Improved Detection of Bartonella DNA in Mammalian Hosts and Arthropod Vectors by Real-Time PCR Using the NADH Dehydrogenase Gamma Subunit (nuoG)

Abstract

We used a whole-genome scanning technique to identify the NADH dehydrogenase gamma subunit (nuoG) primer set that is sensitive and specific enough to detect a diverse number of Bartonella species in a wide range of environmental samples yet maintains minimal cross-reactivity to mammalian host and arthropod vector organisms.

Bacteria in the genus Bartonella are found in a wide variety of mammalian hosts (2, 8, 18, 20, 21) and are thought to be transmitted by arthropod vectors, including fleas, ticks, and possibly mites (4, 7, 9, 14, 16); humans serve as accidental hosts. Of the at least 20 named Bartonella species, 10 have been shown to cause disease in humans, including Carrion's disease (13), cat scratch disease (7, 14, 25), endocarditis (6, 11), and recently a febrile illness in humans from Thailand (caused by Bartonella tamiae) (17). Because of their wide distribution and potential for frequent contact with humans, many Bartonella species are considered potential emerging pathogens (1, 26, 28).

Bartonella identification requires the ability to detect bacteria in both mammalian hosts and arthropod vectors. Although bacterial culture is considered ideal, the difficulty and time involved make it impractical for large-scale use. Additionally, nucleic acid-based detection techniques may be hindered by inhibitors in environmental and clinical samples, low sensitivity, and the absence of genus-specific primers (10, 27).

To address these issues, we used whole-genome scanning based on the complete genomes of Bartonella bacilliformis, B. henselae, and B. quintana to identify host- and vector-blind primer sets for real-time PCR detection of Bartonella in various field-collected samples. We identified a primer set based on the NADH dehydrogenase gamma subunit (nuoG) that is specific for Bartonella species and sensitive enough to detect Bartonella in both mammalian hosts and arthropod vectors.

Identification of host-blind primer sets.

A whole-genome scan was performed on complete genomic sequences from B. henselae and B. quintana and shotgun sequences from B. bacilliformis available in GenBank. Each subsequence of 16, 17, 18, and 19 nucleotides present in published Bartonella genomes was compared with subsequences from other genomes present in GenBank, including genomes for bacteria that could infect human blood and tissues and potential mammalian hosts and arthropod vectors for bartonellae. The number of base changes necessary to convert each Bartonella subsequence to the closest subsequence in the background collection was calculated to identify potential primers with a reduced probability of hybridizing to and amplifying nontarget DNA.

In total, one ultraspecific, host-blind primer pair (the nuoG primer pair) was identified that met the following conditions: the pair (i) maintained at least a 2-base specificity among the complete GenBank sequence database, (ii) amplified fragments of identical sizes in the B. henselae and B. quintana genomes, (iii) had predicted amplicon sizes of less than 400 bp, and (iv) had primer melting temperatures (T_ms) within 2°C. Although they did not conform to all of these conditions, the ftsZ and gltA primer sets were included in further comparisons due to the large amount of sequence data available for these genes.

Primer pairs were tested in reaction with three Bartonella species (B. henselae, B. quintana, and B. bacilliformis) and then with the use of ∼30-fold excess competitor DNA from J774 (murine) and THP1 (human) tissue culture cells over the template DNA from B. henselae. Interestingly, despite their common use, the gltA primer set demonstrated high cross-reactivity both to potential Bartonella hosts (Rattus spp., Mus spp., and Homo sapiens) and to bacterial species, such as Ehrlichia spp., that could inhabit similar ecological niches (Table 1).

TABLE 1.

Details of primers used in this study^a

Gene and orientation	Nucleotide sequence	Primer Tm	Amplicon size (bp)	Expected amplification result	Other species carrying the gene
gltA				B. henselae, B. quintana	Legionella pneumophila, Erlichia spp.,
F	GGGGACCAGCTCATGGTGG	57.58	340		Alkalilimnicola ehrlichei, Mus
R	AATGCAAAAAGAACAGTAAACA	56.68			musculus, Rattus norvegicus, Homo sapiens
nuoG				B. henselae, B. quintana,	None
F	GGCGTGATTGTTCTCGTTA	55.56	346	B. bacilliformis
R	CACGACCACGGCTATCAAT	56.68
ftsZ				B. henselae, B. quintana	None
F	CGCATAGAAGTATCATCCA	50.72	753
R	ACGATTAATCTGCATCGGC	53.99

^aExpected amplification results and occurrences in other genomes were determined by whole-genome scanning versus B. henselae, B. bacilliformis, and B. quintana. F, forward; R, reverse.

Amplification performance of the nuoG, gltA, and ftsZ primer sets against reference Bartonella DNA and environmental samples.

The nuoG, gltA, and ftsZ primer sets were used to amplify reference DNAs from 11 Bartonella species, chosen for their distant phylogenetic relationships, under conditions optimized for each primer set. The amplification results differed considerably between primer sets and species of Bartonella being amplified (Table 2) and are as follows: the nuoG primer set performed best (amplifying first, with the lowest threshold cycle [C_T] value) on 3 of the 11 tested species, the gltA set performed best on 7 of the 11 species, and the ftsZ set performed best on 1 of the 11 species. Although the gltA primer set performed best for the highest number of reference species, only the nuoG set successfully amplified all 11 species.

TABLE 2.

C_T values for the three primer sets resulting from amplification of 11 reference DNAs derived from culture samples^a

Species	CT
	nuoG1 primer set	gltA primer set	ftsZ72 primer set
Cotton rat sp. A1	26.1	28.6	23.8
Cotton rat sp. C1	17.1	18.6	34.5
Bartonella grahamii	21.2	18.3	21.8
Bartonella phoceensis	25.5	28.2	29.8
B. rattimassiliensis	21.9	21.0	22.0
B. tamiae	37.7	29.9	NA
B. tribocorum	28.3	11.8	19.8
B. vinsonii subsp. arupensis	17.9	15.3	17.7
B. vinsonii subsp. berkhoffii	26.7	14.9	18.9
B. vinsonii subsp. vinsonii	22.4	22.0	21.9
Bartonella washoensis	16.9	NA	19.5

^aValues for those cases with more than 3.3 cycles (1-log starting quantity) are in bold. C_T values higher than 35 are considered not valid (NA), due to the potential influence of primer dimers.

The primer sets were next tested against a panel of DNA from field-collected samples (purified from liver samples from Nepalese rats and ticks from Colombia) to determine their efficacy in detecting Bartonella DNA in field-collected hosts and vectors. Consistent with the predicted specificities from the whole-genome scans, the nuoG primer set demonstrated significantly higher sensitivity and specificity for Bartonella than the other primer sets by consistently yielding more sequence-confirmed PCR-positive results (Table 3). For the 61 total ticks sampled, the nuoG primer set yielded 7 Bartonella-positive samples, compared to 1 and 0 for the ftsZ and gltA sets, respectively. Of 24 total rodent liver samples tested, 18 were found to be Bartonella positive by the nuoG primer set, compared to 10 and 2 for the ftsZ and gltA sets, respectively.

TABLE 3.

Bartonella-positive samples, as verified by sequencing, based on primer set, for field-collected samples

Primer set	No. of Colombian ticks (%) (n = 61)	No. of Nepal rodent livers (%) (n = 24)
gltA set	0 (0)	2 (9)
ftsZ72 set	1 (2)	10 (42)
nuoG set	7 (11)	18 (75)

Phylogenetic analysis.

Analysis of a nuoG-derived phylogeny showed strong statistical support for the following clades: B. henselae and Bartonella koehlerae; the species found in Rattus and related hosts, including Bartonella elizabethae, B. rattimassiliensis, and B. tribocorum; 3 Bartonella vinsonii subspecies (Bartonella vinsonii subsp. arupensis, B. vinsonii subsp. vinsonii, and B. vinsonii subsp. berkhoffii); and two strains of B. tamiae, described to occur in febrile Thai patients (type strain Th239 and strain Th307) (Fig. 1). All of these species groups share high genetic similarity within their respective clades, suggesting that the nuoG primer set provides better phylogenetic estimation with closely related species. Bartonella bovis was placed extremely distant to the other Bartonella species, with strong statistical support; conversely, B. bacilliformis was placed more centrally within the phylogeny than is seen with other genes, though this placement did not have strong statistical support. These placements, which are different from those generated with multiple concatenated Bartonella sequences (Fig. 1) (17), are likely due to the genetic rearrangements and horizontal gene transfer events that commonly occur in Bartonella (3, 12, 19, 23). Because of this, care should be taken when interpreting phylogenies based solely on nuoG sequences. A much more reliable approach is to include the nuoG sequence as one of many concatenated sequences to be used for phylogenetic analysis.

FIG. 1.

Bayesian analysis of the Bartonella phylogeny based on the nuoG gene sequence. The sequences were obtained either from direct sequencing of PCR products or from GenBank. The listed node values represent posterior probabilities; Brucella was used as the outgroup.

In summary, whole-genome scanning has allowed us to identify nuoG as a sensitive and specific target gene for use in detection of Bartonella species from various clinical and environmental specimens. nuoG's superior performance in identifying Bartonella species in field-collected samples makes it an ideal candidate for complementing the use of gltA and ftsZ on culture samples.