IgVH and IgVL mAbs (described in (Tiller et al., 2008)), cloning of mAbs from class-switched B cells, or expression of VH1-69-encoded mAbs as IgG1.

One area where this technique may be most immediately useful is in the accurate definition of the IgM RF that is observed in HCV+MC+ patients. We have previously observed that these patients have clonal expansions of memory B cells expressing modestly somatically hypermutated IgM (Charles et al., 2008) and that some of these clones have CDR3 sequences identical to RF IgMs isolated from patients with mucosa-associated lymphoid tissue neoplasms (Bende et al., 2005). We are currently utilizing our expression system to examine the binding of IgM RF to IgG1 and non-IgG1 antigens, and to determine whether somatic hypermutation modulates these interactions. Knowledge gained from such experiments could possibly be applied to therapeutics capable of blocking antigen-RF complexes.

The selective cloning of VH1-69-encoded mAbs may be particularly useful in the identification of effective anti-viral humoral responses. VH1-69-encoded Abs are enriched in anti-influenza (Corti et al.; Sui et al., 2009) and anti-HIV (Huang et al., 2004) responses. Moreover, CBH5, which is partially encoded by VH1-69, is a potent cross-neutralizing anti-HCV mAb (Chan et al., 2001; Keck et al., 2007). The distinct hydrophobic CDR-H2 loop encoded by VH1-69 may confer antiviral activity by binding to hydrophobic viral targets (Sui et al., 2009).

Additionally, the usefulness of our approach may not be limited to patients with rheumatic or viral diseases. VH1-69/Vκ3-20 gene pairs are also increased in frequency among B cell chronic lymphocytic leukemia (CLL) clones (Messmer et al., 2004). Expression of CLL patients' IgM mAbs as IgG1 suggests that somatic hypermutation abrogates germline BCR reactivity (Herve et al., 2005), and recent evidence suggests that they may recognize nonmuscle myosin heavy chain IIA (Chu et al., 2010). Expression of these mAbs as IgM may reveal additional, or altered antigenic specificities by virtue of Cμ-dependent IgV conformations.

To conclude, we have described a system to clone and express IgM RF from VH1-69+ B cells. The expression of monoclonal RF as IgM allows for an assessment of antigenic reactivity that more accurately reflects in vivo disease processes. This methodology may be utilized for the elucidation of the pathogenesis of human rheumatic disease, B cell neoplasia, or for the assessment of effective antimicrobial humoral responses.

Acknowledgments

We are grateful for the generosity of the patient volunteers. We thank Roy Jefferis for G6 mAb, Götz Ehrhardt for biotinylated FCRL4 F(ab')2, and Steve Foung for CBH5 IgG1 mRNA. We thank the Rockefeller University Center for Clinical and Translational Science for providing excellent clinical research support. We appreciate the expert assistance of Svetlana Mazel and Chris Bare of the Rockefeller University Flow Cytometry Core Facility. Sorting on the FACSAria II was made possible by support from the Empire State Stem Cell Fund through NYSDOH Contract #C023046. Opinions expressed here are solely those of the authors and do not necessarily reflect those of the Empire State Stem Cell Fund, the NYSDOH, or the state of NY.

This study was supported in part by the National Institute of Health/National Institute of Allergy and Infectious Disease grants R01AI60561 (L.B.D.) and K08AI075031 (E.D.C.), the Irma T. Hirschl/Monique Weill-Caulier Trust (L.B.D.), and CTSA grant UL1 RR024143 (to Rockefeller University), from the National Center for Research Resources (NCRR), a component of NIH.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. National Center for Biotechnology Information [Accessed October 1, 2009];GenBank. http://ncbi.nlm.nih.gov/Genbank.
  2. Bende RJ, Aarts WM, Riedl RG, de Jong D, Pals ST, van Noesel CJ. Among B cell non-Hodgkin's lymphomas, MALT lymphomas express a unique antibody repertoire with frequent rheumatoid factor reactivity. J Exp Med. 2005;201:1229–41. doi: 10.1084/jem.20050068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bonagura VR, Agostino N, Borretzen M, Thompson KM, Natvig JB, Morrison SL. Mapping IgG epitopes bound by rheumatoid factors from immunized controls identifies disease-specific rheumatoid factors produced by patients with rheumatoid arthritis. J Immunol. 1998;160:2496–505. [PubMed] [Google Scholar]
  4. Brown CM, Plater-Zyberk C, Mageed RA, Jefferis R, Maini RN. Analysis of immunoglobulins secreted by hybridomas derived from rheumatoid synovia. Clin Exp Immunol. 1990;80:366–72. doi: 10.1111/j.1365-2249.1990.tb03294.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carbonari M, Caprini E, Tedesco T, Mazzetta F, Tocco V, Casato M, Russo G, Fiorilli M. Hepatitis C virus drives the unconstrained monoclonal expansion of VH1-69-expressing memory B cells in type II cryoglobulinemia: a model of infection-driven lymphomagenesis. J Immunol. 2005;174:6532–9. doi: 10.4049/jimmunol.174.10.6532. [DOI] [PubMed] [Google Scholar]
  6. Chan CH, Hadlock KG, Foung SK, Levy S. V(H)1-69 gene is preferentially used by hepatitis C virus-associated B cell lymphomas and by normal B cells responding to the E2 viral antigen. Blood. 2001;97:1023–6. doi: 10.1182/blood.v97.4.1023. [DOI] [PubMed] [Google Scholar]
  7. Charles ED, Dustin LB. Hepatitis C virus-induced cryoglobulinemia. Kidney Int. 2009;76:818–24. doi: 10.1038/ki.2009.247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Charles ED, Green RM, Marukian S, Talal AH, Lake-Bakaar GV, Jacobson IM, Rice CM, Dustin LB. Clonal expansion of immunoglobulin M+CD27+ B cells in HCV-associated mixed cryoglobulinemia. Blood. 2008;111:1344–56. doi: 10.1182/blood-2007-07-101717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chu CC, Catera R, Zhang L, Didier S, Agagnina BM, Damle RN, Kaufman MS, Kolitz JE, Allen SL, Rai KR, Chiorazzi N. Many chronic lymphocytic leukemia antibodies recognize apoptotic cells with exposed nonmuscle myosin heavy chain IIA: implications for patient outcome and cell of origin. Blood. 2010;115:3907–15. doi: 10.1182/blood-2009-09-244251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Corti D, Suguitan AL, Jr., Pinna D, Silacci C, Fernandez-Rodriguez BM, Vanzetta F, Santos C, Luke CJ, Torres-Velez FJ, Temperton NJ, Weiss RA, Sallusto F, Subbarao K, Lanzavecchia A. Heterosubtypic neutralizing antibodies are produced by individuals immunized with a seasonal influenza vaccine. J Clin Invest. 120:1663–73. doi: 10.1172/JCI41902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fossati-Jimack L, Reininger L, Chicheportiche Y, Clynes R, Ravetch JV, Honjo T, Izui S. High pathogenic potential of low-affinity autoantibodies in experimental autoimmune hemolytic anemia. J Exp Med. 1999;190:1689–96. doi: 10.1084/jem.190.11.1689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gorevic PD, Frangione B. Mixed cryoglobulinemia cross-reactive idiotypes: implications for the relationship of MC to rheumatic and lymphoproliferative diseases. Semin Hematol. 1991;28:79–94. [PubMed] [Google Scholar]
  13. Herve M, Xu K, Ng YS, Wardemann H, Albesiano E, Messmer BT, Chiorazzi N, Meffre E. Unmutated and mutated chronic lymphocytic leukemias derive from self-reactive B cell precursors despite expressing different antibody reactivity. J Clin Invest. 2005;115:1636–43. doi: 10.1172/JCI24387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huang CC, Venturi M, Majeed S, Moore MJ, Phogat S, Zhang MY, Dimitrov DS, Hendrickson WA, Robinson J, Sodroski J, Wyatt R, Choe H, Farzan M, Kwong PD. Structural basis of tyrosine sulfation and VH-gene usage in antibodies that recognize the HIV type 1 coreceptor-binding site on gp120. Proc Natl Acad Sci U S A. 2004;101:2706–11. doi: 10.1073/pnas.0308527100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Keck ZY, Xia J, Cai Z, Li TK, Owsianka AM, Patel AH, Luo G, Foung SK. Immunogenic and functional organization of hepatitis C virus (HCV) glycoprotein E2 on infectious HCV virions. J Virol. 2007;81:1043–7. doi: 10.1128/JVI.01710-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Knight GB, Agnello V, Bonagura V, Barnes JL, Panka DJ, Zhang QX. Human rheumatoid factor cross-idiotypes. IV. Studies on WA XId-positive IgM without rheumatoid factor activity provide evidence that the WA XId is not unique to rheumatoid factors and is distinct from the 17.109 and G6 XIds. J Exp Med. 1993;178:1903–11. doi: 10.1084/jem.178.6.1903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Laffly E, Sodoyer R. Monoclonal and recombinant antibodies, 30 years after. Hum Antibodies. 2005;14:33–55. [PubMed] [Google Scholar]
  18. Messmer BT, Albesiano E, Efremov DG, Ghiotto F, Allen SL, Kolitz J, Foa R, Damle RN, Fais F, Messmer D, Rai KR, Ferrarini M, Chiorazzi N. Multiple distinct sets of stereotyped antigen receptors indicate a role for antigen in promoting chronic lymphocytic leukemia. J Exp Med. 2004;200:519–25. doi: 10.1084/jem.20040544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Normansell D.a.C.Y., Jr. The IgG Subclass Specificity of Anti IgG Immunoglobulin Rheumatoid Factors. Immunochemistry. 1975;12:187–188. [Google Scholar]
  20. Potter KN, Li Y, Mageed RA, Jefferis R, Capra JD. Molecular characterization of the VH1-specific variable region determinants recognized by anti-idiotypic monoclonal antibodies G6 and G8. Scand J Immunol. 1999;50:14–20. doi: 10.1046/j.1365-3083.1999.00524.x. [DOI] [PubMed] [Google Scholar]
  21. Schrohenloher RE, Mestecky J, Stanton TH. Molecular weight of a human J chain. Biochim Biophys Acta. 1973;295:576–81. doi: 10.1016/0005-2795(73)90055-x. [DOI] [PubMed] [Google Scholar]
  22. Silverman GJ, Goldfien RD, Chen P, Mageed RA, Jefferis R, Goni F, Frangione B, Fong S, Carson DA. Idiotypic and subgroup analysis of human monoclonal rheumatoid factors. Implications for structural and genetic basis of autoantibodies in humans. J Clin Invest. 1988;82:469–75. doi: 10.1172/JCI113620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Souto-Carneiro MM, Longo NS, Russ DE, Sun HW, Lipsky PE. Characterization of the human Ig heavy chain antigen binding complementarity determining region 3 using a newly developed software algorithm, JOINSOLVER. J Immunol. 2004;172:6790–802. doi: 10.4049/jimmunol.172.11.6790. [DOI] [PubMed] [Google Scholar]
  24. Steinitz M, Izak G, Cohen S, Ehrenfeld M, Flechner I. Continuous production of monoclonal rheumatoid factor by EBV-transformed lymphocytes. Nature. 1980;287:443–5. doi: 10.1038/287443a0. [DOI] [PubMed] [Google Scholar]
  25. Sui J, Hwang WC, Perez S, Wei G, Aird D, Chen LM, Santelli E, Stec B, Cadwell G, Ali M, Wan H, Murakami A, Yammanuru A, Han T, Cox NJ, Bankston LA, Donis RO, Liddington RC, Marasco WA. Structural and functional bases for broad-spectrum neutralization of avian and human influenza A viruses. Nat Struct Mol Biol. 2009;16:265–73. doi: 10.1038/nsmb.1566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Symersky J, Novak J, McPherson DT, DeLucas L, Mestecky J. Expression of the recombinant human immunoglobulin J chain in Escherichia coli. Mol Immunol. 2000;37:133–40. doi: 10.1016/s0161-5890(00)00035-3. [DOI] [PubMed] [Google Scholar]
  27. Tiller T, Meffre E, Yurasov S, Tsuiji M, Nussenzweig MC, Wardemann H. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 2008;329:112–24. doi: 10.1016/j.jim.2007.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Torres M, Casadevall A. The immunoglobulin constant region contributes to affinity and specificity. Trends Immunol. 2008;29:91–7. doi: 10.1016/j.it.2007.11.004. [DOI] [PubMed] [Google Scholar]
  29. Traggiai E, Becker S, Subbarao K, Kolesnikova L, Uematsu Y, Gismondo MR, Murphy BR, Rappuoli R, Lanzavecchia A. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 2004;10:871–5. doi: 10.1038/nm1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vorauer-Uhl K, Wallner J, Lhota G, Katinger H, Kunert R. IgM characterization directly performed in crude culture supernatants by a new simple electrophoretic method. J Immunol Methods. 2010;359:21–7. doi: 10.1016/j.jim.2010.05.003. [DOI] [PubMed] [Google Scholar]
  31. Wardemann H, Yurasov S, Schaefer A, Young JW, Meffre E, Nussenzweig MC. Predominant autoantibody production by early human B cell precursors. Science. 2003;301:1374–7. doi: 10.1126/science.1086907. [DOI] [PubMed] [Google Scholar]

RESOURCES