Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jan 20.
Published in final edited form as: Virology. 2010 Nov 5;409(2):204–210. doi: 10.1016/j.virol.2010.09.032

Shp2 suppresses PyMT-induced transformation in mouse fibroblasts by inhibiting Stat3 activity

Ying Yang a,*, Beibei Jiang a, Yingqing Huo a, Luca Primo b, Jean S Dahl c, Thomas L Benjamin c, Jincai Luo a,*
PMCID: PMC3008596  NIHMSID: NIHMS244803  PMID: 21056449

Abstract

We have examined the effect of expression of the protein tyrosine phosphatase Shp2 on transformation by the mouse polyoma virus middle T antigen (PyMT). Gain-of-function mutations in Shp2 indicate it may serve as an oncogene in several types of human leukemia. Paradoxically, however, some catalytically dominant negative mutations of Shp2 have also been identified in leukemia and neuroblastomas. In this study, we show that Shp2 suppresses transformation induced by PyMT, the major polyoma viral oncoprotein known to act through binding and activation of pp60c-src. Over-expression of a catalytically inactive Shp2 mutant in NIH3T3 cells significantly enhanced PyMT-induced transformation. Conversely, re-introduction of Shp2 into Shp2-deficient cells strongly inhibited PyMT-induced transformation and tumorigenesis. Short hairpin RNA (shRNA)-mediated Shp2 knockdown potentiated PyMT-induced transformation. Finally, we present evidence that the transformation-suppressive effects of Shp2 are mediated at least partially through the inhibition of signal transducers and activators of transcription 3.

Keywords: polyoma middle T antigen, transformation, Shp2, oncogene, signal transduction, fibrooblasts

Introduction

Shp2, a ubiquitously expressed cytoplasmic protein tyrosine phosphatase (PTP), is essential for the activation of mitogen activated protein kinase (MAPK) by growth factors and cytokines, and favors the promotion of cell proliferation (Neel et al., 2003; Feng, 2007; Dance et al., 2008). Interestingly, Shp2 also negatively regulates several signaling pathways, including the Stat signaling pathway, and inhibits gliogenesis and lymphoid cell activation (Gauthier et al., 2007; Sedy et al., 2005; Feng, 1999). So far, very little is known with regard to any negative role that Shp2 plays in cancer signaling.

Genetic studies have identified somatic gain-of-function mutations in PTPN11, which encodes the Shp2 tyrosine phosphatase, in various types of leukemia with constitutively active phosphatase activity, suggesting that Shp2 is a bona fide oncogene (Chan et al., 2007; Mohi et al., 2007). Interestingly, loss-of-function germline mutations in PTPN11 were also identified in LEOPARD (lentigines, electrocardiogram abnormalities, ocular hypertelorism, pulmonic valvular stenosis, abnormalities of genitalia, retardation of growth, and deafness) syndrome with decreased phosphatase activity, in association with acute myelogenous leukemia and neuroblastoma (Mohi et al., 2007). Mutant Shp2 proteins, which are catalytically defective and dominant–negative, inhibit growth factor-evoked Erk activation (Kontaridis et al., 2006). Shp2 has also been shown to inhibit transformation of a human brain tumor cell line (Jazayeri et al., 2000). These observations contradict an oncogenic role of Shp2, indicating that the functions of Shp2 in tumorigenesis in some types of cancer may be complicated. At present, no clear-cut mechanistic explanation has been found to explain these paradoxical characteristic of Shp2 mutations (Edouard et al., 2007).

To examine the role of Shp2 in a well characterized experimental system we turned to the mouse polyoma virus middle T antigen (PyMT). PyMT is able to transform established rodent fibroblasts to a fully transformed, tumorigenic phenotype in a dosage-dependent fashion (Ichaso et al., 2001; Dilworth et al., 2002; Raptis et al., 1985). PyMT is a cytoplasmically facing membrane bound protein which interacts with pp60c-src and other members of the src family of non-receptor tyrosine kinases. pp60c-src is activated in complexes with PyMT, resulting in phosphorylation of PyMT at three distinct sites. This leads to activation of multiple signal transduction pathways (Fluck et al., 2009; Schaffhausen et al., 2009; Cheng et al., 2009). The serine/threonine phosphatase PP2A binds to both the middle and small T antigens and is needed for formation of PyMT-Src complexes (Brewster et al., 1997; Campbell et al., 1995). PP2A can serve this function even in a catalytically inactive form (Ogris et al., 1999). Tyrosine substitution mutants of PyMT blocked in specific pathways have been used to study events at the molecular level that are essential for cell transformation in vitro and tumor induction in the mouse. The action of Shp2, or other PTP, in this system may be envisaged to act at multiple levels with potentially opposite effects on transformation. Dephosphorylation of tyrosine-527, the autoregulatory site in pp60c-src, would be expected to activate kinase activity toward exogenous substrates, including PyMT. Dephosphorylation of tyrosine-419 on the other hand may block activation (Roskoski, 2005). Dephosphorylation of PyMT at any of the three tyrosines phosphorylated by pp60c-src is expected to be inhibitory, in a maner dependent on cell type. The evidence is based on tumor studies in mice with middle T mutants showing that blocking specific signaling pathways results in changes in tissue-specificity as well as frequency in the tumor profile (Bronson et al., 1997; Talmage et al., 1989).

To investigate the role of Shp2 in transfomation, we utilized PyMT as a model oncogene and found that Shp2 suppressed transformation of established fibroblasts by PyMT. The inhibitory effect of Shp2 was mediated at least in part through Stat3.

Results

A catalytically inactive Shp2 mutant enhanced PyMT-induced transformation

To assess the role of Shp2 in transformation, we first examined the effect of over-expression of Shp2 C/S mutant, a catalytically defective Shp2 mutant that dominant-negatively inhibits the activity of endogenous Shp2 (Zhang et al., 2004), on cellular transformation induced by PyMT (Fig. 1A). Focus formation assays were used to measure transformation. PyMT-transformed cells that over-express the dominant negative form of Shp2 formed more and larger foci than those, which over-expressed the wild-type Shp2 or the vector alone (Fig. 1B). Compared to the cells over-expressing wild type Shp2 or empty vector, the PyMT-transformed cells over-expressing the Shp2 mutant became more refringent, with an elongated, spindle shape (not shown). These observations suggested that the inhibition of Shp2 enhanced transformation induced by PyMT.

Figure 1.

Figure 1

Overexpression of a dominant negative Shp2 mutant enhanced PyMT-induced transformation. (A) PyMT induced transformation in 3T3 cells transduced with empty vector (3T3/Vector) or PyMT (3T3.PyMT) as indicated. Top panel: Western blot of PyMT with tubulin as a loading control. Middle panel: Focus formation assay of cells as indicated. Bottom panel: Quantitative results of focus formation using NIH Image J software. Values represent relative color density. Data shown are representative of three independent experiments. (B) Overexpression of dominant-negative Shp2 mutant increased transformation in PyMT-transformed 3T3 cells. Top panel: Western blot of Shp2. PyMT-3T3 cells transduced with empty vector (Vector), wild type Shp2 (Shp2 WT), or Shp2 C/S mutant (Shp2 C/S). Middle panel: Focus formation assays of the cells as indicated. Bottom panel: Quantitative result of focus formation assays.

Re-introduction of Shp2 in Shp2-deficient cells strongly inhibited PyMT-induced transformation both in vitro and in vivo

To directly determine the role of Shp2 in PyMT-induced transformation, we compared the ability of PyMT to transform Shp2-deficient B1 cells, which were derived from Shp2 knockout mice, or Shp2-rescued B1R cells (Oh et al., 1999) (Fig. 2A). Western blot analysis suggested that the expression of exogenous Shp2 is comparable to that of endogenous level in wild type fibroblast cells (Fig. 2B). Foci were fewer and smaller in PyMT-transformed B1R cells than in PyMT-transformed B1 cells. These observations indicate that re-introduction of Shp2 expression in Shp2-deficient cells inhibited PyMT-induced transformation. Importantly, PyMT-transformed B1R cells developed tumors more slowly than PyMT-transformed B1 cells (Fig. 2C), strongly suggesting that Shp2 plays a negative role in PyMT-induced tumorigenesis in vivo. Interestingly, histological staining suggested that the tumor derived from PyMT-transformed B1R cells displayed different cellular morphology from that from PyMT-transformed B1 cells while both of them appeared to be fibrosarcoma.

Figure 2.

Figure 2

Restoring Shp2 expression in Shp2-deficient cells inhibited PyMT-induced transformation in vitro and in vivo. Shp2-rescued B1R cells were established by restoring Shp2 expression in Shp2-deficient B1cells. (A) PyMT induced transformation in B1 or B1R cells transduced with empty vector (B1/Vector or B1R/Vector) or PyMT (B1/PyMT or B1R/PyMT) as indicated. Top panel: Western blot of PyMT or Shp2. Middle panel: Focus formation assays of cells as indicated. Bottom panel: Quantitative results of focus formation. (B) The expression of exogenous Shp2 in B1R cell is comparable to that of endogenous level in wild type fibroblast cells. Western blot analysis was performed using the antibodies as indicated in A. (C) PyMT-induced transformation in vivo is inhibited in Shp2-rescued B1R cells. Top panel: Tumor formation in the mice subcutaneously inoculated with cells as indicated. Pictures were taken three weeks after cell inoculation. Please note that a small pulp corresponding to B1/Vector is granulation tissue that was identified by histological staining (data not shown). Middle panel: Quantitative result of the tumor size (n= ±SD). Bottom panel: Histological H&E staining of the dissected tumors.

Downregulation of Shp2 expression by the shRNA also promoted PyMT-induced transformation

To exclude the possibility that long term culture changed the transformation activity of Shp2-deficient cells, Shp2 shRNA was utilized to determine the effect of down-regulating Shp2 on PyMT-induced transformation in NIH3T3 cells. Western blot analysis showed that Shp2 protein expression was significantly down-regulated by Shp2 shRNA even at 10 days after shRNA introduction (Fig. 3A). In accordance with the results obtained in Shp2-deficient cells, Shp2 shRNA knockdown enhanced PyMT-induced transformation compared to scrambled shRNA (Fig. 3B).

Figure 3.

Figure 3

Shp2 knockdown enhanced PyMT-induced transformation. PyMT-transformed 3T3 cells were transduced with scrambled shRNA or Shp2 shRNA for 6 and 10 days. (A) The knockdown efficiency of Shp2 shRNA. Left panel: Western blot of Shp2 and ERK2 as a loading control. Right panel: Quantitative result of the Western blots using NIH Image J software. The value for each band represents relative band density normalized to the loading control. Data shown are representative of three independent experiments. (B) Right panel: Focus formation assays. Left panel: Quantitative result.

Enhanced activation of Stat3 partially accounts for increased transformation activity in PyMT-induced transformation in a Shp2-deficient cell line

To understand the mechanism underlying the negative role of Shp2 in transformation by PyMT, we first investigated the activation status of Erk and Akt kinases, previously shown to be regulated by Shp2 (Zhang et al., 2002; Neel et al., 2003), in PyMT-transformed cells in response to EGF stimulation. As expected, the EGF-induced phosphorylation level of Erk kinase was lower in PyMT-transformed B1 cells than in transformed B1R cells (Fig. 4A). PyMT expression induced a constitutive activation of Akt (Dahl, et al., 1998), with an equal or slightly higher level in B1R cells than B1 cells. Because Shp2 has been shown to manipulate the activation of Stat proteins (Feng, 1999), we then compared the phosphorylation level of Stat3, which is an important regulator in fibroblast transformation (Kalakonda et al., 2007), in PyMT-transformed B1 and B1R cells. Interestingly, Stat3 phosphorylation was up-regulated in transformed B1 cells compared to transformed B1R cells, in both the presence and absence of EGF (Fig. 4A). Shp2 shRNA knockdown also led to similar results in PyMT-transformed 3T3 cells (Fig. 4B). To confirm the importance of Stat3 in this transformation, we studied the effect of the Stat3 shRNA knockdown. Down-regulation of Stat3 suppressed the PyMT-induced transformation, bringing it to a similar level in PyMT-transformed B1 and B1R cells (Fig. 4D).

Figure 4.

Figure 4

Stat3 partially mediates the effect of Shp2 on PyMT-induced transformation. (A) The phosphorylation level of Stat3 was increased in Shp2-deficient cells. The empty vector- or PyMT-transduced B1 or B1R cells were serum-starved overnight and then stimulated with EGF (100 ng/ml), followed by Western blotting with the antibodies as indicated. Arrow heads indicate quantitative results of phospho-Stat3. (B) Shp2 knockdown enhanced the phosphorylation of Stat3 in PyMT-expressing 3T3 cells. Western blots were performed on 3T3 cells transduced with Shp2 shRNA 6 and 10 days after infection. (C, D) Stat3 knockdown suppressed PyMT-induced transformation. PyMT-transduced B1 or B1R cells were transduced with Scrambled or Stat3 shRNA lentiviruses, followed by Western blotting (C) or focus formation assay (D). The left panel in (D) is a quantitative result of the focus formation.

Discussion

Studies of PyMT have contributed significantly to our understanding of the roles of intracellular signaling pathways involvng tyrosine phosphorylation in cell transformation and tumor induction in the mouse (Fluck et al., 2009; Schaffhausen et al., 2009; Cheng et al., 2009). Here we have shown that the protein tyrosine phosphatase Shp2 inhibits PyMT-induced transformation. PyMT is among several oncogenes associated with increased Stat3 activity (Garcia et al., 1997). Evidence presented here indicates that the effect of Shp2 on transformation is mediated in part through inhibition of Stat3 pathway(s). These conclusions are based on the following experimental observations: 1) a catalytically inactive Shp2 mutant enhanced PyMT-induced transformation; 2) the reintroduction of Shp2 into Shp2-deficient cells (Fig. 2) inhibited PyMT-induced transformation in vitro and tumorigenesis; and 3) down regulation of Shp2 expression by the shRNA promoted PyMT-induced transformation. The effects of Shp2 on transformation are not likely due to the changes in PyMT expression level (Figs. 2 and 3) or its activity (Fig. 4) caused by Shp2 gene manipulation. Instead, deficiency of Shp2 led to an increase of Stat3 activation in PyMT-transformed cells and Stat3 knockdown inhibited transformation. Although Shp2 has been reported to negatively regulate cytokine-triggered Stat pathway in lymphoid cells and astrocytes (Gauthier et al., 2007; Sedy et al., 2005; Feng, 1999), this is the first report that negative regulation of a Stat pathway by Shp2 is involved in the inhibition of transformation. It is worthy of note that the expression level of Shp2 does not significantly affect the anchorage-independent growth, another transformation ability of PyMT, of PyMT-transformed cells (data not shown) although it does affect the tumorigenesis of PyMT-transformed cells in vivo (Fig. 2).

Other substrates and pathways may also be involved in Shp2-mediated inhibition of transformation. Shp2 could affect acitvation of Src itself by dephosphorylating the regulatory sites at Y527 and Y419. It has been suggested that PyMT may interact with Shp2 (Ong et al., 2001; Fluck et al., 2009; Schaffhausen et al., 2009; Cheng et al., 2009). Dephosphorylation of PyMT by Shp2 at any of the three tyrosines phosphorylated by Src would be expected to have differential affects on cell transformation and tumor induction, depending on the target cell.

The inhibitory effects of Shp2 on transformation of established fibroblasts may not be predictive of its effects on oncogenic transformation in vivo, as indicated by results with the polyoma virus middle T mutant 250YS. Substitution of Y250, or mutations of residues immediately upstream, strongly inhibits transformation of established rodent fibroblasts (Druker et al., 1992; Dahl et al., 1996; Dilworth et al., 1994) and endothelial cells (Ong et al., 2001). Phosphorylation at this site promotes binding of ShcA and may also recruit Shp2 through interaction with adaptors Grb2-Gab1. Surprisingly, the non-transforming 250YS mutant virus is highly tumorigenic in the mouse (Bronson et al., 1997). This mutant induces tumors broadly but with differences from the wild type virus in terms of the spectrum, frequencies and biological behavior of specific tumor types. Tumor formation is more pronounced at some sites and less pronounced at others compared to the spectrum induced by the wild type virus. Paradoxically, though unable to transform fibroblasts in culture, the mutant induces subcutaneous fibrosarcomas more effeciently than the wild type virus. Clearly, the operation of particular pathways leads to different outcomes in tumor development depending on the cell type and tissue context. Further studies on signaling pathways downstream of Y250 in PyMT and identification of Shp2 substrate(s) will be required to fully define the mechanism(s) of Shp2 signaling in transformation. Further investigations will also be needed to determine whether Shp2 plays a negative or positive role in the development of particular human tumors.

Materials and methods

Reagents and antibodies

Dulbecco’s modified Eagle’s medium (DMEM) was purchased from Invitrogen (Carlsbad, CA); fetal calf serum (FCS) was purchased from Hyclone (Logan, UT). Transfection reagent Fugene 6 was from Roche Applied Science (Herndon, VA). The antibodies against phospho-Stat3, phospho-Akt and phospho-MAPK for Western blotting were purchased from Cell Signaling Technology (Beverly, MA). The antibodies against Shp2, Stat3, Akt and Erk2 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), except for the F4 mouse monoclonal antibody against PyMT (Pallas et al., 1986).

Cell lines and plasmids

Mouse embryo fibroblast cell line, NIH3T3, was cultured in DMEM containing 10% FCS in a 5% CO2-humidified atmosphere at 37°C. B1 cell line, Shp2-deficient embryo fibroblast, was derived from Shp2Δ46-110 (Shp2-/-) mice; B1R cell line was from the B1 cell line rescued by reintroduction of wild-type Shp2 gene (Zhang et al., 2002). To establish PyMT-expressing stable cell lines, NIH3T3, B1 and B1R cells were infected by retrovirus-containing supernatant from 293T cell lines, which were co-transfected with the plasmids of retroviral pPinco/PyMT or empty pPinco vector and the packaging plasmids as described before (Yu et al., 2006). Infected cells were selected in the presence of 1.1 μg/ml of puromycin (Sigma; St Louis, MO) for 1 week. The same approach was used to express exogenously wild type Shp2 (Shp2 WT) or the dominant negative Shp2 C/S mutants (Shp2 C/S) in NIH3T3 cells.

Construction and transient expression of small hairpin RNAs (shRNAs) of Shp2 and Stat3 in fibroblasts

Sequences for targeting genes and the scrambled control were selected according to an open program (http://jura.wi.mit.edu/bioc/siRNAext/). The shRNA sequence of Shp2 is 5’- GGACATGAATATACCAATATT -3’; the shRNA sequence of Stat3 is GTCAGGTTGCTGGTCAAATTT-3’; and the control scrambled sequence is 5’-CCTAAGGTTAAGTCGCCCTCG-3’. Sense and antisense oligonucleotides were synthesized, annealed, and inserted into a lentiviral vector pLKO1 (Sigma). The nucleotide sequences of the inserts were confirmed by sequencing analysis. Preparation of lenti viruses and infection of PyMT-transformed 3T3 cells were carried out as described (Durocher et al., 2002). The plasmids of shRNA or control vectors were transfected into 293T cells to produce lenti virus by using a PEI transfection method (Xiong et al., 2009).

Western blot assay

Cells were lysed in 1% Nonidet P-40 (Calbiochem, San Diego, CA) buffer containing 150mM NaCl, 50mM Tris-HCl,pH 7.4, 5 mM EDTA, 1% Nonidet P-40, 1 mM NaVO3, 20 mM NaF, 1mM benzamidine, 1mM phenylmethylsulfonyl fluoride, 1μg/ml of pepstatin A, 5μg/ml of aprotinin, and 5μg/ml of leupeptin on ice. Cell lysates were clarified by centrifugation at 15,000 rpm at 4°C for 20 min. The protein concentration was determined using the BCA™ protein assay kit according to the manufacturer’s instructions (Pierce, Rockford, IL). Lysates were subjected to SDS-PAGE electrophoresis, followed by Western blot analysis using a standard protocol (Luo et al., 1998).

Focus formation assay

Focus formation assays were performed as describe previously with minor modifications (Ischenko et al., 2003). Briefly, 5×103 cells stably expressing PyMT were plated on 6 cm dishes together with 5×104 parental NIH3T3 cells. The cells were grown in DMEM supplemented with 5% FCS, 100 μg/mL of streptomycin, and 100 units/mL of penicillin for 10 days and the medium was changed every three days. Plates were washed with PBS and fixed in ice-cold methanol for 10 minutes. Foci were stained with crystal violet (Sigma), photographed and counted under a low-power microscope. Quantitative analysis of focus formation was carried out using NIH Image J software.

Nude mouse tumor xenograft model

A total of 1×107 cells (in 100 μL of PBS) expressing PyMT or empty vector were inoculated subcutaneously in BALB/c nude mice (n=4). The tumor size was measured from day three after cell inoculation. Mice were sacrificed three weeks after inoculation. The volume and weight of the tumors was measured and compared. Dissected tumor tissue was fixed in formalin, embedded in paraffin, stained with hematoxylin and eosin (H&E) using standard techniques.

Statistical analyses

Group differences were analyzed by a standard Student T test. All values are expressed as mean±SD. Statistical significance was set at a P-value less than 0.05 (*) or 0.01 (**).

Acknowledgments

We thank Dr. Benjamin G Neel (Ontario Cancer Institute, Toronto, Canada) for generously providing the Shp2 plasmids, B1 and B1R cells. We also thank Changjun He and Chao Chen for their excellent technical support. YY is funded by the National Science Funds (30700392). JC is funded by the National Science Funds (Nos. 30671030, 90607004). The work has also been supported by grant RO1 CA-092520 to TB from the National Cancer Institute.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Brewster CE, Glover HR, Dilworth SM. pp60c–src binding to polyomavirus middle T-antigen (MT) requires residues 185 to 210 of the MT sequence. J Virol. 1997;71:5512–5520. doi: 10.1128/jvi.71.7.5512-5520.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bronson R, Dawe C, Carroll J, Benjamin T. Tumor induction by a transformation-defective polyoma virus mutant blocked in signaling through Shc. Proc Natl Acad Sci U S A. 1997;94:7954–7958. doi: 10.1073/pnas.94.15.7954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Campbell KS, Auger KR, Hemmings BA, Roberts TM, Pallas DC. Identification of regions in polyomavirus middle T and small t antigens important for association with protein phosphatase 2A. J Virol. 1995;69:3721–3728. doi: 10.1128/jvi.69.6.3721-3728.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chan RJ, Feng GS. PTPN11 is the first identified proto-oncogene that encodes a tyrosine phosphatase. Blood. 2007;109:862–867. doi: 10.1182/blood-2006-07-028829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cheng J, DeCaprio JA, Fluck MM, Schaffhausen BS. Cellular transformation by Simian Virus 40 and Murine Polyoma Virus T antigens. Semin Cancer Biol. 2009;19:218–228. doi: 10.1016/j.semcancer.2009.03.002. Review. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dahl J, Freund R, Blenis J, Benjamin TL. Studies of partially transforming polyomavirus mutants establish a role for phosphatidylinositol 3-kinase in activation of pp70 S6 kinase. Mol Cell Biol. 1996;16:2728–2735. doi: 10.1128/mcb.16.6.2728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dahl J, Jurczak A, Cheng LA, Baker DC, Benjamin TL. Evidence of a role for phosphatidylinositol 3-kinase activation in the blocking of apoptosis by polyomavirus middle T antigen. J Virol. 1998;72:3221–3226. doi: 10.1128/jvi.72.4.3221-3226.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dance M, Montagner A, Salles JP, Yart A, Raynal P. The molecular functions of Shp2 in the Ras/Mitogen-activated protein kinase (ERK1/2) pathway. Cell Signal. 2008;20:453–459. doi: 10.1016/j.cellsig.2007.10.002. [DOI] [PubMed] [Google Scholar]
  9. Dilworth SM, Brewster CEP, Jones MD, Lanfrancone L, Pelicci G, Pelicci PG. Transformation by polyoma virus middle T-antigen involves the binding and tyrosine phosphorylation of Shc. Nature. 1994;367:87–90. doi: 10.1038/367087a0. [DOI] [PubMed] [Google Scholar]
  10. Dilworth SM. Polyoma virus middle T antigen and its role in identifying cancer-related molecules. Nat Rev Cancer. 2002;2:951–956. doi: 10.1038/nrc946. [DOI] [PubMed] [Google Scholar]
  11. Druker BJ, Sibert L, Roberts TM. Polyomavirus middle T-antigen NPTY mutants. J Virol. 1992;66:5770–5776. doi: 10.1128/jvi.66.10.5770-5776.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Durocher Y, Perret S, Kamen A. High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res. 2002;30:E9. doi: 10.1093/nar/30.2.e9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Edouard T, Montagner A, Dance M, Conte F, Yart A, Parfait B, Tauber M, Salles JP, Raynal P. How do Shp2 mutations that oppositely influence its biochemical activity result in syndromes with overlapping symptoms? Cell Mol Life Sci. 2007;64:1585–1590. doi: 10.1007/s00018-007-6509-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Feng GS. Shp-2 tyrosine phosphatase: signaling one cell or many. Exp Cell Res. 1999;253:47–54. doi: 10.1006/excr.1999.4668. [DOI] [PubMed] [Google Scholar]
  15. Feng GS. Shp2-mediated molecular signaling in control of embryonic stem cell self-renewal and differentiation. Cell Res. 2007;17:37–41. doi: 10.1038/sj.cr.7310140. [DOI] [PubMed] [Google Scholar]
  16. Fluck MM, Schaffhausen BS. Lessons in Signaling and Tumorigenesis from Polyomavirus Middle T Antigen. Microbiol Mol Biol Rev. 2009;73:542–563. doi: 10.1128/MMBR.00009-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Garcia R, Yu CL, Hudnall A, Catlett R, Nelson KL, Smithgall T, Fujita DJ, Ethier SP, Jove R. Constitutive activation of Stat3 in fibroblasts transformed by diverse oncoproteins and in breast carcinoma cells. Cell Growth Differ. 1997;8:1267–1276. [PubMed] [Google Scholar]
  18. Gauthier AS, Furstoss O, Araki T, Chan R, Neel BG, Kaplan DR, Miller FD. Control of CNS cell-fate decisions by SHP-2 and its dysregulation in Noonan syndrome. Neuron. 2007;54:245–262. doi: 10.1016/j.neuron.2007.03.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ichaso N, Dilworth SM. Cell transformation by the middle T-antigen of polyoma virus. Oncogene. 2001;20:7908–7916. doi: 10.1038/sj.onc.1204859. [DOI] [PubMed] [Google Scholar]
  20. Ischenko I, Petrenko O, Gu H, Hayman MJ. Scaffolding protein Gab2 mediates fibroblast transformation by the SEA tyrosine kinase. Oncogene. 2003;22:6311–6318. doi: 10.1038/sj.onc.1206742. [DOI] [PubMed] [Google Scholar]
  21. Jazayeri A, McGee J, Shimamura T, Cross SB, Bejcek BE. SHP-2 can suppress transformation induced by platelet-derived growth factor. Exp Cell Res. 2000;254:197–203. doi: 10.1006/excr.1999.4741. [DOI] [PubMed] [Google Scholar]
  22. Kalakonda S, Nallar SC, Lindner DJ, Hu J, Reddy SP, Kalvakolanu DV. Tumor-suppressive activity of the cell death activator GRIM-19 on a constitutively active signal transducer and activator of transcription 3. Cancer Res. 2007;67:6212–6220. doi: 10.1158/0008-5472.CAN-07-0031. [DOI] [PubMed] [Google Scholar]
  23. Kontaridis MI, Swanson KD, David FS, Barford D, Neel BG. PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 2006;281:6785–6792. doi: 10.1074/jbc.M513068200. [DOI] [PubMed] [Google Scholar]
  24. Luo JC, Yamaguchi S, Shinkai A, Shitara K, Shibuya M. Significant expression of vascular endothelial growth factor/vascular permeability factor in mouse ascites tumors. Cancer Res. 1998;58:2652–2660. [PubMed] [Google Scholar]
  25. Mohi MG, Neel BG. The role of Shp2 (PTPN11) in cancer. Curr Opin Genet Dev. 2007;17:23–30. doi: 10.1016/j.gde.2006.12.011. [DOI] [PubMed] [Google Scholar]
  26. Neel BG, Gu H, Pao L. The ’Shp’ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci. 2003;28:284–293. doi: 10.1016/S0968-0004(03)00091-4. [DOI] [PubMed] [Google Scholar]
  27. Oh ES, Gu H, Saxton TM, Timms JF, Hausdorff S, Frevert EU, Kahn BB, Pawson T, Neel BG, Thomas SM. Regulation of early events in integrin signaling by protein tyrosine phosphatase SHP-2. Mol Cell Biol. 1999;19:3205–3215. doi: 10.1128/mcb.19.4.3205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ong SH, Dilworth S, Hauck-Schmalenberger I, Pawson T, Kiefer F. ShcA and Grb2 mediate polyoma middle T antigen-induced endothelial transformation and Gab1 tyrosine phosphorylation. EMBO J. 2001;20:6327–6336. doi: 10.1093/emboj/20.22.6327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ogris E, Mudrak I, Mak E, Gibson D, Pallas DC. Catalytically inactive protein phosphatase 2A can bind to polyomavirus middle tumor antigen and support complex formation with pp60c–src. J Virol. 1999;73:7390–7398. doi: 10.1128/jvi.73.9.7390-7398.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pallas DC, Schley C, Mahoney M, Harlow E, Schaffhausen BS, Roberts TM. Polyomavirus small t antigen: overproduction in bacteria, purification, and utilization for monoclonal and polyclonal antibody production. J Virol. 1986;60:1075–1084. doi: 10.1128/jvi.60.3.1075-1084.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Raptis L, Lamfrom H, Benjamin TL. Regulation of cellular phenotype and expression of polyomavirus middle T antigen in rat fibroblasts. Mol Cell Biol. 1985;5:2476–2486. doi: 10.1128/mcb.5.9.2476-2486.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Roskoski R., Jr Src kinase regulation by phosphorylation and dephosphorylation. Biochem Biophys Res Commun. 2005;331:1–14. doi: 10.1016/j.bbrc.2005.03.012. Review. [DOI] [PubMed] [Google Scholar]
  33. Schaffhausen BS, Roberts TM. Lessons from polyoma middle T antigen on signaling and transformation: A DNA tumor virus contribution to the war on cancer. Virology. 2009;384:304–316. doi: 10.1016/j.virol.2008.09.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sedy JR, Gavrieli M, Potter KG, Hurchla MA, Lindsley RC, Hildner K, Scheu S, Pfeffer K, Ware CF, Murphy TL, Murphy KM. B and T lymphocyte attenuator regulates T cell activation through interaction with herpesvirus entry mediator. Nat Immunol. 2005;6:90–98. doi: 10.1038/ni1144. [DOI] [PubMed] [Google Scholar]
  35. Talmage DA, Freund R, Young AT, Dahl J, Dawe CJ, Benjamin TL. Phosphorylation of middle T by pp60c-src: a switch for binding of phosphatidylinositol 3-kinase and optimal tumorigenesis. Cell. 1989;59:55–65. doi: 10.1016/0092-8674(89)90869-6. [DOI] [PubMed] [Google Scholar]
  36. Xiong Y, Huo Y, Chen C, Zeng H, Lu X, Wei C, Ruan C, Zhang X, Hu Z, Shibuya M, Luo J. Vascular endothelial growth factor (VEGF) receptor-2 tyrosine 1175 signaling controls VEGF-induced von Willebrand factor release from endothelial cells via phospholipase C-gamma 1- and protein kinase A-dependent pathways. J Biol Chem. 2009;284:23217–23224. doi: 10.1074/jbc.M109.019679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yu M, Luo J, Yang W, Wang Y, Mizuki M, Kanakura Y, Besmer P, Neel BG, Gu H. The scaffolding adapter Gab2, via Shp-2, regulates kit-evoked mast cell proliferation by activating the Rac/JNK pathway. J Biol Chem. 2006;281:28615–28626. doi: 10.1074/jbc.M603742200. [DOI] [PubMed] [Google Scholar]
  38. Zhang SQ, Tsiaras WG, Araki T, Wen G, Minichiello L, Klein R, Neel BG. Receptor-specific regulation of phosphatidylinositol 3’-kinase activation by the protein tyrosine phosphatase Shp2. Mol Cell Biol. 2002;22:4062–4072. doi: 10.1128/MCB.22.12.4062-4072.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhang SQ, Yang W, Kontaridis MI, Bivona TG, Wen G, Araki T, Luo J, Thompson JA, Schraven BL, Philips MR, Neel BG. Shp2 regulates SRC family kinase activity and Ras/Erk activation by controlling Csk recruitment. Mol Cell. 2004;13:341–355. doi: 10.1016/s1097-2765(04)00050-4. [DOI] [PubMed] [Google Scholar]

RESOURCES