Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jan 1.
Published in final edited form as: Cell Microbiol. 2010 Aug 27;13(1):47–61. doi: 10.1111/j.1462-5822.2010.01516.x

Anaplasma phagocytophilum AptA modulates Erk1/2 signaling

Bindu Sukumaran 1, Juliana E Mastronunzio 1,#, Sukanya Narasimhan 1,#, Sarah Fankhauser 4, Pradeep D Uchil 2, Roie Levy 4, Morven Graham 3, Tonya Michelle Colpitts 1, Cammie F Lesser 4,+, Erol Fikrig 1,+,*
PMCID: PMC3005019  NIHMSID: NIHMS244432  PMID: 20716207

Summary

Anaplasma phagocytophilum causes human granulocytic anaplasmosis, one of the most common tick-borne diseases in North America. This unusual obligate intracellular pathogen selectively persists within polymorphonuclear leukocytes. In this study, using the yeast surrogate model we identified an A. phagocytophilum virulence protein, AptA (Anaplasma phagocytophilum toxin A), that activates mammalian Erk1/2 mitogen activated protein kinase. This activation is important for A. phagocytophilum survival within human neutrophils. AptA interacts with the intermediate filament protein vimentin, which is essential for A. phagocytophilum-induced Erk1/2 activation and infection. A. phagocytophilum infection reorganizes vimentin around the bacterial inclusion, thereby contributing to intracellular survival. These observations reveal a major role for the bacterial protein, AptA, and the host protein, vimentin, in the activation of Erk1/2 during A. phagocytophilum infection.

Introduction

Obligate intracellular bacteria belonging to the order Rickettsiales (Dumler et al., 2001) are among the most deadly and least studied human pathogens, particularly in terms of the mechanisms of infection. Anaplasma phagocytophilum, an arthropod-borne Rickettsiales bacterium (Dumler and Bakken, 1998), is the second most common tick-borne pathogen in the United States. A. phagocytophilum causes human granulocytic anaplasmosis (HGA) (Dumler et al., 2005), an illness with a reported mortality rate of up to 5% (Bayard-Mc Neeley et al., 2004; Bakken et al., 1996). In nature, A. phagocytophilum cycles between its arthropod vector, Ixodes scapularis, and its primary mammalian reservoir, the white-footed mouse, Peromyscus leucopus (Bakken and Dumler, 2000).

Our knowledge about the survival strategies of A. phagocytophilum (and other Rickettsiales) is primarily confined to the host cell modifications occurring during infection (Carlyon and Fikrig, 2006). A. phagocytophilum is a unique obligate intracellular bacterium with a specific tropism for human neutrophils, major contributors to the host innate immune response. A. phagocytophilum uses platelet selectin glycoprotein-1 (PSGL1) to enter human cells, in an α-2,3 sialylation- and α-1,3 fucosylation-dependent manner (Carlyon and Fikrig, 2006; Yago et al., 2003). ROCK1 phosphorylation-induced signaling is also important for A. phagocytophilum internalization (Thomas and Fikrig, 2007). Following the entry into polymorphonuclear leukocytes by caveolae-mediated endocytosis, A. phagocytophilum-containing vacuoles evade fusion with host lysosomes, thereby avoiding phagolysosomal killing (Webster et al., 1998). A. phagocytophilum infection causes inhibition of the neutrophil respiratory burst by repressing gp91phox and rac2, leading to inhibition of the production of lethal superoxide anions (Carlyon et al., 2002; Banerjee et al., 2000). A delay of spontaneous apoptosis (Borjesson et al., 2005; Ge et al., 2005), exploitation of early autophagosome-like compartment for survival (Niu et al., 2008), selective recruitment of Rab GTPases to the A. phagocytophilum-containing vacuole (Huang et al., 2010a), host lipid incorporation (Xiong et al., 2009; Manzano-Roman et al., 2008), and epigenetic modulation of host defense genes (Garcia-Garcia et al., 2009a) are other host cell modifications induced by this bacterium. Recently, activation of Erk1/2, a key component of the host MAP kinase pathway, has been suggested to be required for the infection of HL-60 cells by A. phagocytophilum (Xiong et al., 2009). Erk1/2 activation has been implicated in the infection of several bacteria (Voth and Heinzen, 2009). The bacterial proteins involved in Erk1/2 activation are not known, with the exception of CagA protein of Helicobacter pylori (Zhu et al., 2007) and the listerolysin A of Listeria monocytogenes (Tang et al., 1998).

The identity of the A. phagocytophilum components that are involved in facilitating mammalian host colonization, including Erk1/2 activation, is not known. Many bacterial pathogens inject effector proteins directly into the host cell cytoplasm to modulate cell functions. The type IV secretion apparatus, evolutionarily related to the bacterial conjugation machinery, is among the several specialized systems used by bacteria to deliver virulence factors into host cells (Cascales and Christie, 2003). Recent studies have identified VirB/D4 operons homologous to the Agrobacterium tumefaciens type IV system in the A. phagocytophilum genome (Hotopp et al., 2006). AnkA and Ats-1 (Niu et al., 2010) are the only A. phagocytophilum-encoded secreted effector proteins identified so far, that modulate host cell signaling. AnkA activates SHP-1, binds Abl-1 and interacts with neutrophil DNA, nuclear proteins as well as transcriptional regulatory regions of the CYBB locus (Garcia-Garcia et al., 2009b; Ijdo et al., 2007; Lin et al., 2007; Park et al., 2004). Ats-1 localizes to host cell mitochondria during A. phagocytophilum infection, and delays apoptosis (Niu et al., 2010).

Yeast is a model eukaryote that has recently emerged as a powerful surrogate for the identification of bacterial virulence factors that target conserved eukaryotic cellular signaling pathways. This system is particularly useful for identifying virulence proteins for bacteria, and obligate intracellular pathogens, that are not readily amenable to genetic manipulation (Siggers and Lesser, 2008). The basic approach involves expression of the bacterial proteins in yeast and monitoring their effect on yeast physiology. There is ample evidence that yeast growth inhibition is a sensitive and specific marker of bacterial virulence proteins (Aleman et al., 2009; Huang et al., 2008; Kramer et al., 2007; Sisko et al., 2006; Campodonico et al., 2005; Rodriguez-Escudero et al., 2005; Shohdy et al., 2005; Lesser and Miller, 2001; Tripathi et al., 2010). We now extend this approach to better understand the infection strategies of A. phagocytophilum, as a model for genetically intractable Rickettsial pathogens.

Results

AptA, a putative virulence protein from A. phagocytophilum, inhibits yeast growth

Pathogenic bacteria are known to utilize bacterially encoded proteins (effector/ virulence proteins) to modulate their host’s cellular signaling pathways. Some of these bacteria have evolved versatile bacterial transport systems to export a multitude of effector molecules into eukaryotic cells. The structural components of such transport systems (e.g., Type IV secretion apparatus) are well conserved among divergent bacterial species. In contrast, identification and characterization of the effector proteins has been a challenging task since each bacterium delivers its own unique set of effector molecules with no signature sequence or sequence similarity to known proteins. We initiated a study to identify putative effector proteins of A. phagocytophilum using the well-established yeast model. It was reasoned that A. phagocytophilum proteins that interfere with conserved eukaryotic signaling may inhibit growth when expressed in yeast. During natural infection, endogenous expression of these genes often will not cause growth inhibition because they are expressed at a very low level, coupled with temporal differences. We expressed candidate A. phagocytophilum virulence proteins in yeast and monitored their effect on yeast growth. The A. phagocytophilum genome encodes 1369 ORFs, among which 747 ORFs have been assigned a function (Hotopp et al., 2006). We chose 35 A. phagocytophilum proteins (Supplementary Figure 1A), each of which satisfied one or more of the following three criteria: (a) similarity to eukaryotic protein motifs (using the software 3D–PSSM, www.sbg.bio.ic.ac.uk/3dpssm), (b) expressed during A. phagocytophilum infection (Nelson et al., 2008) and (c) unique to A. phagocytophilum. The A. phagocytophilum ORFs, cloned into a high-copy vector under the control of the GAL10 promoter such that they were fused to GFP (Lesser and Miller, 2001), were transformed and conditionally expressed in wild type yeast (S288C).

To determine the effect of expression of A. phagocytophilum proteins on yeast growth, both liquid and solid growth assays were conducted. By monitoring the GFP expression, we confirmed that 33 of the tested proteins were expressed in yeast (data not shown). Strikingly, the assay showed that the growth of yeast is severely reduced by the expression of the A. phagocytophilum protein APH_0233 (hereafter named as AptA, for A. phagocytophilum toxin A). Figure 1A shows that yeast cells expressing GFP-AptA grew normally under non-inducing conditions, but failed to grow on inducing galactose-containing medium. Yeast cells expressing negative control GFP-vector showed comparable growth in both glucose and galactose-containing medium. This result shows that AptA expression negatively impacts yeast growth, indicating potential interference with eukaryotic cellular functions. None of the other 32 proteins impacted yeast growth.

Figure 1.

Figure 1

Open in a new tab

Expression of AptA attenuates eukaryotic cell growth. (A) Yeast cells harboring GFP-AptA or vector-GFP grown as 10-fold serial dilutions in non-inducing glucose or inducing galactose were imaged at 48 h. (B) Growth of yeast cells when AptA was expressed from high copy (HC), low copy (LC), or no tag vectors. L. pneumophila Type IV effector YlfA (Yeast lethal factor A) was used as the positive control for inhibition. Results are expressed as the mean ± SD of triplicate samples normalized to vector control. (C) RT-PCR analysis of total RNA isolated from A. phagocytophilum-infected HL-60 cells (Lane 1) or infected tick salivary glands during transmission (Tick-I-Tra, Lane 2) and acquisition (Tick-I-Acq, Lane-3) shows that AptA is differentially expressed by A. phagocytophilum during its infection cycle. (D) Western blot analysis shows that AptA is expressed by A. phagocytophilum in HL-60 cells at 24 h post infection. AptA pre-immune serum is shown as the negative control. (E) AptA expression caused a reduction in the proliferation of HEK293 cells by BrdU proliferation assay measured at 48 h, expressed as the mean ± SD of triplicate samples. *, p<0.05 (unpaired two-tailed test).

As shown in figure 1B, expression of GFP-AptA from a low copy number vector also significantly reduced yeast growth (p < 0.05). Furthermore, we also determined that the phenotypic effect of AptA is independent of fusion with GFP (Figure 1B). In all cases, the degree of growth retardation caused by AptA was comparable to the control YlfA, a known virulence factor of Legionella pneumophila (Campodonico et al., 2005) (Figure 1B). Collectively, these results convincingly identified a protein encoded by A. phagocytophilum that alters yeast growth.

AptA is a 298 amino acid protein with no known or predicted function. It has four predicted transmembrane segments, indicating potential association with membranes. AptA is a highly positive charged (43 positively charged vs 18 negatively charged residues) protein with a pI of 10.25.

AptA is expressed by A. phagocytophilum during mammalian infection, and alters mammalian cell proliferation

A. phagocytophilum has a biphasic life cycle involving both mammalian and arthropod hosts. AptA could be involved in the infection of either one, or both, of these hosts. Due to its obligate intracellular nature, however, targeted gene deletion of the effector proteins is not feasible in A. phagocytophilum. We attempted to understand the involvement of AptA in the life cycle of A. phagocytophilum by first determining its expression profile. Using RT-PCR, we found that the AptA gene is transcribed by A. phagocytophilum (HZ strain) during infection (24 h post-infection) of HL-60 cells, an in vitro cell culture infection model (Figure 1C). In contrast, AptA transcripts were not detected in A. phagocytophilum-infected ticks at 72 h post-feeding, during either acquisition or transmission (Figure 1C). The presence of the bacterium within ticks was confirmed by bacteria-specific 16s rRNAgene amplification. We also detected the presence of AptA protein in infected HL-60 cells (Figure 1D) using AptA specific polyclonal antisera raised in rabbit. Thus, AptA displays differential expression during A. phagocytophilum infection cycle.

We also investigated whether ectopically expressed AptA exerts any growth altering phenotype on mammalian cells. As shown in figure 1E, expression of AptA in HEK293 cells (Supplementary Figure 1B) caused a 2.5 fold (p<0.03) reduction in cell proliferation, as measured by the BrdU proliferation assay. The transfection efficiency was determined to be comparable between AptA (81±3%) and vector (84±2%) transfected cells (Supplementary Figure 1C). In summary, AptA interfered with growth of both yeast and mammalian cells.

AptA localizes with A. phagocytophilum inclusions during infection

We next analyzed the sub-cellular localization of AptA in yeast. As seen in Figure 2A, at 2 h GFP-AptA is seen within the yeast cell cytoplasm and a small region of the plasma membrane. At 4 h the protein begins to spread on the plasma membrane, and by 8 h it completely encircled the periphery of yeast cells, indicating its localization to the plasma membrane. GFP–alone does not localize to membranes. We also adopted a biochemical approach to confirm the observed surface membrane localization of AptA. Using selective fractionation of yeast expressing AptA, we show that AptA was present in the plasma membrane fraction (Figure 2B). A similar distribution pattern was also observed in mammalian cells such as HEK293 cells (Supplementary Figure 2A), HL-60 and RF/6A cells (Figure 2C and 2D). The latter two cell types are used as in vitro cell culture models of A. phagocytophilum infection (Xiong et al., 2009; Herron et al., 2005). AptA expressed from the vector pEGFP-C1 for 24 h showed a predominant localization at the plasma membrane, as well as punctate spots in the cytoplasm of these mammalian cells.

Figure 2.

Figure 2

Open in a new tab

Localization of AptA. (A) GFP-AptA is localized to plasma membrane of yeast by 8 h post induction. Deletion of N-terminal 60 amino acids (GFP-AptA-DN60), but not C-terminal (GFP-AptA-DC60), abolished the membrane localization of AptA. Cells expressing control GFP at 8 h of induction show GFP localization in the cytoplasm. (B) Western blot showing the expression of AptA in GFP-AptA expressing yeast cells using GFP antibody. UI-total= un-induced total lysate, I-total= Induced total lysate, the expression of protein was induced by galactose. Biochemical fractionation of yeast cells expressing GFP-AptA shows that AptA is present in the plasma membrane fraction (I-PM) of the yeast lysate. (C) and (D) shows that AptA is localized to the plasma membrane and as punctate cytoplasmic spots of HL-60 or RF/6A cells respectively. The cells were transfected with AptA in pC1EGFP vector and the expression analysis was done at 24 h post-transfection. Similar to yeast, deletion of N-terminal 60 amino acids (GFP-AptA-DN60), but not C-terminal (GFP-AptA-DC60), abolished the membrane localization of AptA in HL-60 cells (E) Ectopically expressed AptA colocalized with A. phagocytophilum inclusions. RF/6A cells were transfected with GFP-AptA (green), and infected with mCherry- A. phagocytophilum (red) for 24 h and analysed by immunoflourescence. (F) Endogenously expressed AptA is localized to the inclusion membrane of A. phagocytophilum. RF/6A cells infected with mCherry- A. phagocytophilum (red) for 48 h were fixed immunostained using polyclonal antibody against AptA (green). White arrow shows AptA on the inclusion membrane. AptA pre-immune control serum does not stain A. phagocytophilum-infected RF/6A cells. (G) Time course analysis of endogenously expressed AptA in RF/6A cells. AptA (green) expression is barely detectable at 12 h post infection around A. phagocytophilum (red), however at 24 h and 48 h following infection, AptA was localized to the inclusion membrane. (H) Immuno-electron microscopic imaging (using anti-AptA antibody) showing distribution of AptA in A. phagocytophilum-infected HL-60 cells. Black dots correspond to AptA. Bars, 0.2 µm.

We next determined the region of AptA required for the subcellular localization by creating AptA truncations. Deletion of the amino-terminal 28 (data not shown) or 60 amino acids completely abolished the subcellular localization of AptA in yeast (Figure 2A). However, deletion of even up to 60 amino acids from C-terminus did not abolish localization (Figure 2A). The truncated alleles of AptA behaved similarly when expressed in HL-60 cells (Figure 2C). Thus, AptA has an N-terminal sequence-dependent subcellular localization in both yeast and mammalian cells, pointing to a conserved mode of interaction.

In infected cells A. phagocytophilum resides and replicates within membrane-bound compartments (vacuoles) to form microcolonies called morulae or inclusions. Because ectopically expressed AptA was found to associate with membranous compartments, we hypothesized that AptA may localize to A. phagocytophilum inclusions during infection. We used RF/6A cells, which are flat, large and easily transfectable, for the imaging studies instead of HL-60 cells (Herron et al., 2005; Niu et al., 2010). The cells were transfected with GFP-AptA and then infected with A. phagocytophilum. Interestingly, we observed that ectopically expressed AptA co-localized with the bacterial inclusions (Figure 2E). Because ectopic expression can result in mislocalization, we also determined the localization of AptA when it is endogenously expressed by A. phagocytophilum during infection of HL-60 (not shown) and RF/6A cells (Figure 2F). Immunostaining with AptA-specific antibody revealed that AptA expressed by A. phagocytophilum during infection was seen as a punctate ring on the membrane of the bacterial inclusion (Figure 2F). Individual A. phagocytophilum also stained for AptA (Supplementary Figure 3A).

Subsequently we determined the kinetics of AptA expression during infection. As shown in Figure 2G, until 12 h post infection, there was barely any detectable expression of AptA in infected cells. However, during the active multiplication of bacteria (at around 24 h onwards), strong expression of AptA was detected. Interestingly, the expression of AptA seems to be coincident with the formation of A. phagocytophilum inclusions. Furthermore, immuno-EM studies demonstrated the presence of AptA on the surrounding vacuolar membrane as well as the cytoplasmic region adjoining the vacuole (Figure 2H, Supplementary Figure 3B). Taken together, these results indicate that AptA co-localizes with A. phagocytophilum inclusions during infection.

MAP kinase pathway is a target of AptA

We reasoned that the ability of AptA to inhibit yeast growth is likely due to its interference with a conserved eukaryotic cellular pathway. Therefore we systematically investigated whether any such aspects of yeast cells are altered by AptA expression. Staining for yeast nuclei, mitochondria, endoplasmic reticulum, plasma membrane and actin showed that all these structures are unaltered by expression of AptA (data not shown). We then investigated whether expression of AptA activates or inhibits MAP kinase signaling pathways. Yeast encode six MAP kinase pathways (Gustin et al., 1998) that normally exhibit minimal activity when the yeast are grown under standard laboratory conditions. However, we observed that expression of AptA resulted in activation of one of these highly conserved eukaryotic MAPK signaling cascades, the yeast cell wall integrity pathway. As shown in Figure 3A, expression of AptA resulted in the phosphorylation (3.8 fold by the software ImageJ, http://rsbweb.nih.gov/ij/) of Mpk1, the terminal MAPK in this pathway. Furthermore, expression of AptA resulted in the activation of Rlm1, a transcription factor activated by induction of the cell wall integrity pathway. As shown in Figure 3B, expression of AptA increased the activity of Rlm1 transcription reporter 35-fold (p <0.005) compared to control. We did not detect a significant activation of other MAP kinase pathways of yeast (not shown).

Figure 3.

Figure 3

Open in a new tab

AptA activates MAP kinase pathway and interacts with vimentin. (A) and (B) show that AptA activates cell wall integrity MAP kinase pathway in yeast. (A) Western blot of AptA expressing yeast cells (4 h post induction) showed the phosphorylation of Mpk1/Slt2, the MAPK of cell wall integrity pathway. −AptA (without induction), and +AptA (with induction). (B) AptA activates the Rlm1-regulated β-galactosidase reporter. Yeast cells harboring Rlm1-β gal reporter construct and AptA or control vector were assayed at 0, 2 and 4 h following induction. The results are expressed as the mean ± SD from triplicate experiments. *, p<0.05 (unpaired two-tailed test). **, p<0.01 (unpaired two-tailed test). (C) AptA activates the Erk1/2 MAPK pathway through Mek1/2 in mammalian cells. Western blot performed using pErk1/2 and pMek1/2 antibodies on the lysate from HL-60 cells transfected with GFP-AptA and vector-GFP at 24 h post transfection. Non-phosphorylated Erk1/2 and Mek1/2 was used as controls (D) N terminal 28 amino acids of AptA is required for Erk1/2 activation. HL-60 cells were transfected for 24 h with full length (full), vector-GFP (GFP), N-terminal 28-amino acid deletion (DN28), N-terminal 60-amino acid deletion (DN60), and C-terminal 60-amino acid deletion (DC60) mutants of AptA. (E) Immunoprecipitated vimentin from AptA-GFP, DN60, DC60 or vector-GFP transfected HEK293 cells, followed by probing with anti-AptA antibody, showed that AptA co-immunoprecipitated with vimentin from AptA-GFP and DC60 but not with vector-GFP and DN60 transfected samples. Total lysate (input) was probed with anti-AptA antibody to show the expression of AptA in AptA-GFP, DN60 or DC60 transfected cells. (F) AptA and vimentin colocalize on A. phagocytophilum inclusion membrane. RF/6A cells or neutrophils (Nϕ) infected with A. phagocytophilum for 72 h or 3 h for Nϕ were immuno-stained for both vimentin (green) and AptA (red). Infected (I) RF/6A cells and neutrophils treated with isotype antibodies were used as negative controls.

Mammalian Erk1/2 is activated by AptA through MEK1/2

We next investigated whether AptA activates mammalian MAPK signaling pathways. To test this, we transiently expressed AptA in HL-60 and HEK293 cells for 24 h, and monitored the activation of the three major mammalian MAP Kinase pathways: Erk1/2, JNK and p38. As shown in Figure 3C (Supplementary Figure 3C for HEK293 cells), AptA expression specifically induced phosphorylation of Erk1/2. Quantitation using the software ImageJ showed 2.1 and 2.8 fold activation of Erk1/2 by AptA in HL-60 and HEK 293 cells respectively . Other MAPK pathways were not altered by AptA (not shown). Interestingly, the mammalian Erk pathway shares the most homology with the yeast cell wall integrity pathway. As shown in Figure 3D, deletion of the amino-terminal 28 amino acids (DN28 AptA) of AptA nearly completely abolished Erk1/2 activation, while deletion of up to 60 carboxy-terminal residues had no effect. This observation demonstrates that AptA specifically activates mammalian Erk1/2 pathway, a phenotype that is consistent with what is observed in the yeast, further supporting the use of this model organism for studying bacterial virulence proteins. Furthermore, these results show that the N-terminus of AptA is key to its localization and MAP Kinase activation.

In order to gain insight into how AptA activates Erk1/2, we next investigated the activation states of upstream proteins in the ERK signaling cascade by examining their phosphorylation state. Interestingly, MEK, the key MAP2K that phosphorylates Erk1/2, was also activated (phosphorylated) (1.5-fold by ImageJ) in HL-60 cells expressing AptA (Figure 3C). Similarly, MEK1/2 was also activated (2.2-fold by ImageJ) in AptA expressing HEK 293 cells (Supplementary Figure 3C). These results indicate that AptA activates Erk1/2 through MEK.

Tandem affinity purification (TAP) identifies vimentin as an interacting partner of AptA

In order to further define the mechanism by which AptA modulates eukaryotic cell physiology, we performed a tandem affinity purification (TAP) immunoprecipitation assay to identify mammalian proteins that interact with AptA. We used an N-terminal calmodulin tag-based TAP system and full length AptA in HEK293 cells to purify the interacting proteins. The putative interacting proteins were subsequently identified by LC/MS-MS, and the protein with the highest score was found to be the cytoskeletal protein vimentin. Therefore we focused on vimentin as a potential interacting partner of AptA. To validate this interaction, AptA-transfected cells were lysed and endogenous vimentin was immunoprecipitated using anti-vimentin antibody, followed by probing with AptA antibody. As shown in Figure 3E, the Western blot showed that immunoprecipitated vimentin also pulled down AptA. Truncation experiments showed that the N-terminus of AptA is required for interaction with vimentin (Figure 3E). These experiments demonstrate that AptA interacts with the mammalian intermediate filament protein vimentin.

The identified interaction of AptA with vimentin suggests that these proteins associate during infection. Because AptA is present around the A. phagocytophilum inclusions and also interacts with vimentin, we hypothesized that vimentin may colocalize with AptA such that it is distributed around A. phagocytophilum inclusion. To address this, we performed double indirect immunofluorescence staining of AptA and vimentin in A. phagocytophilum-infected RF/6A cells. As hypothesized, AptA and vimentin colocalized in A. phagocytophilum infected cells (Figure 3F). In uninfected cells, vimentin was present throughout the cytoplasm. Interestingly, during infection, vimentin was reorganized in such a way that it was present as a network predominantly around the A. phagocytophilum inclusion. A similar pattern of vimentin localization was also observed in A. phagocytophilum-infected human neutrophils (Figure 3F). Immuno- electron microscopy also identified vimentin around the inclusion (Supplementary Figure 4A and 4B). In addition, immuno-EM showed a spatial proximity between AptA and vimentin (Supplementary Figure 4A). Thus, these data further substantiate the identified interaction between AptA and vimentin.

A. phagocytophilum infection results in vimentin dependent Erk1/2 phosphorylation

Because we found that AptA induces Erk1/2 phosphorylation, we investigated this further in the context of A. phagocytophilum infection. We first investigated whether Erk1/2 is activated by the bacterium. We found that Erk1/2 is phosphorylated during infection of both HL-60 cells and human neutrophils (Figure 4A). We also determined that bacterial internalization was required for Erk1/2 activation (Figure 4B). Infection of HL-60 cells pretreated with cytochalasin D (final concentration 3 µM) for 30 min, a drug previously shown to block entry but not binding of A. phagocytophilum, failed to activate Erk1/2. Treatment of neutrophils with the MEK inhibitor U0126 revealed that A. phagocytophilum infection activates Erk1/2 in a MEK1/2-dependent manner (Figure 4 C). Recently, Kumar et al (2007) showed that vimentin plays a role in Erk1/2 activation from beta-adrenergic receptor signaling (Kumar et al., 2007). Another study also showed that vimentin maintains Erk1/2 in its phosphorylated state (Perlson et al., 2006). Because both AptA and vimentin are involved in Erk1/2 activation, and are also interacting partners, we next tested whether vimentin is required for the phosphorylation of Erk1/2 in A. phagocytophilum-infected HL-60 cells. As seen in Figure 4D, phosphorylation of Erk1/2 was greatly reduced in vimentin-silenced cells infected with A. phagocytophilum. Efficient vimentin gene silencing was confirmed at the protein level (Supplementary Figure 5A). We also investigated whether vimentin is involved in Erk1/2 activation in infected neutrophils. Due to their short-lived nature, it is not possible to silence vimentin in neutrophils. Therefore we used the small molecule inhibitor withaferin-A, known to interfere with vimentin organization (Bargagna-Mohan et al., 2007; Chi et al., 2010), to assess the role of vimentin in Erk1/2 phosphorylation in human neutrophils. Neutrophils treated with withaferin-A also showed that intact vimentin is required for Erk1/2 activation during A. phagocytophilum infection (Figure 4E).

Figure 4.

Figure 4

Open in a new tab

Vimentin is involved in Erk1/2 activation and A. phagocytophilum infection. (A) Erk1/2 is activated during A. phagocytophilum infection in mammalian cells. Western blot analysis of Erk1/2 activation in A. phagocytophilum infected HL-60 cells and neutrophils (Nϕ) at 48 h and 3 h post infection respectively. UI (uninfected cells), I (A. phagocytophilum-infected cells). (B) Bacterial internalization is a pre-requisite to A. phagocytophilum –induced Erk1/2 activation. Western blot shows that infection of HL-60 cells pre-treated with cytochalasin D (+cyto) failed to activate Erk1/2 in comparison to cells untreated cells (−cyto). (C) Inhibition of MEK1/2 using U0126 abolishes Erk1/2 activation during A. phagocytophilum infection in human neutrophils. Neutrophils were treated with U0126 (20 µM) (I+U0126) or control DMSO (I) and infected with A. phagocytophilum for 3 h and lysates were anlaysed for phosphorylated Erk1/2. (D–I) shows that vimentin is involved in Erk1/2 phosphorylation during A. phagocytophilum infection. (D) shows reduction of Erk1/2 phosphorylation during A. phagocytophilum infection in vimentin silenced HL-60 cells. (E) shows reduction of Erk1/2 phosphorylation during A. phagocytophilum infection in withaferin A treated neutrophils. (F) Inhibition of MEK1/2 reduces A. phagocytophilum infection in human neutrophils. Neutrophils were treated with vehicle (DMSO) or the inhibitor U0126 and infected with A. phagocytophilum. Total RNA was isolated and qRT-PCR was performed to measure the levels of A. phagocytophilum, and values were normalized with the values corresponding to beta-actin. The results are expressed by normalization with DMSO control sample values, mean ± SD from triplicate experiments. (G) Silencing of vimentin caused reduction in A. phagocytophilum infection of HL-60 cells, analysed at 48 h using qRT-PCR. The levels of A. phagocytophilum were normalized with the values corresponding to beta-actin. The results are expressed by normalization with non-targeting siRNA treated control sample values, mean ± SD from triplicate experiments. (H) Vimentin silencing by Withaferin A treatment caused reduction in A. phagocytophilum infection of neutrophils, analysed by qRT-PCR. The levels of A. phagocytophilum were normalized with the values corresponding to beta-actin. The results are expressed by normalization with DMSO (vehicle) treated control sample values, mean ± SD from triplicate experiments. (I) Erk1/2 inhibition and vimentin silencing does not affect A. phagocytophilum internalization. Following Erk1/2 inhibition and vimentin silencing, the number of internalized bacteria was analyzed at an early time point (4 h post infection) by microscopy following immuno-staining. The number of A. phagocytophilum per 100 host cells was calculated and the results are shown as mean ± SD from triplicate wells and is a representative of two independent experiments with similar results. *, p<0.05 (unpaired two-tailed test). **, p<0.01 (unpaired two-tailed test).

Vimentin and Erk1/2 activation facilitates A. phagocytophilum infection of mammalian cells

We also investigated whether vimentin and Erk1/2 activation play any role in A. phagocytophilum infection. We first determined the effect of Erk1/2 activation on bacterial infection, by inhibiting MEK using the small molecule inhibitor U0126. The results revealed that prevention of Erk1/2 phosphorylation by MEK inhibition reduced A. phagocytophilum infection by 3.4 fold (p<0.05) compared to the DMSO control (Figure 4F). These results have also been recently demonstrated in HL-60 cells (Xiong et al., 2009). Subsequently, we also investigated the requirement of vimentin in A. phagocytophilum infection by silencing vimentin in HL-60 cells prior to infection. As shown in Figure 4G, vimentin gene silencing resulted in 1.6 fold (p <0.05) reduction in ,A. phagocytophilum infection of HL-60 cells (48 h), determined by Q-RTPCR. A FACS analysis also showed a comparable 1.8 fold (p <0.05) reduction in A. phagocytophilum infection under similar conditions (Supplementary Figure 5B). Using multiple unique siRNAs we confirmed the on target specificity of vimentin gene silencing (Supplementary Figure 5C). Withaferin A mediated interference of vimentin in human neutrophils also resulted in the reduction of A. phagocytophilum infection (2.3-fold, p <0.05, Figure 4H). Additional studies were performed to determine the stage of infection that is affected by Erk1/2 inhibition or vimentin silencing. Time course analysis of bacterial intake at the early time point (4 h) using immunofluorescence showed that Erk1/2 inhibition and vimentin silencing does not affect bacterial internalization. This indicates that Erk1/2 and vimentin impacts A. phagocytophilum infection at a post-internalization step (Figure 4I). These studies demonstrate a role for vimentin and Erk1/2 activation in the mammalian cellular infection of A. phagocytophilum.

Discussion

Arthropod-borne microorganisms of the order Rickettsiales include important human pathogens, and have caused epidemics resulting in millions of human deaths (Azad and Radulovic, 2003). Distributed world-wide, many rickettsial pathogens are considered potential agents of bioterrorism. Despite their importance, the infection mechanisms of Rickettsiaceae, particularly the identity of the Rickettsiales bacterial gene products that modify host cells to enable infection are poorly understood. The obligate intracellular nature of these pathogens severely limits our ability to perform conventional genetic manipulation to identify their virulence proteins. In this study, we exploited a yeast model system (Siggers and Lesser, 2008) to identify an A. phagocytophilum protein that modulates host cells to facilitate infection.

Using the yeast model, we identified a protein, AptA, which activates the cell wall integrity pathway, a highly conserved MAP kinase pathway, and subsequently confirmed that this activity is conserved in mammalian cells. AptA activated the mammalian MAP kinase pathway by inducing the phosphorylation of Erk1/2. Additional experiments showed that MEK1/2, the kinase that phosphorylates Erk1/2, was also activated by AptA. AptA was found to exhibit a differential expression, with the transcripts being detected predominantly during the mammalian phase of A. phagocytophilum infection. A recent study on the gene expression profile of A. phagocytophilum also detected a preferential expression of AptA in the mammalian host (Nelson et al., 2008).

A previous gene expression study reported that Erk1/2 is activated in neutrophils by A. phagocytophilum (Lee et al., 2008), indicating a potential role for this pathway during infection. Consistent with this, a recent study showed that infection of HL-60 cells by A. phagocytophilum requires the activation of Erk1/2 (Xiong et al., 2009). Our data extends this further by demonstrating that Erk1/2 activation is also important for the infection of neutrophils, the natural host cells of this bacterium. However, the mechanism of Erk1/2 activation during A. phagocytophilum infection, particularly the role of bacterial proteins, remains unknown. Our data demonstrate that at least one of the proteins of A. phagocytophilum, AptA, activates Erk1/2 phosphorylation. Although Erk1/2 activation was proposed to modulate the lipid dynamics important for A. phagocytophilum infection (Xiong et al., 2009), the precise role Erk1/2 plays in A. phagocytophilum infection remains unanswered. A previous study reported that Erk1/2 activation was critical for the acquisition of host lipids by the intracellular bacterium Chlamydia trachomatis. (Su et al., 2004).

Our study also reports for the first time, the involvement of the intermediate filament protein vimentin in the infection of A. phagocytophilum. We showed that vimentin interacts and colocalizes with AptA (Figure 3E, 3F). Interestingly, vimentin was reorganized during A. phagocytophilum infection around the bacterial inclusions (Figure 3F). Studies with Chlamydia (Kumar and Valdivia, 2008b; Kumar and Valdivia, 2008a) and Toxoplasma (Halonen and Weidner, 1994) have also reported pathogen-induced reorganization of vimentin. Gene silencing revealed that vimentin is required for the activation of Erk1/2 by A. phagocytophilum during infection, and vimentin is necessary for A. phagocytophilum infection. Although vimentin silencing heavily reduced the Erk1/2 phosphorylation, there was only a modest reduction in the bacterial infection. One potential reason is that even the observed low level of Erk1/2 activation may be sufficient for the infection to progress, although at a diminished rate. In addition, there may be a temporal relationship between Erk1/2 activation and its requirement for infection. How AptA– vimentin interaction is driving the activation of Erk1/2 during A. phagocytophilum infection needs further mechanistic studies. Bacterial internalization was required for Erk1/2 activation during infection. Similarly, inhibition of Erk1/2 activation and vimentin silencing did not affect the internalization of the bacterium. These results point out that both Erk1/2 and vimentin are involved at a post internalization multiplication step of A. phagocytophilum infection. Although previous studies had reported a role for vimentin in the activation of Erk1/2 consequent to adrenergic receptor signaling (Kumar et al., 2007), no study has reported a direct requirement of vimentin in Erk1/2 activation during bacterial infection. Similar to AptA, proteins of Salmonella (Murli et al., 2001) and E. coli K1 (Chi et al., 2010) were also shown to interact with vimentin, indicating an important role for this protein in cellular infection of several intracellular pathogens.

The immunofluorescence studies showed that AptA was present on both bacterial and vacuolar membranes. A recent study reported that another A. phagocytophilum protein also showed similar localization pattern (Huang et al., 2010b). In addition, immuno-EM studies also detected the presence of AptA in the cytoplasmic region surrounding the bacteria containing vacuole (Figure 2H and Supplementary Figure 4). The localization of AptA to the inclusion membrane surrounding the A. phagocytophilum morulae and adjoining cytoplasmic region indicates that at least a fraction of AptA is secreted out of the bacterium. Although A. phagocytophilum has a type IV secretion system, whether AptA is translocated through the type IV system remains to be addressed. However, the generally observed basic charged C-terminus of Type IV effectors (Vergunst et al., 2005) is absent in AptA. Even though AptA has an overall net basic charge, its C-terminus is acidic. Existence of effector proteins that are vacuolar membrane associated has been reported previously. An example is the Inc proteins of Chlamydia (Sisko et al., 2006; Rockey et al., 2002). The localization pattern of AptA suggests that AptA might activate Erk1/2 by interacting with cellular components at the interface of the cytoplasm and inclusion membrane. The TAP assay and co-IP assay suggested that AptA and vimentin interacts. Since, vimentin is also colocalized with AptA, we speculate a concerted involvement of both these molecules in Erk1/2 activation.

Ectopically expressed AptA localized predominantly to membranous structures. Interestingly, when ectopic AptA expressing cells were infected with A. phagocytophilum, there was a notable localization of AptA on the bacterial inclusion membrane. This observation hints that AptA or AptA-containing membranous structures were recruited to bacterial replication vacuole, by an unknown mechanism. A similar observation has been reported in a previous study, where an ectopically expressed virulence protein of Legionella was found to re-distribute to the bacterial vacuole during infection (Ninio et al., 2009).

In summary, this study expands our current understanding of the mechanisms adopted by A. phagocytophilum to facilitate infection. Our finding of vimentin reorganization around the bacterial inclusion and its role in Erk1/2 activation potentially indicates how vacuolar pathogens can exploit the host cytoskeleton to modulate host signaling during infection. In addition, we demonstrate that surrogate host models, such as yeast, are a powerful strategy to mine the genome of A. phagocytophilum and other Rickettsiales bacteria to reveal more information about their infection mechanisms and identify potential therapeutic targets.

Experimental procedures

GenBank accession number

APH_0233: YP_504850

Cell lines, yeast strains and plasmids

HEK293 and RF/6A cells were purchased from ATCC and cultured in DMEM with 10% FCS. HL-60 cell was cultured in RPMI 1640 supplemented with 10% FCS. Vectors used for ORF cloning and yeast expression are pDNR221 entry vector (Invitrogen, Carlsbad, CA), high-copy GFP fusion vector pFUS-GFP (Lesser and Miller, 2001), low copy GFP fusion vector p413 GAL GFP, low copy no fusion tag plasmid p413 GAL. All the yeast expression plasmids were transformed into wild type strain Saccharomyces cerevisiae, Leu+, S288C,BY4741 MATa. pEGFP-C1 (Clontech, CA) vector was used for mammalian cell gene expression studies.

In vitro cultivation of A. phagocytophilum

A. phagocytophilum strain HZ (received from Yasuko Rikihisa, Ohio State University) and mCherry-HZ (kindly provided by Ulrike G. Munderloh and Michael Herron, University of Minnesota) (Felsheim et al., 2006) were cultivated in HL-60 cells as previously described (Thomas et al., 2005). PMNs were prepared from heparinized human blood essentially as described before (Carlyon et al., 2004) . Host cell-free A. phagocytophilum was obtained as described previously (Thomas and Fikrig, 2007) and used at a multiplicity of infection (MOI) of 50.

Antibodies and Chemicals

Rabbit anti-AptA antibody was produced against the peptides TYFTGISVDWKVNAGLFKA and AGKTADIGRRGRSAVSSVKK. Rabbit anti-phospho Erk1/2, Erk1/2, pMek1/2, Mek1/2, actin and MEK1/2 inhibitor U0126 were purchased from Cell Signaling Technology (Cell Signaling Technology, Danvers, MA). Cytochalasin D was purchased from Sigma. Mouse anti-Vimentin antibody was purchased from Abcam (Abcam, Cambridge, MA). Horseradish peroxidase (HRP) conjugated anti-mouse and anti-rabbit secondary antibodies were purchased from Sigma (Sigma-Aldrich, St Louis, MO). Vimentin inhibitor Withaferin A was purchased from ChromaDex (ChromaDex, Irvine, CA). Non-targeting control siRNA and vimentin siRNAs were purchased from Dharmacon (Dharma on, Lafayette, CO).

A. phagocytophilum ORF cloning into yeast vectors

The A. phagocytophilum ORFs were PCR amplified and cloned first into the entry vector pDONR221, followed by homologous recombination-based cloning (GATEWAY Technology, Invitrogen, CA) into the yeast expression vector pFUS (Lesser and Miller, 2001), a high-copy (2µ) plasmid, to create GFP fusion proteins under the control of the GAL10 promoter. Subsequent to sequence confirmation, the genes were conditionally expressed in yeast (strain Saccharomyces cerevisiae, Leu+, S288C,BY4741 MATa) as N-terminal GFP fusion proteins. Yeast transformations were done using the standard PEG/lithium acetate method. Recombinant yeast strains were maintained in CSM-Leucine containing 2% dextrose in 96 well plates.

Deletion mutant construction

Full length AptA was cloned using the primers ATGGGCAAAAATCCGTTG, and TGCTTTAAAGAGACCCGCG. Deletions were made using Quickchange kit (Stratagene, CA) with the primers: ΔN28 ATGTCTGTAAAGAAAGCTGTCAG and TGCTTTAAAGAGACCCGCG; ΔN60 ATGGTTGCTTTCTCGTGGTATG and TGCTTTAAAGAGACCCGCG; ΔC60 ATGGGCAAAAATCCGTTG and TGCTAAAGAGGTCATACTCATCG.

Yeast growth assays

Solid growth assay: To induce the expression of proteins, the yeast carrying A. phagocytophilum genes were grown overnight in non-inducing selective synthetic medium containing 2% raffinose. Yeast were diluted to OD600= 1 in raffinose medium and serially diluted 10-fold four additional times. 5 µl aliquotes of each of the dilutions were replica plated on to selective medium plate supplemented with either inducing galactose or non-inducing glucose. The plates were incubated at 30°C for 2 days and photographs were taken. Liquid growth assay: In order to perform liquid yeast growth assays, a microscale method of the yeast growth assay was used to monitor the growth of thousands of cultures in parallel (Slagowski et al., 2008). The individual yeast transformants were first grown in non-inducing selective media supplemented with 4% glucose to OD600between 0.3–0.4, and were subsequently induced in media containing 4% galactose. Growth was monitored by readings at an OD600 at 48 h as described before (Slagowski et al., 2008).

Yeast Western blot analysis

Yeast strains expressing GFP-AptA were grown overnight in the presence of 2% raffinose. Next day, cultures were diluted to OD600 = 1.0 in selective media supplemented with 2% raffinose. After 2 hours, protein induction was done by the addition of galactose (4%) and following 4 h induction, yeast (same OD) were subsequently resuspended in breaking buffer (0.2M NaCl, 0.025M Tris, 0.001M EDTA, 1.2 mM sodium orthovandate, 10mM sodium flouride) with protease inhibitors and lysed by heating/vortexing in the presence of glass beads. Samples were analysed by SDS-PAGE and subjected to western blot analysis.

Membrane isolation from yeast

The yeast plamsa membrane was purified as described before (Rieder and Emr, 2001). Briefly, yeast cells were disrupted with glass beads, crude plasma membrane fraction was pelleted by ultracentrifugation (22,000 × g), and finally plasma membrane was separated and purified on discontinuous sucrose gradients.

Yeast β-galactosidase assay

Yeast cells expressing AptA-GFP or GFP control along with the RLM-1 regulated LacZ reporter plasmid (p1434) (Levin, 2005) were grown in 2% raffinose overnight. In the morning, cells were diluted to OD of 1.0 and allowed to grow for another 2 hours before 2% galactose was added as an inducer. β-galactosidase assay was performed at 0, 2 and 4 h following induction as described (Pryciak and Hartwell, 1996).

Mammalian cell transfection

HEK293 and RF/6A cells were transiently transfected with the respective plasmids using Fugene6 transfection reagent (Roche Diagnostics, IN) or Xfect (Clontech, CA) respectively, according to manufacturer’s protocols. HL-60 cells were electroporated using Amaxa Nucleofection technology (Lonza, Rockland, USA) according to manufacturer’s guidelines. Briefly, exponentially growing HL-60 cells were suspended in prewarmed Nucleofector solution kit V containing 200nM vimentin siRNA (Dharmacon siGENOME SMARTpool, cat#M003551-02), or four different siRNAs targeting unique regions of vimentin (Dharmacon siGENOME set of 4, cat#D-003551-01, 02, 03 and 05) or non targeting siRNA control (Dharmacon, Lafayette, CO) or 1 µg of plasmid constructs in an electroporation cuvette and nucleofection was carried out using the T-019 program. Following electroporation, cells were immediately transferred into prewarmed media and cultured for another 48 hours. For infection of siRNA treated cells, 48 h after transfection, cells were infected with purified A. phagocytophilum (HZ-mCherry, MOI of 50) and samples were collected 48 hour post infection. For the FACS analysis, mCherry fluorescence (emission at 610 nm) was detected by a 532 nm laser on a BD LSRII-Green flow cytometer. A total of 100,000 events were recorded per sample.

BrDU proliferation assay

Mammalian cell proliferation was monitored by 5’-bromo-2’-deoxyuridine (BrDU)-incorporation into cellular DNA using the BrDU proliferation assay (Calbiochem, San Diego, CA). HEK293 cells expressing AptA-GFP and control GFP were grown in the presence of BrDU for 48 h. Cells were labeled with BrDU according to manufacturer’s protocol and BrDU incorporation was detected by measuring the absorbance at 540 nm.

Immunoflourescence and confocal microscopy

RF/6A cells were grown in eight-well chamber slides. Following transfection with GFP-AptA or control GFP for 24 hours, the cells were infected with host-cell free A. phagocytophilum (HZ-mCherry) for the respective time points. Anaplasma infected RF/6A cells, HL-60 cells or human neutrophils were washed in PBS and fixed in 2% paraformaldehyde at room temperature for 15 min. Cells were then incubated with anti-AptA antibody and/or anti vimentin antibody in PBS with 1% BSA for 1 h at room temperature. After washing with PBS, cells were labeled with fluorescent dye conjugated secondary antibodies (Molecular Probes, CA) for 30 min. Cells were then washed, and fluorescence images were analyzed at 60X magnification using fluorescence microscope (Carl Zeiss, Göttingen, Germany).

Immunoelectron microscopy

Samples were fixed in 4% paraformaldehyde/0.1% gluteraldehyde in 0.1 M sodium cacodylate buffer for 1 hour. Samples were rinsed in 0.1M sodium cacodylate buffer and re-suspended in 10% gelatin, chilled and trimmed to smaller blocks and placed in cryoprotectant of 2.3M sucrose overnight on a rotor at 4°C. They were transferred to aluminum pins and frozen rapidly in liquid nitrogen. The frozen block was trimmed on a Leica Cryo-EMUC6UltraCut and 65nm thick sections were collected using the method described earlier (Tokuyasu, 1973) and placed on a grid and floated in a dish of PBS for immunolabeling. Grids were placed section side down on drops of 0.1M ammonium chloride to quench untreated aldehyde groups, then blocked for nonspecific binding on 1% fish skin gelatin in PBS for 20 mins. Single labeled Grids were incubated on a primary antibody rabbit anti-ApTA antibody (1:15) for 30 min, rinsed and incubated on 10 nm (PAG) protein A gold (UtrectUMC) for 30 minutes. Double labeled grids used the primary rabbit anti-APTA (1:15) and 10 nm PAG and primary mouse anti-vimentin (Abcam, Cambridge, MA) 1:20, bridged using rabbit anti-mouse 1:200 (Jackson ImmunoResearch, PA) and at 5nm PAG. All grids were rinsed in PBS, fixed using 1% gluteraldehyde for 5mins, rinsed and transferred to a UA/methylcellulose drop for 10minutes. Images were taken using Morada CCD and iTEM (Olympus) software. Samples were all viewed FEI Tencai Biotwin TEM at 80Kv. Images were taken using Morada CCD and iTEM (Olympus) software.

Mammalian MAPK assay

HL-60 or HEK293 cells were transfected with AptA-GFP and control GFP plasmids and 24 h post transfection, cells were collected, washed in PBS and lysed in RIPA buffer with protease and phosphatase inhibitors. Samples were analyzed by Western blot analysis using specific antibodies (Cell Signaling Technology, MA).

RT-PCR and QRT-PCR analysis

Total RNA was isolated from Anaplasma infected HL-60 cells/human neutrophils/tick salivary glands using RNeasy kit (Qiagen, CA). One microgram of DNase treated total RNA was used to synthesize first strand cDNA using the iScript cDNA synthesis kit (Bio-rad, CA). To analyze the expression levels of AptA in Anaplasma-infected HL-60 cells and tick salivary glands, RT-PCR was done using AptA specific primers (AptA-F: ATGGGCAAAAATCCGTTG, and AptA-R: TGCTTTAAAGAGACCCGCG) and A. phagocytophilum 16S rRNA specific primers 16SF: GGTGAGTAATGCATAGGAATC, 16SR: GCTCATCTAATAGCGATAAATC. Quantitative PCR analysis of triplicate samples of cDNA was performed with the iCycler real-time detection system (Bio-Rad) using iQ SYBR Green Supermix (Bio-Rad, CA) protocol. The relative expression level of target gene (P44) was quantified by normalization with the expression value of human beta-actin gene as an internal standard. The primer sequences are as described before (Thomas and Fikrig, 2007).

Tandem affinity purification assay

Full length AptA was PCR amplified and cloned into N-terminal TAP plasmid (Stratagene, CA). The plasmid was transfected into HEK293 cells using Fugene6 reagent (Roche Diagnostics, IN) according to manufacturer’s protocol. Briefly, 30 µg DNA was used for transfection per T175 flask. At 24 h post-transfection, cells were washed with PBS and lysed using 1X lysis buffer containing protease inhibitors. All steps were done at 4°C to maintain the protein interactions. The cell lysates were applied to streptavidin resin, incubated at 4°C for 2 h, washed, and bound proteins eluted off. A second purification step was done with calmodulin resin and proteins boiled off into PBS. The eluted proteins were analyzed at the Yale University W.M. Keck Foundation core facility (New haven, CT). The eluate was subjected to trypsin digestion followed by LC/MS-MS for peptide sequencing and identification using Human protein database. Mammalian proteins that were found to bind the vector alone controls were eliminated as non-specific interactors.

Co-immunoprecipitation

GFP -AptA, GFP-AptA-N60, GFP-AptA-C60 and control GFP transfected HEK293 cells were harvested at 24 h post transfection in RIPA buffer (50mM Tris-Cl pH 8.0, 150mM NaCl, 1% IGEPAL CA-630, 0.1% SDS, 0.5% sodium deoxycholate, protease and phsophatase inhibitors). Cell lysates were incubated on ice for 20 min, followed by centrifugation to remove the cell debris. The total cell lysate was incubated with anti-vimentin coated Protein G Dynabeads overnight at 4°C. The bead was then washed in 1ml RIPA buffer five times and finally boiled in protein loading buffer for 5 min and ran on SDS-PAGE for Western blot anlaysis using anti-AptA antibody, and anti-vimentin antibody.

Statistical Analysis

Statistical differences between groups were evaluated using the Student’s unpaired t-test (two-tailed) using Excel. Data were recorded as mean ± SD. P values ≤ 0.05 were considered significant.

Supplementary Material

Supp Figure S1. Supplementary Figure 1.

(A). Growth analysis of selected A. phagocytophilum proteins in yeast. 35 proteins of A. phagocytophilum were expressed in yeast and tested for growth inhibition. The individual yeast transformants were grown in non-inducing (empty bars) or inducing (striped bars) and the growth was measured by measuring OD600 (t=48 h). Results are expressed as mean± SD of six replicates. (B) Western blot showing the expression of AptA-GFP in HEK293 cells using anti-AptA antibody at 24 h post transfection. (C) Transfection efficiency of GFP-AptA and GFP control transfected HEK293 cells measured at 24 h post-transfection. Results are expressed as percentage of total cells that are GFP positive, mean± SD of three replicates.

Supp Figure S2. Supplementary Figure 2.

(A) AptA is localized to the plasma membrane and punctate cytoplasmic spots of mammalian cells. HEK293 cells were transfected with AptA in pC1EGFP vector and the expression analysis was done at 24 h post-transfection.

Supp Figure S3. Supplementary Figure 3.

(A) Immunodetection of AptA on A. phagocytophilum. RF/6A cells infected with mCherry- A. phagocytophilum (red) for 48 h were fixed immunostained using polyclonal antibody against AptA (green). White arrow shows AptA staining on A. phagocytophilum. (B) Immuno-electron microscopic imaging of A. phagocytophilum-infected HL-60 cells with AptA preimmune antibody (I-preimmune) and uninfected HL-60 cells with anti-AptA antibody (UI+ anti-AptA) showed no appreciable background labeling. Bars, 0.2 µm. (C) AptA activates the Erk1/2 MAPK pathway in mammalian cells. Western blot was performed using pErk1/2 antibodies on the lysate from HEK293 cells transfected with GFP-AptA and vector-GFP at 24 h post transfection. Non phosphorylated Erk1/2 was used as the control.

Supp Figure S4. Supplementary Figure 4.

(A) Immuno-electron microscopy showing that AptA and vimentin localizes to regions surrounding the A. phagocytophilum inclusion. (B) shows that the control mouse antibody does not have appreciable background labeling. 5 nm and 10 nm particle size corresponds to vimentin and AptA respectively.

Supp Figure S5. Supplementary Figure 5.

(A) Western blot showing the efficiency of siRNA knockdown in vimentin knock down cells. (B) Silencing of vimentin caused reduction in A. phagocytophilum infection of HL-60 cells, analysed at 48 h determined by FACS analysis. Percent of HL-60 cell population positive for m-cherry fluorescence is displayed. Results are shown as mean ± SD from triplicate samples and is a representative of two independent experiments with similar results. p<0.05 (unpaired two-tailed test). (C) Determination of on-target specificity of vimentin siRNA using 4 different siRNAs targeting vimentin by qRT-PCR. The levels of A. phagocytophilum were normalized with the values corresponding to beta-actin. The results are expressed by normalization with non-targeting siRNA treated control sample values, mean ± SD from triplicate experiments is shown.

Acknowledgements

We thank Dr Munderloh and Michael Herron, University of Minnesota for providing us with fluorescently labeled A. phagocytophilum, Yasuko Rikihisa (Ohio State University) for providing the HZ strain of A. phagocytophilum. This work was supported by grants from NIH to EF (R01 AI41440), CFL (R01 AI064285) and BS (R03 AI080993-01A1).

References

  1. Aleman A, Fernandez-Pinar P, Perez-Nunez D, Rotger R, Martin H, Molina M. A yeast-based genetic screen for identification of pathogenic Salmonella proteins. FEMS Microbiol Lett. 2009;296:167–177. doi: 10.1111/j.1574-6968.2009.01630.x. [DOI] [PubMed] [Google Scholar]
  2. Azad AF, Radulovic S. Pathogenic rickettsiae as bioterrorism agents. Ann N Y Acad Sci. 2003;990:734–738. doi: 10.1111/j.1749-6632.2003.tb07452.x. [DOI] [PubMed] [Google Scholar]
  3. Bakken JS, Dumler JS. Human granulocytic ehrlichiosis. Clin Infect Dis. 2000;31:554–560. doi: 10.1086/313948. [DOI] [PubMed] [Google Scholar]
  4. Bakken JS, Krueth J, Wilson-Nordskog C, Tilden RL, Asanovich K, Dumler JS. Clinical and laboratory characteristics of human granulocytic ehrlichiosis. JAMA. 1996;275:199–205. [PubMed] [Google Scholar]
  5. Banerjee R, Anguita J, Roos D, Fikrig E. Cutting edge: infection by the agent of human granulocytic ehrlichiosis prevents the respiratory burst by down-regulating gp91phox. J Immunol. 2000;164:3946–3949. doi: 10.4049/jimmunol.164.8.3946. [DOI] [PubMed] [Google Scholar]
  6. Bargagna-Mohan P, Hamza A, Kim YE, Khuan Abby Ho Y, Mor-Vaknin N, Wendschlag N, et al. The tumor inhibitor and antiangiogenic agent withaferin A targets the intermediate filament protein vimentin. Chem Biol. 2007;14:623–634. doi: 10.1016/j.chembiol.2007.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bayard-Mc Neeley M, Bansal A, Chowdhury I, Girao G, Small CB, Seiter K, et al. In vivo and in vitro studies on Anaplasma phagocytophilum infection of the myeloid cells of a patient with chronic myelogenous leukaemia and human granulocytic ehrlichiosis. J Clin Pathol. 2004;57:499–503. doi: 10.1136/jcp.2003.011775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Borjesson DL, Kobayashi SD, Whitney AR, Voyich JM, Argue CM, Deleo FR. Insights into pathogen immune evasion mechanisms: Anaplasma phagocytophilum fails to induce an apoptosis differentiation program in human neutrophils. J Immunol. 2005;174:6364–6372. doi: 10.4049/jimmunol.174.10.6364. [DOI] [PubMed] [Google Scholar]
  9. Campodonico EM, Chesnel L, Roy CR. A yeast genetic system for the identification and characterization of substrate proteins transferred into host cells by the Legionella pneumophila Dot/Icm system. Mol Microbiol. 2005;56:918–933. doi: 10.1111/j.1365-2958.2005.04595.x. [DOI] [PubMed] [Google Scholar]
  10. Carlyon JA, Fikrig E. Mechanisms of evasion of neutrophil killing by Anaplasma phagocytophilum. Curr Opin Hematol. 2006;13:28–33. doi: 10.1097/01.moh.0000190109.00532.56. [DOI] [PubMed] [Google Scholar]
  11. Carlyon JA, Chan WT, Galan J, Roos D, Fikrig E. Repression of rac2 mRNA expression by Anaplasma phagocytophila is essential to the inhibition of superoxide production and bacterial proliferation. J Immunol. 2002;169:7009–7018. doi: 10.4049/jimmunol.169.12.7009. [DOI] [PubMed] [Google Scholar]
  12. Carlyon JA, Abdel-Latif D, Pypaert M, Lacy P, Fikrig E. Anaplasma phagocytophilum utilizes multiple host evasion mechanisms to thwart NADPH oxidase-mediated killing during neutrophil infection. Infect Immun. 2004;72:4772–4783. doi: 10.1128/IAI.72.8.4772-4783.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cascales E, Christie PJ. The versatile bacterial type IV secretion systems. Nat Rev Microbiol. 2003;1:137–149. doi: 10.1038/nrmicro753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Chen SM, Dumler JS, Bakken JS, Walker DH. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol. 1994;32:589–595. doi: 10.1128/jcm.32.3.589-595.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Chi F, Jong T, Wang L, Ouyang Y, Wu C, Li W, Huang SH. Vimentin-mediated signaling is required for IbeA+ E. coli K1 invasion of human brain microvascular endothelial cells. Biochem J. 2010;427:79–90. doi: 10.1042/BJ20091097. [DOI] [PubMed] [Google Scholar]
  16. Dumler JS, Bakken JS. Human ehrlichioses: newly recognized infections transmitted by ticks. Annu Rev Med. 1998;49:201–213. doi: 10.1146/annurev.med.49.1.201. [DOI] [PubMed] [Google Scholar]
  17. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001;51:2145–2165. doi: 10.1099/00207713-51-6-2145. [DOI] [PubMed] [Google Scholar]
  18. Dumler JS, Choi KS, Garcia-Garcia JC, Barat NS, Scorpio DG, Garyu JW, et al. Human granulocytic anaplasmosis and Anaplasma phagocytophilum. Emerg Infect Dis. 2005;11:1828–1834. doi: 10.3201/eid1112.050898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Felsheim RF, Herron MJ, Nelson CM, Burkhardt NY, Barbet AF, Kurtti TJ, Munderloh UG. Transformation of Anaplasma phagocytophilum. BMC Biotechnol. 2006;6:42. doi: 10.1186/1472-6750-6-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Garcia-Garcia JC, Barat NC, Trembley SJ, Dumler JS. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum. PLoS Pathog. 2009a;5:e1000488. doi: 10.1371/journal.ppat.1000488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Garcia-Garcia JC, Rennoll-Bankert KE, Pelly S, Milstone AM, Dumler JS. Silencing of host cell CYBB gene expression by the nuclear effector AnkA of the intracellular pathogen Anaplasma phagocytophilum. Infect Immun. 2009b;77:2385–2391. doi: 10.1128/IAI.00023-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ge Y, Yoshiie K, Kuribayashi F, Lin M, Rikihisa Y. Anaplasma phagocytophilum inhibits human neutrophil apoptosis via upregulation of bfl-1, maintenance of mitochondrial membrane potential and prevention of caspase 3 activation. Cell Microbiol. 2005;7:29–38. doi: 10.1111/j.1462-5822.2004.00427.x. [DOI] [PubMed] [Google Scholar]
  23. Gustin MC, Albertyn J, Alexander M, Davenport K. MAP kinase pathways in the yeast Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 1998;62:1264–1300. doi: 10.1128/mmbr.62.4.1264-1300.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Halonen SK, Weidner E. Overcoating of Toxoplasma parasitophorous vacuoles with host cell vimentin type intermediate filaments. J Eukaryot Microbiol. 1994;41:65–71. doi: 10.1111/j.1550-7408.1994.tb05936.x. [DOI] [PubMed] [Google Scholar]
  25. Herron MJ, Ericson ME, Kurtti TJ, Munderloh UG. The interactions of Anaplasma phagocytophilum, endothelial cells, and human neutrophils. Ann N Y Acad Sci. 2005;1063:374–382. doi: 10.1196/annals.1355.090. [DOI] [PubMed] [Google Scholar]
  26. Hotopp JC, Lin M, Madupu R, Crabtree J, Angiuoli SV, Eisen JA, et al. Comparative genomics of emerging human ehrlichiosis agents. PLoS Genet. 2006;2:e21. doi: 10.1371/journal.pgen.0020021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Huang B, Hubber A, McDonough JA, Roy CR, Scidmore MA, Carlyon JA. The Anaplasma phagocytophilum-occupied vacuole selectively recruits Rab-GTPases that are predominantly associated with recycling endosomes. Cell Microbiol. 2010a doi: 10.1111/j.1462-5822.2010.01468.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Huang B, Troese MJ, Ye S, Sims JT, Galloway NL, Borjesson DL, Carlyon JA. Anaplasma phagocytophilum APH_1387 is expressed throughout bacterial intracellular development and localizes to the pathogen-occupied vacuolar membrane. Infect Immun. 2010b;78:1864–1873. doi: 10.1128/IAI.01418-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Huang J, Lesser CF, Lory S. The essential role of the CopN protein in Chlamydia pneumoniae intracellular growth. Nature. 2008;456:112–115. doi: 10.1038/nature07355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ijdo JW, Carlson AC, Kennedy EL. Anaplasma phagocytophilum AnkA is tyrosine-phosphorylated at EPIYA motifs and recruits SHP-1 during early infection. Cell Microbiol. 2007;9:1284–1296. doi: 10.1111/j.1462-5822.2006.00871.x. [DOI] [PubMed] [Google Scholar]
  31. Kramer RW, Slagowski NL, Eze NA, Giddings KS, Morrison MF, Siggers KA, et al. Yeast functional genomic screens lead to identification of a role for a bacterial effector in innate immunity regulation. PLoS Pathog. 2007;3:e21. doi: 10.1371/journal.ppat.0030021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kumar N, Robidoux J, Daniel KW, Guzman G, Floering LM, Collins S. Requirement of vimentin filament assembly for beta3-adrenergic receptor activation of ERK MAP kinase and lipolysis. J Biol Chem. 2007;282:9244–9250. doi: 10.1074/jbc.M605571200. [DOI] [PubMed] [Google Scholar]
  33. Kumar Y, Valdivia RH. Actin and intermediate filaments stabilize the Chlamydia trachomatis vacuole by forming dynamic structural scaffolds. Cell Host Microbe. 2008a;4:159–169. doi: 10.1016/j.chom.2008.05.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kumar Y, Valdivia RH. Reorganization of the host cytoskeleton by the intracellular pathogen Chlamydia trachomatis. Commun Integr Biol. 2008b;1:175–177. doi: 10.4161/cib.1.2.7146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lee HC, Kioi M, Han J, Puri RK, Goodman JL. Anaplasma phagocytophilum-induced gene expression in both human neutrophils and HL-60 cells. Genomics. 2008;92:144–151. doi: 10.1016/j.ygeno.2008.05.005. [DOI] [PubMed] [Google Scholar]
  36. Lesser CF, Miller SI. Expression of microbial virulence proteins in Saccharomyces cerevisiae models mammalian infection. Embo J. 2001;20:1840–1849. doi: 10.1093/emboj/20.8.1840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Levin DE. Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 2005;69:262–291. doi: 10.1128/MMBR.69.2.262-291.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lin M, den Dulk-Ras A, Hooykaas PJ, Rikihisa Y. Anaplasma phagocytophilum AnkA secreted by type IV secretion system is tyrosine phosphorylated by Abl-1 to facilitate infection. Cell Microbiol. 2007;9:2644–2657. doi: 10.1111/j.1462-5822.2007.00985.x. [DOI] [PubMed] [Google Scholar]
  39. Manzano-Roman R, Almazan C, Naranjo V, Blouin EF, Kocan KM, de la Fuente J. Expression of perilipin in human promyelocytic cells in response to Anaplasma phagocytophilum infection results in modified lipid metabolism. J Med Microbiol. 2008;57:159–163. doi: 10.1099/jmm.0.47504-0. [DOI] [PubMed] [Google Scholar]
  40. Murli S, Watson RO, Galan JE. Role of tyrosine kinases and the tyrosine phosphatase SptP in the interaction of Salmonella with host cells. Cell Microbiol. 2001;3:795–810. doi: 10.1046/j.1462-5822.2001.00158.x. [DOI] [PubMed] [Google Scholar]
  41. Nelson CM, Herron MJ, Felsheim RF, Schloeder BR, Grindle SM, Chavez AO, et al. Whole genome transcription profiling of Anaplasma phagocytophilum in human and tick host cells by tiling array analysis. BMC Genomics. 2008;9:364. doi: 10.1186/1471-2164-9-364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ninio S, Celli J, Roy CR. A Legionella pneumophila effector protein encoded in a region of genomic plasticity binds to Dot/Icm-modified vacuoles. PLoS Pathog. 2009;5:e1000278. doi: 10.1371/journal.ppat.1000278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Niu H, Yamaguchi M, Rikihisa Y. Subversion of cellular autophagy by Anaplasma phagocytophilum. Cell Microbiol. 2008;10:593–605. doi: 10.1111/j.1462-5822.2007.01068.x. [DOI] [PubMed] [Google Scholar]
  44. Niu H, Kozjak-Pavlovic V, Rudel T, Rikihisa Y. Anaplasma phagocytophilum Ats-1 is imported into host cell mitochondria and interferes with apoptosis induction. PLoS Pathog. 2010;6:e1000774. doi: 10.1371/journal.ppat.1000774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Park J, Kim KJ, Choi KS, Grab DJ, Dumler JS. Anaplasma phagocytophilum AnkA binds to granulocyte DNA and nuclear proteins. Cell Microbiol. 2004;6:743–751. doi: 10.1111/j.1462-5822.2004.00400.x. [DOI] [PubMed] [Google Scholar]
  46. Perlson E, Michaelevski I, Kowalsman N, Ben-Yaakov K, Shaked M, Seger R, et al. Vimentin binding to phosphorylated Erk sterically hinders enzymatic dephosphorylation of the kinase. J Mol Biol. 2006;364:938–944. doi: 10.1016/j.jmb.2006.09.056. [DOI] [PubMed] [Google Scholar]
  47. Pryciak PM, Hartwell LH. AKR1 encodes a candidate effector of the G beta gamma complex in the Saccharomyces cerevisiae pheromone response pathway and contributes to control of both cell shape and signal transduction. Mol Cell Biol. 1996;16:2614–2626. doi: 10.1128/mcb.16.6.2614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rieder SE, Emr SD. Isolation of subcellular fractions from the yeast Saccharomyces cerevisiae. Curr Protoc Cell Biol. 2001 doi: 10.1002/0471143030.cb0308s08. Chapter 3: Unit 3 8. [DOI] [PubMed] [Google Scholar]
  49. Rockey DD, Scidmore MA, Bannantine JP, Brown WJ. Proteins in the chlamydial inclusion membrane. Microbes Infect. 2002;4:333–340. doi: 10.1016/s1286-4579(02)01546-0. [DOI] [PubMed] [Google Scholar]
  50. Rodriguez-Escudero I, Hardwidge PR, Nombela C, Cid VJ, Finlay BB, Molina M. Enteropathogenic Escherichia coli type III effectors alter cytoskeletal function and signalling in Saccharomyces cerevisiae. Microbiology. 2005;151:2933–2945. doi: 10.1099/mic.0.28072-0. [DOI] [PubMed] [Google Scholar]
  51. Shohdy N, Efe JA, Emr SD, Shuman HA. Pathogen effector protein screening in yeast identifies Legionella factors that interfere with membrane trafficking. Proc Natl Acad Sci U S A. 2005;102:4866–4871. doi: 10.1073/pnas.0501315102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Siggers KA, Lesser CF. The Yeast Saccharomyces cerevisiae: a versatile model system for the identification and characterization of bacterial virulence proteins. Cell Host Microbe. 2008;4:8–15. doi: 10.1016/j.chom.2008.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sisko JL, Spaeth K, Kumar Y, Valdivia RH. Multifunctional analysis of Chlamydia-specific genes in a yeast expression system. Mol Microbiol. 2006;60:51–66. doi: 10.1111/j.1365-2958.2006.05074.x. [DOI] [PubMed] [Google Scholar]
  54. Slagowski NL, Kramer RW, Morrison MF, LaBaer J, Lesser CF. A functional genomic yeast screen to identify pathogenic bacterial proteins. PLoS Pathog. 2008;4:e9. doi: 10.1371/journal.ppat.0040009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Su H, McClarty G, Dong F, Hatch GM, Pan ZK, Zhong G. Activation of Raf/MEK/ERK/cPLA2 signaling pathway is essential for chlamydial acquisition of host glycerophospholipids. J Biol Chem. 2004;279:9409–9416. doi: 10.1074/jbc.M312008200. [DOI] [PubMed] [Google Scholar]
  56. Tang P, Sutherland CL, Gold MR, Finlay BB. Listeria monocytogenes invasion of epithelial cells requires the MEK-1/ERK-2 mitogen-activated protein kinase pathway. Infect Immun. 1998;66:1106–1112. doi: 10.1128/iai.66.3.1106-1112.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Thomas V, Fikrig E. Anaplasma phagocytophilum specifically induces tyrosine phosphorylation of ROCK1 during infection. Cell Microbiol. 2007;9:1730–1737. doi: 10.1111/j.1462-5822.2007.00908.x. [DOI] [PubMed] [Google Scholar]
  58. Thomas V, Samanta S, Wu C, Berliner N, Fikrig E. Anaplasma phagocytophilum modulates gp91phox gene expression through altered interferon regulatory factor 1 and PU.1 levels and binding of CCAAT displacement protein. Infect Immun. 2005;73:208–218. doi: 10.1128/IAI.73.1.208-218.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tokuyasu KT. A technique for ultracryotomy of cell suspensions and tissues. J Cell Biol. 1973;57:551–565. doi: 10.1083/jcb.57.2.551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tripathi R, Singh Naorem S, Dureja C, Haldar S, Mondal AK, Raychaudhuri S. VopF, a type III effector protein from a non-O1, non-O139 Vibrio cholerae strain, demonstrates toxicity in a Saccharomyces cerevisiae model. J Med Microbiol. 2010;59:17–24. doi: 10.1099/jmm.0.012336-0. [DOI] [PubMed] [Google Scholar]
  61. Vergunst AC, van Lier MC, den Dulk-Ras A, Stuve TA, Ouwehand A, Hooykaas PJ. Positive charge is an important feature of the C-terminal transport signal of the VirB/D4-translocated proteins of Agrobacterium. Proc Natl Acad Sci U S A. 2005;102:832–837. doi: 10.1073/pnas.0406241102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Voth DE, Heinzen RA. Sustained activation of Akt and Erk1/2 is required for Coxiella burnetii antiapoptotic activity. Infect Immun. 2009;77:205–213. doi: 10.1128/IAI.01124-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Webster P, Ijdo JW, Chicoine LM, Fikrig E. The agent of Human Granulocytic Ehrlichiosis resides in an endosomal compartment. J Clin Invest. 1998;101:1932–1941. doi: 10.1172/JCI1544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Xiong Q, Lin M, Rikihisa Y. Cholesterol-dependent anaplasma phagocytophilum exploits the low-density lipoprotein uptake pathway. PLoS Pathog. 2009;5:e1000329. doi: 10.1371/journal.ppat.1000329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Yago T, Leppanen A, Carlyon JA, Akkoyunlu M, Karmakar S, Fikrig E, et al. Structurally distinct requirements for binding of P-selectin glycoprotein ligand-1 and sialyl Lewis x to Anaplasma phagocytophilum and P-selectin. J Biol Chem. 2003;278:37987–37997. doi: 10.1074/jbc.M305778200. [DOI] [PubMed] [Google Scholar]
  66. Zhu Y, Wang C, Huang J, Ge Z, Dong Q, Zhong X, et al. The Helicobacter pylori virulence factor CagA promotes Erk1/2-mediated Bad phosphorylation in lymphocytes: a mechanism of CagA-inhibited lymphocyte apoptosis. Cell Microbiol. 2007;9:952–961. doi: 10.1111/j.1462-5822.2006.00843.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Figure S1. Supplementary Figure 1.

(A). Growth analysis of selected A. phagocytophilum proteins in yeast. 35 proteins of A. phagocytophilum were expressed in yeast and tested for growth inhibition. The individual yeast transformants were grown in non-inducing (empty bars) or inducing (striped bars) and the growth was measured by measuring OD600 (t=48 h). Results are expressed as mean± SD of six replicates. (B) Western blot showing the expression of AptA-GFP in HEK293 cells using anti-AptA antibody at 24 h post transfection. (C) Transfection efficiency of GFP-AptA and GFP control transfected HEK293 cells measured at 24 h post-transfection. Results are expressed as percentage of total cells that are GFP positive, mean± SD of three replicates.

NIHMS244432-supplement-Supp_Figure_S1.tif (631.8KB, tif)
Supp Figure S2. Supplementary Figure 2.

(A) AptA is localized to the plasma membrane and punctate cytoplasmic spots of mammalian cells. HEK293 cells were transfected with AptA in pC1EGFP vector and the expression analysis was done at 24 h post-transfection.

NIHMS244432-supplement-Supp_Figure_S2.tif (66.7KB, tif)
Supp Figure S3. Supplementary Figure 3.

(A) Immunodetection of AptA on A. phagocytophilum. RF/6A cells infected with mCherry- A. phagocytophilum (red) for 48 h were fixed immunostained using polyclonal antibody against AptA (green). White arrow shows AptA staining on A. phagocytophilum. (B) Immuno-electron microscopic imaging of A. phagocytophilum-infected HL-60 cells with AptA preimmune antibody (I-preimmune) and uninfected HL-60 cells with anti-AptA antibody (UI+ anti-AptA) showed no appreciable background labeling. Bars, 0.2 µm. (C) AptA activates the Erk1/2 MAPK pathway in mammalian cells. Western blot was performed using pErk1/2 antibodies on the lysate from HEK293 cells transfected with GFP-AptA and vector-GFP at 24 h post transfection. Non phosphorylated Erk1/2 was used as the control.

NIHMS244432-supplement-Supp_Figure_S3.tif (420.9KB, tif)
Supp Figure S4. Supplementary Figure 4.

(A) Immuno-electron microscopy showing that AptA and vimentin localizes to regions surrounding the A. phagocytophilum inclusion. (B) shows that the control mouse antibody does not have appreciable background labeling. 5 nm and 10 nm particle size corresponds to vimentin and AptA respectively.

NIHMS244432-supplement-Supp_Figure_S4.tif (1.5MB, tif)
Supp Figure S5. Supplementary Figure 5.

(A) Western blot showing the efficiency of siRNA knockdown in vimentin knock down cells. (B) Silencing of vimentin caused reduction in A. phagocytophilum infection of HL-60 cells, analysed at 48 h determined by FACS analysis. Percent of HL-60 cell population positive for m-cherry fluorescence is displayed. Results are shown as mean ± SD from triplicate samples and is a representative of two independent experiments with similar results. p<0.05 (unpaired two-tailed test). (C) Determination of on-target specificity of vimentin siRNA using 4 different siRNAs targeting vimentin by qRT-PCR. The levels of A. phagocytophilum were normalized with the values corresponding to beta-actin. The results are expressed by normalization with non-targeting siRNA treated control sample values, mean ± SD from triplicate experiments is shown.

NIHMS244432-supplement-Supp_Figure_S5.tif (236.5KB, tif)

RESOURCES