Abstract
Trehalose is a non-reducing disaccharide and can be accumulated in response to heat or oxidative stresses in Candida albicans. Here we showed that a C. albicans tps1Δ mutant, which is deficient in trehalose synthesis, exhibited increased apoptosis rate upon H2O2 treatment together with an increase of intracellular Ca2+ level and caspase activity. When the intracellular Ca2+ level was stimulated by adding CaCl2 or A23187, both the apoptosis rate and caspase activity were increased. In contrast, the presence of two calcium chelators, EGTA and BAPTA, could attenuate these effects. Moreover, we investigated the role of Ca2+ pathway in C. albicans apoptosis and found that both calcineurin and the calcineurin-dependent transcription factor, Crz1p, mutants showed decreased apoptosis and caspase activity upon H2O2 treatment compared to the wild-type cells. Expression of CaMCA1, the only gene found encoding a C. albicans metacaspase, in calcineurin-deleted or Crz1p-deleted cells restored the cell sensitivity to H2O2. Our results suggest that Ca2+ and its downstream calcineurin/Crz1p/CaMCA1 pathway are involved in H2O2 -induced C. albicans apoptosis. Inhibition of this pathway might be the mechanism for the protective role of trehalose in C. albicans.
Introduction
Candida albicans is the most important human fungal pathogen, causing various diseases from superficial mucosal infections to life-threatening systemic disorders [1]–[3]. The number of clinical C. albicans infections worldwide has risen considerably in recent years, and the incidence of resistance to traditional antifungal therapies is also rising. Many existing antifungal therapies have unfortunate clinical side effects; therefore, strategies are needed to identify new targets for antifungal therapy.
In the past few years, it became evident that apoptosis might occur not only in multicellular, but also in unicellular organisms, such as fungi. The induction of cell apoptosis is considered as a new and promising strategy for antifungal therapy. It has been reported that Saccharomyces cerevisiae dies in an apoptotic manner in response to weak acid stress, oxidative stress, salt stress, and UV irradiation [4]–[7]. Ultrastructural and biochemical changes that are characteristic of apoptosis have also been reported in pathogenic fungi. C. albicans can be triggered to undergo an apoptotic cell death response when exposed to environmental stress such as H2O2, amphotericin B (AmB) or intracellular acidification. However, the mechanism of C. albicans apoptosis has not been fully revealed. Ras–cAMP–PKA was found to be involved in the apoptosis of C. albicans. Mutations that blocked Ras–cAMP–PKA signaling (ras1Δ, cdc35Δ, tpk1Δ, and tpk2Δ) suppressed or delayed the apoptotic response, whereas mutations that stimulated signaling (RAS1val13 and pde2Δ) accelerated the rate of entry into apoptosis [8]–[10]. We recently found that CaMCA1, a homologue of Saccharomyces cerevisiae metacaspase YCA1, was involved in oxidative stress-induced apoptosis in C. albicans [11].
Trehalose, a non-reducing disaccharide, plays diverse roles, from energy source to stress protectant, and this sugar is found in bacteria, fungi, plants, and invertebrates but not in mammals [12]. In yeast, trehalose acts both as a main reserve of carbohydrates and as a cellular protector against a variety of nutritional and/or environmental stress challenges (oxidative, heat shock, osmotic and/or saline stress, xenobiotics etc.), increasing cell resistance to such insults [13]. The mechanism of trehalose protection is an active area of research that includes studies of the interaction of sugars with plasma membranes, the effects on cell osmotic responses, and the unique physicochemical properties of trehalose [14]. In yeast, trehalose is synthesized by a large enzyme complex comprising the two catalytic activities of trehalose biosynthesis. Trehalose-6-phosphate (Tre6P) synthase, encoded by TPS1, synthesizes Tre6P from glucose-6-phosphate and UDP-glucose. Tre6P is then hydrolyzed into trehalose by Tre6P phosphatase, encoded by TPS2 [15], [16]. In C. albicans, tps1/tps1 mutants are defective not only for Tre6P synthesis but also for growth on glucose or related rapidly fermented sugars and virulence [17], [18]. Previous work on C. albicans pointed to a specific role of trehalose in cellular protection against oxidative stress. A tps1/tps1 mutant was shown to be deficient in trehalose synthesis and was extremely sensitive to H2O2 exposure [19]. However, the underlying mechanism by which trehalose protects C. albicans from the injuries remains undefined.
Ca2+ is an important second messenger in developmental and stress signaling pathways. In fungi, Ca2+ is responsible for the regulation of several processes, including cation homeostasis, morphogenesis, virulence traits, and antifungal drug resistance [20]–[23]. A rise in cytoplasmic Ca2+ has been found to be responsible for pheromone-induced S. cerevisiae apoptosis [24]. Fungicidal activity of amiodarone is also tightly coupled to calcium influx [25]. A rise in cytosolic calcium activates the calcium-dependent signaling pathway via the phosphatase, calcineurin (consisting of a catalytic subunit A encoded by CMP1 and a regulatory subunit B encoded by CNB1) and the calcineurin-dependent transcription factor, Crz1p. In C. albicans, Ca2+ and its downstream calcineurin/Crz1p pathway are involved in azole resistance, cell morphogenesis and virulence [26]–[29].
In this study, we show that lack of trehalose can accelerate H2O2 -induced C. albicans apoptosis. Furthermore, this is linked to an increase of Ca2+ concentration and caspase activity. Addition or depletion of Ca2+ affected the cell death and caspase activity. Moreover, we investigated the role of Ca2+ signaling in C. albicans apoptosis, and found that both calcineurin-deleted and Crz1p-deleted cells showed decreased cell death and caspase activity compared to the wild-type cells. Expression of CaMCA1 in calcineurin-deleted or Crz1p-deleted cells restored the sensitivity to H2O2.
Results
Lack of Trehalose Accelerates H2O2-induced Apoptosis
In C. albicans, TPS1 encodes trehalose-6-phosphate (Tre6P) synthase that is required for trehalose synthesis. A tps1Δ mutant is deficient in trehalose accumulation. The impact of TPS1 mutation on trehalose accumulation is shown in Fig. 1A. Trehalose accumulation was increased in wild-type cells after 1 to 3 hours exposure to 1 mM H2O2. This increase did not appear in tps1Δ mutant.
Figure 1. Effects of trehalose accumulation on H2O2-induced apoptosis and ROS production.
(A) The wild-type (CAI4-EXP), tps1△-EXP and tps1△-TPS1 cells were exposed to 1 mM H2O2 for up to 3 hours. At the indicated times, aliquots of cells were taken to measure trehalose content. (B) The cells were exposed to 1 mM H2O2. At the indicated times, aliquots of cells were taken to measure the intracellular ROS by POLARstar Galaxy with excitation at 485 nm and emission at 520 nm. (C) DNA damage of the cells after treatment with 1 mM H2O2 for 3 hours revealed by the TUNEL assay under a fluorescence microscope. (D) Percentage of cells that were classified as apoptotic by TUNEL assay after treatment with indicated concentrations of H2O2 for 3 hours using a BD FACS Calibur flow cytometer with excitation and emission wavelength settings at 488 and 520 nm, respectively. These data were mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values from the control CAI4-EXP cells.
Since it has been reported that H2O2 can induce apoptosis in C. albicans and reactive oxygen species (ROS) is an indicator of apoptosis [9], [22], we examined ROS generation of the cells with the fluorescent dye DCFH-DA. An increase of intracellular ROS level was observed in both tps1△ mutant and wild-type cells upon H2O2 treatment. However, this increase was even stronger in tps1△ mutant (Fig. 1B). Consistent with this, the tps1△ mutant showed a higher percentage of cells demonstrating ROS accumulation than the wild-type cells (Table 1).
Table 1. Percentages of cells demonstrating ROS accumulation after exposure to 1 mM H2O2 for the indicated time.
| Group | 1 hour | 2 hours | 3 hours |
| CAI4-EXP | 7±1 | 15±2 | 41±4 |
| tps1△-EXP | 17±2 | 48±6* | 78±6* |
| tps1△-TPS1 | 8±1 | 17±2 | 34±4 |
*indicated P<0.01 compared with values from the CAI4-EXP cells.
To ascertain the role of trehalose in C. albicans apoptosis, we compared the apoptosis rate between the wild-type cells and tps1Δ mutant when exposed to different concentrations of H2O2. As shown in Fig. 1C, upon H2O2 treatment, the apoptosis rate of tps1Δ mutant was higher than wild-type cells. After 3 hours treatment with 2 mM H2O2, 78% of the tps1Δ mutant cells were apoptotic, while the apoptosis rate of the wild-type cells was 47%.
Lack of Trehalose Enhances Ca2+ Elevation And Caspase Activity
In S. cerevisiae, elevation of intracellular Ca2+ can lead to cell death [25]. We determined the intracellular Ca2+ upon H2O2 treatment using a fluorescent calcium indicator Fluo-3/AM. In the absence of H2O2, the intracellular levels of Ca2+ in both the tps1Δ mutant and wild-type cells were rather low and almost undetectable. After treatment with 1 mM H2O2 for 3 hours, both of the groups showed obvious elevation of intracellular Ca2+, while the tps1Δ mutant cells showed a higher level of Ca2+ than the wild-type cells (Fig. 2A, 2B).
Figure 2. Effects of trehalose accumulation on H2O2-induced Ca2+ elevation and caspase activity.
The wild-type (CAI4-EXP), tps1△-EXP and tps1△-TPS1 cells were exposed to 1 mM H2O2 for 3 hours and stained with Fluo-3/AM. Ca2+ levels were determined by observing the fluorescence using a fluorescence microscope (A) or the POLARstar Galaxy (B). The caspase activity of the cells treated with 1 mM H2O2 for 3 hours was determined by staining the cells with D2R and counting under a fluorescence microscope (C, D). Transcription levels of CaMCA1 in response to 1 mM H2O2 for 3 hours determined by real-time RT-PCR. The mRNA levels were normalized on the basis of their ACT1 levels. Gene expression was indicated as the fold increase of tps1△-EXP and tps1△-TPS1 cells relative to that of the wild-type (CAI4-EXP) strain (E). These data were mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values from the control CAI4-EXP cells.
Since we previously found that the caspase activity was increased in C. albicans apoptosis [11], here we investigated the caspase activity by staining the cells with D2R, a nonfluorescent substrate, which is cleaved to green fluorescent monosubstituted rhodamine 110 and free rhodamine [10], [11], [30]. As shown in Fig. 2C and 2D, after treatment with 1 mM H2O2 for 3 hours, the cell number stainable by D2R in the wild-type cells was 26%, while that in the tps1Δ mutant was 51%. Furthermore, the transcript levels of CaMCA1, which is responsible for caspase activity in C. albicans, were investigated by real time RT-PCR. As shown in Fig. 2E, in the absence of H2O2, there was no significant difference in the transcript level of CaMCA1 between the tps1Δ mutant and wild-type cells. However, a 4 fold increase of CaMCA1 transcript level was recorded in the tps1Δ mutant compared to that in the wild-type cells when exposed to 1 mM H2O2 for 3 hours.
Adding or Depleting Ca2+ Affected Apoptosis and Caspase Activity
Since the intracellular Ca2+ level could be increased by H2O2, especially in the tps1Δ mutant, we hypothesized that Ca2+ signaling might regulate C. albicans apoptosis, and the higher sensitivity of tps1Δ mutant to H2O2 might be due to its higher intracellular Ca2+ level. As shown in Fig. 3A, when we stimulated the intracellular Ca2+ level by adding CaCl2 (0.5 mM), the apoptosis rate increased in both the tps1△ mutant and wild-type cells. Similar effects were observed when A23187 (0.5 µM), a calcium ionophore, was added. CaCl2 and A23187 themselves at the concentrations tested had no effects on C. albicans growth. In addition, the presence of both CaCl2 and A23187 resulted in an increased caspase activity in both the tps1△ mutant and wild-type cells (Fig. 3C).
Figure 3. Effects of adding or depleting Ca2+ on H2O2-induced apoptosis and caspase activity.
(A, B) The wild-type (CAI4-EXP), tps1△-EXP and tps1△-TPS1 cells were exposed to 0.5 mM or 1 mM H2O2 for 3 hours in the absence or presence of CaCl2 (0.5 mM), A23187 (0.5 µM), EGTA (1 mM), BAPTA (1 µM). Percentage of cells that were classified as apoptotic by TUNEL assay was shown. (C, D) Caspase activity determined by staining the cells with D2R. These data were mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values from the cells treated with the same concentrations of H2O2 only.
Furthermore, we tested the effect of depleting Ca2+. As shown in Figure 3B, the presence of EGTA (1 mM), an extracellular calcium chelator, attenuated the H2O2-induced apoptosis in both tps1Δ mutant and wild-type cells, accompanied by the decrease of caspase activity (Fig. 3D). Similarly, when BAPTA (1 µM), an intracellular calcium chelator, was added, both the apoptosis rate and caspase activity in the two strains were decreased.
Deletion of Calcineurin or Crz1p Leads to a Decrease in Apoptosis and Caspase Activity
In C. albicans, calcineurin and Crz1p are two major proteins involved in Ca2+ signaling and play an important role in antifungal tolerance, cell morphogenesis and virulence [20], [21], [26]. So it is possible that the effects of Ca2+ on cell death are mediated by calcineurin and its downstream target Crz1p. To test this hypothesis, we examined the viability of calcineurin and Crz1p mutants [27] upon H2O2 treatment. After 3 hours treatment with 2 mM H2O2, 52% of wild-type cells were apoptotic while the apoptosis rates of cmp1Δ and crz1Δ mutants were 19% and 25%, respectively. In the cmp1Δ-CMP1 and crz1Δ-CRZ1 cells which contain reintroduced CMP1 and CRZ1 gene, the apoptosis rate was similar to the wild-type cells (Fig. 4A). As expected, the caspase activities in both the cmp1Δ and crz1Δ mutants were lower than that in wild-type cells (Fig. 4B). Consistent with this, the transcription levels of CaMCA1 in cmp1Δ and crz1Δ mutants were much lower than that in the wild-type cells (Fig. 4C). The potential role of calcineurin in H2O2-induced apoptosis was further examined using the calcineurin inhibitor cyclosporin A. Upon H2O2 treatment, the wild type cells showed lower apoptosis rates and caspase activity in the presence of 0.08 µM cyclosporin A as compared to the absence of this compound (Fig. 4A, 4B).
Figure 4. Effects of CMP1 deletion, CRZ1 deletion or expression of CaMCA1 on H2O2-induced apoptosis and caspase activity.
The wild-type (CAI4-EXP), cmp1Δ-EXP, crz1Δ-EXP, cmp1Δ-CMP1, crz1Δ-CRZ1 camca1Δ, CAI4-CaMCA1, cmp1Δ-CaMCA1 and crz1Δ-CaMCA1 cells were exposed to 2 mM H2O2 for 3 hours. In another experiment, the wild-type cells were exposed to 2 mM H2O2 for 3 hours in the presence of cyclosporin A (0.08 µM). (A) Percentage of cells that were classified as apoptotic by TUNEL assay was shown. (B) The caspase activity was determined by staining the cells with D2R. (C) Transcription level of CaMCA1 in response to 2 mM H2O2 for 3 hours was determined by real time RT-PCR. The mRNA levels were normalized on the basis of their ACT1 levels. Gene expression is indicated as the fold increase of the mutant and CaMCA1-introduced cells relative to that of the wild-type cells. The data are mean values ± S.D. from three independent experiments. * indicates P<0.01 compared with values of CAI4-EXP treated with H2O2 only. ** indicates P<0.01 compared with values of parental cells without CaMCA1.
Expression of CaMCA1 in Calcineurin-deleted and Crz1p-deleted Cells Restored the Sensitivities to H2O2
Since the caspase activity was decreased in cmp1Δ and crz1Δ mutants upon H2O2 exposure, we introduced CaMCA1 into the cmp1Δ and crz1Δ mutants and assessed the phenotype. Upon H2O2 treatment, the apoptosis rates (Fig. 4A) and caspase activities (Fig. 4B) of the CaMCA1-introduced cells were much higher than the cmp1Δ and crz1Δ mutants. Consistent with this, the transcription levels of CaMCA1 in cmp1Δ and crz1Δ mutants were lower than that in the wild-type cells, while the transcription levels of CaMCA1 in the CaMCA1-introduced cells were similar to that in the wild-type cells (Fig. 4C). In addition, the apoptosis rates and caspase activities of the camca1Δ mutant were lower than the wild-type cells. These data indicated that CaMCA1 could restore the decreased apoptosis and caspase activities of calcineurin-deleted and Crz1p-deleted cells.
Discussion
In yeasts, trehalose acts both as a main reserve of carbohydrates and as a cellular protector against a variety of nutritional and/or environmental stress challenges, increasing cell resistance to such injuries. Trehalose accumulation in C. albicans has been described as a defense mechanism against oxidative stress. A trehalose-deficient tps1Δ mutant is highly sensitive to H2O2 and prone to undergo phagocytic digestion [31]. However, the mechanism by which trehalose protects C. albicans from injuries remains unclear. Since apoptosis is now considered as one of the important ways of C. albicans death, we assessed the role of trehalose in H2O2-induced apoptosis using a tps1△ mutant. According to our result, lack of trehalose could accelerate H2O2 -induced apoptosis which was accompanied by an increase of ROS, an apoptosis indicator. This result revealed a mechanism for the protective role of trehalose in C. albicans. Similar results were reported by other researchers. Liu et al. found that trehalose could inhibit the phagocytosis of refrigerated platelets in vitro via preventing apoptosis [32]. Also, trehalose has been found to protect against ocular surface disorders in experimental murine dry eye through suppression of apoptosis [33].
Our detailed studies on the protective effect of trehalose revealed a role of Ca2+ signals in C. albicans apoptosis. We observed that there was an increase of intracellular Ca2+ level in both the tps1△ mutant and wild-type cells upon H2O2 treatment. However, this increase was much stronger in tps1△ mutant, which was consistent with the higher apoptosis rate induced in this strain. When we stimulated the intracellular Ca2+ level by adding CaCl2 or A23187, the apoptosis rates in both the tps1△ mutant and wild-type cells were increased. In contrast, when Ca2+ was depleted by adding EGTA or BAPTA, the apoptosis rates in both the tps1△ mutant and wild-type cells were decreased. These results indicated that apoptosis could be induced in C. albicans through increasing intracellular Ca2+ level.
The role of Ca2+ in C. albicans apoptosis was further examined by the experiments with CMP1 and CRZ1, two genes involved in Ca2+ signaling. We found that cmp1Δ and crz1Δ mutants showed attenuated apoptosis upon H2O2 treatment, similar to the effect of depleting Ca2+ in wild-type cells. Consistent with this result, addition of cyclosporin A, a calcineurin inhibitor, could also attenuate apoptosis. Taken together, Ca2+ and its downstream calcineurin/Crz1p pathway are involved in H2O2 -induced C. albicans apoptosis.
In mammals, apoptosis can be directed by the activation caspases, which cleave specific substrates and trigger cell death. In the past few years, it has become evident that caspases might exist not only in multicellular, but also in unicellular organisms, such as fungi. In S. cerevisiae, YCA1 encodes a single metacaspase, which has caspase activity. YCA1 is involved in the apoptosis of yeast cells exposed to different environmental stresses, such as H2O2, acetic acid, sodium chloride, heat shock, and hyperosmosis [34]–[36]. In plants, metacaspases have been associated with Norway spruce apoptosis during embryogenesis and tomato plant apoptosis induced by fungal infection [37]–[39]. Using yeast as a heterologous system for apoptosis evaluation, the metacaspases AtMCP1b and AtMCP2b from the plant Arabidopsis thaliana were also found to be involved in apoptosis induced by H2O2 [40]. We recently found that H2O2-induced C. albicans apoptosis was accompanied with caspase activity, which was encoded by CaMCA1 [11]. In this study, we found that, upon H2O2 treatment, the caspase activities in tps1△ mutant were much higher than those in wild-type cells, similar to the phenomena of intracellular Ca2+ levels. The positive relation between Ca2+ level and caspase activity was proved by adding or depleting Ca2+. Moreover, both calcineurin-deleted and Crz1p-deleted cells showed lower caspase activity compared to the wild-type cells, indicating that CaMCA1 might be a downstream gene which is blocked in calcineurin-deleted or Crz1p-deleted cells (Fig. 5). As expected, when extraneous CaMCA1 was introduced into these cells, the caspase activity and cell sensitivity to H2O2 were resumed. Previous studies showed that C. albicans CaMCA1 could be activated by Ca2+ and regulated by calcineurin and Crz1p. Moreover, CDRE (calcineurin-dependent responsive element) was found in the promoter of CaMCA1 [26]. Based on these results, we conclude that CaMCA1 is likely to be one of the downstream genes influenced by the Ca2+ signaling and involved with the protective role of trehalose against H2O2-induced apoptosis.
Figure 5. A model for the role of trehalose in the regulation of H2O2-induced apoptosis in C. albicans.
When C. albicans is exposed to H2O2, the intracellular Ca2+ is increased and its downstream calcineurin/Crz1p pathway is activated. The calcineurin inhibitor cyclosporin A can block this pathway. Crz1p might up-regulate the expression of CaMCA1 through binding to the CDRE (calcineurin-dependent responsive element) in the promoter of CaMCA1. The increased expression of CaMCA1 results in the increased caspase activity and thus apoptosis occurs. tps1△ mutation results in the lack of trehalose accumulation thus accelerates C. albicans apoptosis.
Materials and Methods
Media and Compounds
Yeast media used were YPD (1% yeast extract, 2% peptone, and 2% glucose) and SD [0.67% (w/v) Difco yeast nitrogen base without amino acids]. SD medium was supplemented with a complete synthetic mix containing all the amino acids and bases. For prototrophic selection of yeast, the relevant drop-out mixes were used. Because the capacity of the trehalose-deficient mutant tps1/tps1 to grow on exogenous glucose and fructose as carbon source is seriously compromised, some experiments were carried out in YPgal medium (1% yeast extract, 2% peptone, and 2% galactose) or SDgal [0.67% (w/v) Difco yeast nitrogen base without amino acids, 2% galactose]. Escherichia coli strain DH5α and LB (0.5% yeast extract, 1% peptone, and 1% NaCl) medium were used for transformation and plasmid DNA preparation. Fluo-3/AM, CaCl2, A23187, BAPTA, EGTA, cyclosporin A (Sigma, U.S.A.) were dissolved in either medium or dimethyl sulfoxide (DMSO) and then diluted to the appropriate working concentration.
Plasmids and Strain Construction
The strains (Table 2) were cultivated at 30°C under constant shaking (200 rpm) or incubation. To reintroduce TPS1 to tps1Δ mutant, the ORF of TPS1 was amplified (using upstream primer 5′ ggatccatggttcaaggaaaagtc 3′ and downstream primer 5′ ctgcagctagtccctcaaactcttttg 3′) with Pyrobest DNA polymerase (TaKaRa Biotechnology, Dalian, P.R. China). After being purified, the BamHI-PstI digested PCR fragment was cloned into the integrative expression vector pCaEXP (Table 3) to generate the recombinant plasmid pCaEXP-TPS1 [41]. After sequencing, pCaEXP-TPS1 was linearized and used to transform tps1Δ cells, and selected on SD medium lacking uridine, methionine and cysteine. As controls, the empty plasmid pCaEXP was transformed into CAI4 and tps1Δ cell to produce CAI4-EXP and tps1Δ-EXP, respectively. The same expression vector and transformation method were used for reintroducing CMP1 (using upstream primer 5′ ggatccatgtcaggaaatactgttcaa 3′ and downstream primer 5′ ctgcagttaactttgagataatcttct 3′) and CRZ1 (using upstream primer 5′ ggatccatgtctaacaatcctcatccc 3′ and downstream primer 5′ ctgcagctaagtaatttcaacaccact 3′) genes to their corresponding mutants, and introducing CaMCA1 (using upstream primer 5′ ggatccatgtttccaggacaaggtag 3′ and downstream primer 5′ ctgcagttaaaaaataaattgcaagtt 3′) to cmp1Δ and crz1Δ mutants and CAI4. The expression of TPS1, CMP1, CRZ1 and CaMCA1 in their host cells was confirmed by real time RT-PCR (data not shown).
Table 2. C. albicans strains used in this study.
| Strain | Parent | Genotype | Reference |
| CAI4 | CAF2-1 | ura3△::immm434/ura3△::immm434 | Fonzi et al., 1993 |
| CAI4-EXP | CAI4 | ura3△::immm434/ura3△::immm434::URA3 | This study |
| cmp1Δ(DSY2091) | CAF4-2 | cmp1△::hisG/cmp1△::hisG-URA3-hisG | Karababa et al., 2006 |
| cmp1Δu | cnaΔ | cmp1△::hisG/cmp1△::hisG | This study |
| cmp1Δ-CaMCA1 | cnaΔu | cmp1△::hisG/cmp1△::hisG::CaMCA1-URA3 | This study |
| cmp1Δ-CMP1 | cnaΔu | cmp1△::hisG/cmp1△::hisG::CMP1-URA3 | This study |
| cmp1Δ-EXP | cnaΔu | cmp1△::hisG/cmp1△::hisG::URA3 | This study |
| crz1Δ(DSY2195) | DSY2188 | crz1△::hisG/crz1△::hisG-URA3-hisG | Karababa et al., 2006 |
| crz1Δu | crz1Δ | crz1△::hisG/crz1△::hisG | This study |
| crz1Δ-CaMCA1 | crz1Δu | crz1△::hisG/crz1△::hisG::CaMCA1-URA3 | This study |
| crz1Δ-CRZ1 | crz1Δu | crz1△::hisG/crz1△::hisG::CRZ1-URA3 | This study |
| crz1Δ-EXP | crz1Δu | crz1△::hisG/crz1△::hisG::URA3 | This study |
| camca1Δ | CAI4 | camca1△::hisG/camca1△::hisG-URA3-hisG | Cao et al., 2009 |
| CAI4-CaMCA1 | CAI4 | ura3△::immm434::CaMCA1-URA3 | This study |
| tps1Δ | CAI4 | tps1△::hisG/tps1△::hisG | Zaragoza et al., 1998 |
| tps1Δ-EXP | tps1Δ | tps1△::hisG/tps1△::hisG::URA3 | This study |
| tps1Δ-TPS1 | tps1Δ | tps1△::hisG/tps1△::hisG::TPS1-URA3 | This study |
Table 3. Plasmids used in this study.
| plasmid | Parent | Genotype | Reference |
| pCaEXP | pCaEXP | C. albicans expression vector | Care et al., 1999 |
| pCaEXP-MCA1 | pCaEXP | expression vector containing CaMCA1 | Cao et al., 2009 |
| pCaEXP-CMP1 | pCaEXP | expression vector containing CMP1 | This study |
| pCaEXP-CRZ1 | pCaEXP | expression vector containing CRZ1 | This study |
| pCaEXP-TPS1 | pCaEXP | expression vector containing TPS1 | This study |
Cell Treatment and Apoptosis Measurement
Yeast cells grown to early exponential phase at 30°C were exposed to different concentrations of H2O2 for the required time (range 0–3 hours) and then harvested for apoptosis measurement. A terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) assay was performed in order to confirm the occurrence of the apoptosis process [4]. C. albicans cells were washed twice with PBS and fixed with a solution of 3.6% paraformaldehyde in PBS for 1 hour at 20°C. Cells were rinsed twice with PBS and then incubated with permeabilization solution for 2 minutes on ice. The cells were rinsed in PBS and labeled, using a solution of the label and enzyme solutions from an in situ cell death detection kit, fluorescein (Roche Applied Sciences, Mannheim, Germany), with appropriate controls labeled only with the label solution. The cells were incubated for 1 hour at 37°C in a humidified atmosphere in the dark, rinsed in PBS. The staining of the cells was observed by a fluorescence microscopy. Alternatively, the number of cells determined to be positive by the TUNEL assay was quantified using a BD FACSCalibur flow cytometer with excitation and emission wavelength settings at 488 and 520 nm, respectively.
Assay of the Intracellular Content of Trehalose
For analysis of the intracellular trehalose, the cells grown to early exponential phase at 30°C were exposed to 1 mM H2O2 for 3 hours. At the indicated times, aliquots of cells (about 5×108) were taken and immediately centrifuged and washed with cold distilled water. Samples were microwaved (700 W) for 3×60 seconds with 30 seconds intervals between each, 1 ml of distilled water was then used to extract the trehalose for 1 hour. After centrifugation at 15,000×g for 10 minutes, the trehalose in the supernatants was analyzed by HPLC-MS with a detection limit of 1 ng. An HPLC system (Agilent1100, Wilmington, Germany) equipped with a G1946 mass spectrometer was used in the analysis. The operating conditions were as follows: Extracts were analyzed after separation of an Agilent Zorbax NH2 Column (4.6 mm×250 mm, 5 mm) at a flow rate of 1.0 ml/min. The mobile phase consisted of methanol∶ water 85∶15 (v/v). The HPLC eluant from the DAD detector was introduced into the mass spectrometer via a 1∶3 split. The column temperature was 25°C. A quadrupole mass spectrometer equipped with an ESI interface was used to obtain mass spectra, which were then examined by SIM in negative mode. The nebulizing gas was at 40 psi, and the drying gas temperature was 350°C. The fragmentor was set to 70 V, and the capillary voltage was 3.5 kV. The cell weight was determined as follows: another sample of the same volume of the corresponding cell suspension was filtered through pre-weighed filters (0.22 µm pore size). After washing with PBS, the filters were dried at 37°C for 48 h and then weighed. The trehalose content was showed as nmol/mg.
Measurement of ROS Levels
Intracellular levels of ROS were measured with DCFH-DA (Molecular Probes, U.S.A.). Briefly, cultured cells were collected by centrifugation and washed three times with PBS. Subsequently, the cells were adjusted to 2×107 cells/ml. After being incubated with 20 µg/ml of DCFH-DA for 30 minutes at 30°C, the cells were exposed to H2O2 and incubated at 30°C with constant shaking (200 rpm). At specified intervals, cell suspensions were harvested and examined by fluorescence microscope or transferred to the wells of a flat-bottom microplate (BMG Microplate, 96 well, Blank) to detect fluoresence intensity on the POLARstar Galaxy (BMG, Labtech, Offenburg, Germany) with excitation at 485 nm and emission at 520 nm.
Ca2+ Detection
Cells were loaded with 5 µM Fluo-3/AM for 30 minutes at 37°C. Ca2+ levels were determined by a fluorescence microscopy. Alternatively, fluorescence intensity values were determined on the POLARstar Galaxy (BMG, Labtech, Offenburg, Germany) with excitation at 488 nm and emission at 525 nm.
Assessment of Caspase Activity
Caspase activity was detected by staining with D2R (CaspSCREEN Flow Cytometric Apoptosis Detection Kit, BioVision, U.S.A.) [10], [11], [41]. According to the manufacturer's instructions, cells were in D2R incubation buffer at 30°C for 45 minutes before viewing and counting under a fluorescence microscope with excitation at 488 nm and emission at 530 nm.
Real-time RT-PCR
RNA isolation and real-time RT-PCR were performed as described previously [42]. The isolated RNA was resuspended in diethyl pyrocarbonate-treated water. The OD260 and OD280 were measured, and the integrity of the RNA was visualized by subjecting 2 to 5 µl of the samples to electrophoresis through a 1% agarose-MOPS gel. First-strand cDNAs were synthesized from 3 µg of total RNA in a 60 µl reaction volume using the cDNA synthesis kit for RT-PCR (TaKaRa Biotechnology, Dalian, P.R. China) in accordance with the manufacturer's instructions. Triplicate independent quantitative real-time PCR were performed using the LightCycler System (Roche diagnostics, GmbH Mannheim, Germany). SYBR Green I (TaKaRa) was used to visualize and monitor the amplified product in real time according to the manufacturer's protocol. CaMCA1 was amplified with the forward primer 5′-TATAATAGACCTTCTGGAC-3′ and the reverse primer 5′- TTGGTGGACGAGAATAATG-3′.
The PCR protocol consisted of denaturation program (95°C for 10 seconds), 40 cycles of amplification and quantification program (95°C for 10 seconds, 60°C for 20 seconds, 72°C for 15 seconds with a single fluorescence measurement), melting curve program (60–95°C with a heating rate of 0.1°C per second and a continuous fluorescence measurement) and finally a cooling step to 40°C. A standard curve for each primer set was performed with 1∶10, 1∶25, 1∶50, 1∶100, 1∶250 and 1∶500 dilutions of the cDNAs. The slopes of the standard curves were within 10% of 100% efficiency. The change in fluorescence of SYBR Green I dye in every cycle was monitored by the LightCycler system software, and the threshold cycle (CT) above background for each reaction was calculated. The CT value of ACT1 (amplified with the forward primer 5′-CAACAAGGACAATACAATAG-3′ and the reverse primer 5′- GTTGGTGGACGAGAATAATG -3′) was subtracted from that of the tested genes to obtain a ΔCT value. The ΔCT value of an arbitrary calibrator was subtracted from the ΔCT value of each sample to obtain a ΔΔCT value. The gene expression level relative to the calibrator was expressed as 2−ΔΔCT.
Acknowledgments
We thank Professor William A. Fonzi for kindly providing the C. albicans strains CAI4. We thank Professor Dominique Sanglard for kindly providing the C. albicans strains DSY2091 and DSY2195. We thank Professor Carlos Gancedo for kindly providing the C. albicans tps1Δ strain.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was supported by the National Natural Science Foundation of China (No. 30630071, 30870105) and Shanghai Rising-Star Program (08QA14001). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Fidel PL., Jr Candida-host interactions in HIV disease: relationships in oropharyngeal candidiasis. Adv Dent Res. 2006;19:80–84. doi: 10.1177/154407370601900116. [DOI] [PubMed] [Google Scholar]
- 2.Perlroth J, Choi B, Spellberg B. Nosocomial fungal infections: epidemiology, diagnosis, and treatment. Med Mycol. 2007;45:321–346. doi: 10.1080/13693780701218689. [DOI] [PubMed] [Google Scholar]
- 3.Redding SW, Zellars RC, Kirkpatrick WR, McAtee RK, Caceres MA, et al. Epidemiology of oropharyngeal Candida colonization and infection in patients receiving radiation for head and neck cancer. J Clin Microbiol. 1999;37:3896–3900. doi: 10.1128/jcm.37.12.3896-3900.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Madeo F, Frohlich E, Frohlich KU. A yeast mutant showing diagnostic markers of early and late apoptosis. J Cell Biol. 1997;139:729–734. doi: 10.1083/jcb.139.3.729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Madeo F, Fröhlich E, Ligr M, Grey M, Sigrist SJ, et al. Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol. 1999;145:757–767. doi: 10.1083/jcb.145.4.757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Madeo F, Herker E, Maldener C, Wissing S, Lachel S. A caspase-related protease regulates apoptosis in yeast. Mol Cell. 2002;9:911–917. doi: 10.1016/s1097-2765(02)00501-4. [DOI] [PubMed] [Google Scholar]
- 7.Silva RD, Sotoca R, Johansson B, Ludovico P, Sansonetty F. Hyperosmotic stress induces metacaspase- and mitochondria-dependent apoptosis in Saccharomyces cerevisiae. Mol Microbiol. 2005;58:824–834. doi: 10.1111/j.1365-2958.2005.04868.x. [DOI] [PubMed] [Google Scholar]
- 8.Phillips AJ, Sudbery I, Ramsdale M. Apoptosis induced by environmental stresses and amphotericin B in Candida albicans. Proc Natl Acad Sci USA. 2003;100:14327–14332. doi: 10.1073/pnas.2332326100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Phillips AJ, Crowe JD, Ramsdale M. Ras pathway signaling accelerates programmed cell death in the pathogenic fungus Candida albicans. Proc Natl Acad Sci USA. 2006;103:726–731. doi: 10.1073/pnas.0506405103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Al-Dhaheri RS, Douglas LJ. Apoptosis in Candida biofilms exposed to amphotericin B. J Med Microbiol. 2010;59:149–157. doi: 10.1099/jmm.0.015784-0. [DOI] [PubMed] [Google Scholar]
- 11.Cao YY, Huang S, Dai BD, Zhu ZY, Lu H, et al. Candida albicans cells lacking CaMCA1-encoded metacaspase show resistance to oxidative stress-induced death and change in energy metabolism. Fungal Genet Biol. 2009;46:183–189. doi: 10.1016/j.fgb.2008.11.001. [DOI] [PubMed] [Google Scholar]
- 12.Arguelles JC. Physiological roles of trehalose in bacteria and yeast: a comparative analysis. Arch Microbiol. 2000;174:217–224. doi: 10.1007/s002030000192. [DOI] [PubMed] [Google Scholar]
- 13.Richards AB, Krakowka S, Dexter LB, Schmid H, Wolterbeek APM, et al. Trehalose: a review of properties, history of use and human tolerance, and results of multiple safety studies. Food Chem Toxicol. 2002;40:871–898. doi: 10.1016/s0278-6915(02)00011-x. [DOI] [PubMed] [Google Scholar]
- 14.Elbein AD, Pan YT, Pastuszak I, Carroll D. New insights on trehalose: a multifunctional molecule. Glycobiology. 2003;13:17–27. doi: 10.1093/glycob/cwg047. [DOI] [PubMed] [Google Scholar]
- 15.Van Dijck P, DeRop L, Szlufcik K, VanAel E, Thevelein JM. Disruption of the Candida albicans TPS2 gene encoding trehalose-6-phosphate phosphatase decreases infectivity without affecting hypha formation. Infect Immun. 2002;70:1772–1782. doi: 10.1128/IAI.70.4.1772-1782.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zaragoza O, de Virgilio C, Ponton J, Gancedo C. Disruptionin Candida albicans of the TPS2 gene encoding trehalose-6-phosphate phosphatase affects cell integrity and decreases infectivity. Microbiology. 2002;148:1281–1290. doi: 10.1099/00221287-148-5-1281. [DOI] [PubMed] [Google Scholar]
- 17.Thevelein JM, Hohmann S. Trehalose synthase: guard to the gate of glycolysis in yeast? Trends Biochem Sci. 1995;20:3–10. doi: 10.1016/s0968-0004(00)88938-0. [DOI] [PubMed] [Google Scholar]
- 18.Zaragoza O, Blazquez MA, Gancedo C. Disruption of the Candida albicans TPS1 gene encoding trehalose-6P- synthase impairs formation of hyphae and decreases infectivity. J Bacteriol. 1998;180:3809–3815. doi: 10.1128/jb.180.15.3809-3815.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Alvarez P, Francisco J, Zaragoza O, Pedreno Y, Arguelles JC. Protective role of trehalose during severe oxidative stress caused by hydrogen peroxide and the adaptive oxidative stress response in Candida albicans. Microbiology. 2002;148:2599–2606. doi: 10.1099/00221287-148-8-2599. [DOI] [PubMed] [Google Scholar]
- 20.Bader T, Schroppel K, Bentink S, Agabian N, Kohler G, et al. Role of calcineurin in stress resistance, morphogenesis, and virulence of a Candida albicans wild-type strain. Infect Immun. 2006;74:4366–4369. doi: 10.1128/IAI.00142-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Cannon RD, Lamping E, Holmes AR, Niimi K, Tanabe K, et al. Candida albicans drug resistance: another way to cope with stress. Microbiology. 2007;153:3211–3219. doi: 10.1099/mic.0.2007/010405-0. [DOI] [PubMed] [Google Scholar]
- 22.Hemenway CS, Heitman J. Calcineurin. Structure, function and inhibition. Cell. Biochem Biophys. 1999;30:115–151. doi: 10.1007/BF02737887. [DOI] [PubMed] [Google Scholar]
- 23.Steinbach WJ, Reedy JL, Crame RA, Jr, Perfect JR, Heitman J, et al. Calcineurin: Form and function. Physiol Rev. 2000;80:1483–1521. doi: 10.1152/physrev.2000.80.4.1483. [DOI] [PubMed] [Google Scholar]
- 24.Pozniakovsky AI, Knorre DA, Markova OV, Hyman AA, Skulachev VP, et al. Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast. J Cell Biology. 2005;168:257–269. doi: 10.1083/jcb.200408145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gupta SS, Ton VK, Beaudr V, Rulli S, Cunningham K, et al. Antifungal activity of amiodarone is mediated by disruption of calcium homeostasis. J Biol Chem. 2003;278:28831–28839. doi: 10.1074/jbc.M303300200. [DOI] [PubMed] [Google Scholar]
- 26.Karababa M, Valentino E, Pardini G, Coste AT, Bille J. CRZ1, a target of the calcineurin pathway in Candida albicans. . Mol Microbiol. 2006;59:1429–1451. doi: 10.1111/j.1365-2958.2005.05037.x. [DOI] [PubMed] [Google Scholar]
- 27.Onyewu C, Wormley FL, Perfec JR, Heitman J. The calcineurin target, Crz1, functions in azole tolerance but is not required for virulence of Candida albicans. Infect Immun. 2004;72:7330–7333. doi: 10.1128/IAI.72.12.7330-7333.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sanglard D, Ischer F, Marchetti O, Entenza J, Bille J. Calcineurin A of Candida albicans: Involvement in antifungal tolerance, cell morphogenesis and virulence. Mol Microbiol. 2003;48:959–976. doi: 10.1046/j.1365-2958.2003.03495.x. [DOI] [PubMed] [Google Scholar]
- 29.Stathopoulos AM, Cyert MS. Calcineurin acts through the CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 1997;11:3432–3444. doi: 10.1101/gad.11.24.3432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Vachova L, Palkova Z. Physiological regulation of yeast cell death in multicellular colonies is triggered by ammonia. J Cell Biol. 2005;169:711–717. doi: 10.1083/jcb.200410064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Martínez-Esparza M, Aguinaga A, González-Párraga P, García-Peñarrubia P, Jouault T, et al. Role of trehalose in resistance to macrophage killing: study with a tps1/tps1 trehalose-deficient mutant of Candida albicans. Clin Microbiol Infect. 2007;13:384–394. doi: 10.1111/j.1469-0691.2007.01663.x. [DOI] [PubMed] [Google Scholar]
- 32.Liu Q, Xu L, Jiao SX, Wang TX, Song Y, et al. Trehalose inhibited the the phagocytosis of refrigerated platelets in vitro via preventing apoptosis. Transfusion. 2009;49:2158–2166. doi: 10.1111/j.1537-2995.2009.02254.x. [DOI] [PubMed] [Google Scholar]
- 33.Chen W, Zhang X, Liu M, Zhang J, Ye Y, et al. Trehalose protects against ocular surface disorders in experimental murine dry eye through suppression of apoptosis. Exp Eye Res. 2009;89:311–318. doi: 10.1016/j.exer.2009.03.015. [DOI] [PubMed] [Google Scholar]
- 34.Khan MA, Chock PB, Stadtman ER. Knockout of caspase-like gene, YCA1, abrogates apoptosis and elevates oxidized proteins in Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 2005;102:17326–1731. doi: 10.1073/pnas.0508120102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Madeo F, Herker E, Wissing S, Jungwirth H, Eisenberg T. Apoptosis in yeast. Curr Opin Microbiol. 2004;7:655–660. doi: 10.1016/j.mib.2004.10.012. [DOI] [PubMed] [Google Scholar]
- 36.Wadskog I, Maldener C, Proksch A, Madeo F, Adler L. Yeast lacking the SRO7/SOP1-encoded tumor suppressor homologue show increased susceptibility to apoptosis-like cell death on exposure to NaCl stress. Mol Biol Cell. 2004;15:1436–1444. doi: 10.1091/mbc.E03-02-0114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Bozhkov PV, Suarez MF, Filonova LH, Daniel G, Zamyatnin AA, et al. Cysteine protease mcII-Pa executes programmed cell death during plant organogenesis. . Proc Natl Acad Sci USA. 2005;102:14463–14468. doi: 10.1073/pnas.0506948102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Hoeberichts FA, ten Have A, Woltering EJ. A tomato metacaspase gene is upregulated during programmed cell death in Botrytis cinerea-infected leaves. Planta. 2003;217:517–522. doi: 10.1007/s00425-003-1049-9. [DOI] [PubMed] [Google Scholar]
- 39.Suarez MF, Filonova LH, Smertenko A, Savenkov EI, Clapham DH, et al. Metacaspase-dependent programmed cell death is essential for plant embryogenesis. Curr Biol. 2004;14:R339–40. doi: 10.1016/j.cub.2004.04.019. [DOI] [PubMed] [Google Scholar]
- 40.Watanabe N, Lam E. Two Arabidopsis metacaspases AtMCP1b and AtMCP2b are arginine/lysine-specific cysteine proteases and activate apoptosis-like cell death in yeast. J Biol Chem. 2005;280:14691–14699. doi: 10.1074/jbc.M413527200. [DOI] [PubMed] [Google Scholar]
- 41.Care RS, Trevethick J, Binley KM, Sudbery PE. The MET promoter: a new tool for Candida albicans molecular genetics. Mol Microbiol. 1999;34:792–798. doi: 10.1046/j.1365-2958.1999.01641.x. [DOI] [PubMed] [Google Scholar]
- 42.Wang Y, Cao YY, Jia XM, Cao YB, Gao PH, et al. Cap1p is involved in multiple pathways of oxidative stress response in Candida albicans. Free Radical Biol Med. 2006;40:1201–1209. doi: 10.1016/j.freeradbiomed.2005.11.019. [DOI] [PubMed] [Google Scholar]





