Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2010 Sep 21;19(1):53–59. doi: 10.1038/mt.2010.190

Targeted Gene-and-host Progenitor Cell Therapy for Nonunion Bone Fracture Repair

Nadav Kimelman-Bleich 1, Gadi Pelled 1,2, Yoram Zilberman 1, Ilan Kallai 1, Olga Mizrahi 1, Wafa Tawackoli 2, Zulma Gazit 1,2, Dan Gazit 1,2
PMCID: PMC3017436  PMID: 20859259

Abstract

Nonunion fractures present a challenge to orthopedics with no optimal solution. In-vivo DNA electroporation is a gene-delivery technique that can potentially accelerate regenerative processes. We hypothesized that in vivo electroporation of an osteogenic gene in a nonunion radius bone defect site would induce fracture repair. Nonunion fracture was created in the radii of C3H/HeN mice, into which a collagen sponge was placed. To allow for recruitment of host progenitor cells (HPCs) into the implanted sponge, the mice were housed for 10 days before electroporation. Mice were electroporated with either bone morphogenetic protein 9 (BMP-9) plasmid, Luciferase plasmid or injected with BMP-9 plasmid but not electroporated. In vivo bioluminescent imaging indicated that gene expression was localized to the defect site. Microcomputed tomography (µCT) and histological analysis of murine radii electroporated with BMP-9 demonstrated bone formation bridging the bone gap, whereas in the control groups the defect remained unbridged. Population of the implanted collagen sponge by HPCs transfected with the injected plasmid following electroporation was noted. Our data indicate that regeneration of nonunion bone defect can be attained by performing in vivo electroporation with an osteogenic gene combined with recruitment of HPCs. This gene therapy approach may pave the way for regeneration of other skeletal tissues.

Introduction

Nonunion fractures pose major challenges to orthopedics, for which thus far no optimal solution has been identified.1 Although autologous bone grafts are considered gold-standard treatment for such conditions, their use can result in donor site morbidity.2 Recombinant human bone morphogenetic protein (rhBMP)-2 and rhBMP-7 are presently the only biological alternatives to bone harvesting.3,4 The administration of rhBMPs yields good results;5 however, this treatment requires megadoses of the protein.6

To offer a biological alternative for rhBMP-based therapies, many researchers have used genetically engineered stem cells to treat nonunion bone defects in various animal models.7,8,9,10,11 Other studies investigated a different approach that does not require cell isolation and involves the induction of bone formation by direct introduction of an osteogenic gene into target tissue. In most instances, viral vectors were used;12,13,14,15,16 validating the finding that only transient transgene expression is required to induce bone formation. Yet due to some hazards related to the use of viruses, nonviral methods of gene delivery are considered more clinically relevant.17,18 Indeed, it was shown that nonviral gene delivery is sufficient to induce new bone formation19,20,21,22 in vivo. Designing an efficient strategy for bone regeneration using direct nonviral gene delivery requires several considerations, including choice of gene-delivery method, osteogenic gene and gene localization or targeting method.

Electrical field–mediated gene transfer, better known as DNA electroporation is the use of short high-voltage pulses to overcome the barrier of the cell membrane. The exact translocation mechanism by which electroporated DNA enters the nucleus is not clear, but it seems that the DNA migrates electrophoretically through the membrane and then diffuses toward the nucleus.23,24 This method has been shown to be efficient in gene delivery to various skeletal tissues25 but has not been used for fracture repair, which is the focus of this study. Treating bone fractures with gene therapy requires targeted gene expression in the fracture site. Previously, gene-activated matrices (scaffolds into which DNA plasmid is incorporated) were used as a means of localizing gene expression; alas, this resulted in low transfection efficiency.26 In the present study, we used both needle electrodes (which localize the field of electroporation) and implanted collagen sponges to achieve precise bone formation at the defect site.

In order to induce bone formation followed by fracture repair, we utilized the BMP-9 gene. BMPs are known for their ability to induce bone formation in ectopic and orthotopic sites.4,27,28 When BMP-9 and BMP-6 were delivered into mesenchymal stem cells by means of nucleofection (an electroporation—based method), BMP-9 proved to be the more potent inducer of bone formation.29 Based on these findings, our group selected BMP-9 for the present study. Whereas previous reports have shown the feasibility of inducing bone formation by using in vivo electroporation-mediated gene transfer of other BMPs19,20,21 in ectopic sites, our aim was to overexpress the BMP genes in a fracture site.

Next, we aimed at delivering the osteogenic gene specifically to progenitor cells at the fracture site. Bone regeneration is a complex process that includes multiple cellular and molecular events that have to take place in a specific spatial and temporal order.30 In this study, gene delivery was targeted to host progenitor cells (HPCs) that were localized to the defect site. To allow for cell recruitment and localization of gene therapy in the defect site we used a collagen sponge, which was implanted immediately after the radius bone defect had been created. In summary, we hypothesized that the targeted gene delivery that could be achieved using electroporation, an osteogenic gene, and HPC recruitment would induce localized bone regeneration in a nonunion bone defect.

Results

Population of the implanted collagen sponge by HPCs

Nonunion fractures were created in the radius bones of C3H/HeN mice followed by the implantation of a collagen sponge at the defect site. A histological analysis of defects performed on radii harvested 10 days after the operation revealed that the implanted collagen sponge was populated with HPCs (Figure 1). In areas close to the defect edges, we identified cartilage and callus formation, and in the center of the defect we found dense connective tissue. Radii analyzed 5 or 7 days after generation of the defect contained fewer HPCs and more inflammatory cells (data not shown). Based on these results, and in order to target gene delivery to HPCs, all subsequent gene-delivery experiments were performed on day 10 after sponge implantation.

Figure 1.

Figure 1

Open in a new tab

Host progenitor cells populate the defect site. A 1.5-mm long defect was made in the mouse radius, and a collagen sponge was placed in the defect site. Ten days after surgery, the radius was harvested and stained using H&E. (a–c) Radial defect 10 days after surgery. Staining shows the presence of HPCs (arrowheads). HPC, host progenitor cells; H&E, hematoxylin and eosin; M, defect margin; U, ulna.

Gene transfer efficiency and localization in HPCs

One group of mice was treated with in vivo electroporation of Luciferase directed at the fracture site. Luciferase activity was monitored using a bioluminescence imaging system up to 24 days postelectroporation. We noted a decrease in the luciferase signal between day 3 and day 24 postelectroporation, when no activity was noted. On day 3 postelectroporation, luciferase activity was 49,126 ± 22,549 relative light unit, whereas on day 6 postelectroporation activity had reduced almost 50% to 24,556 ± 2,999 relative light unit. This trend in diminished activity continued: luciferase activity measured only 6,268 ± 1,417 relative light unit on day 13 and no activity could be detected on day 24 (Figure 2). Luciferase activity significantly reduced between days 6 and 13 and again between days 13 and 24 (P < 0.05, two-tailed t-test, n = 4). The signal was localized to the defect site, where it displayed transient activity, as expected when a nonviral gene-delivery method is used.22 In a different experiment performed to verify transgene expression in isolated HPCs, cells were isolated from radius bone defects electroporated with pLuc. Before mice sacrifice, localized Luc expression was verified at the defect site (Figure 2b). Cells from the defect site were isolated and allowed to adhere to plastic culture plates (Figure 2c). RNA was purified from the cells 24 hours after their isolation, and reverse transcription-PCR analysis was performed to verify transgene expression. Although no luciferase expression was found in HPCs isolated from radii that were not electroporated, a robust gene expression was found in cells isolated after pLuc injection and in vivo electroporation (Figure 2d).

Figure 2.

Figure 2

Open in a new tab

Gene transfer efficiency and localization to HPCs. (a) BLI was used to monitor luciferase activity in bone defects following pLuc injection and electroporation. The x axis displays time postelectroporation; the y axis shows activity in RLUs. *P < 0.05, two-tailed t-test, n = 4. Note the representative pictures of one mouse. (b) Results of another BLI study performed in a representative mouse in order to verify gene delivery to HPCs. After they underwent the BLI study, mice were sacrificed and cells from explanted radii were isolated. (c) photomicrograph shows HPCs isolated from the radial explants. (d) Isolated HPCs were lyzed and mRNA was isolated. Using RT-PCR followed by real-time PCR, the presence of Luc expression in the isolated cells was verified (EP Luc). HPCs isolated from defects in which electroporation was not performed were used as a negative control (no EP). BLI, bioluminescence imaging; HPC, host progenitor cells; RLU, relative light unit; RT-PCR, reverse transcription PCR.

Bone formation at the fracture site

New bone that had formed in radius bone defects after injection of pBMP-9 or pLuc and electroporation was compared with new bone in a gene-delivery control group (pBMP-9 injection without electroporation) and with native radial bone of the same dimensions by performing microcomputed tomography (µCT) analysis on radii harvested 35 days post-electroporation. Significantly more bone formed in the defect site in animals that received pBMP-9 with electroporation than in animals that received pLuc with electroporation or BMP-9 injection without electroporation. Using a µCT quantitative analysis, we measured the generation of 0.6731 ± 0.08 mm3 new bone in the pBMP-9 with electroporation group. Smaller amounts of new bone were found in the pLuc with electroporation group and in the pBMP-9 without electroporation group: 0.14 ± 0.02 and 0.03 ± 0.02 mm3, respectively (Figure 3a, *P < 0.01, two-tailed t-test. n = 6 for the pBMP-9 with electroporation group and the native bone group; n = 4 for the pLuc with electroporation group and the pBMP-9 without electroporation group).

Figure 3.

Figure 3

Open in a new tab

Bone formation in the defect area. (a) Bone volume analysis: a comparison of newly formed bone in the radial defect in animals in the pBMP-9 with electroporation (BMP-9, six mice), pLuc with electroporation (Luc, four mice), and pBMP-9 without electroporation (no EP, four mice) groups and of segments of native radii having the same dimensions (native, six mice). *P < 0.01, two-tailed t-test. Note that bone formation in the defect site was significantly higher than in controls. No statistical significant difference was found between mice electroporated with pLuc and mice with pBMP-9 without electroporation. (b) µCT reconstruction comparison of defects treated with pLuc and electroporation (Luc), defects treated with pBMP-9 and electroporation (BMP-9), and defects treated with BMP-9 without electroporation (no EP). M, defect margin. Arrowhead indicates new bone formation in the defect. In the 3D images, orange regions denote new bone formation. (c) Histological sections containing newly formed bone. 1.5-mm long defects were made in mice radii, and a collagen sponge was placed in the defect site. Ten days postoperation, the radius was injected with either pBMP-9 or pLuc followed by electroporation. As a control, radii were injected with pBMP-9 but electroporation was not performed. Five weeks postelectroporation, the radii were harvested and stained using Masson's trichome. M, defect margin; U, ulna. Arrowheads indicate new bone formation; asterisks indicate soft tissue in the defect site. BMP, bone morphogenetic protein 9; µCT, microcomputed tomography.

Almost no bone formed in the defect when pLuc was used with electroporation. However, pBMP-9 with electroporation-induced prominent bone formation that was localized to the defect site and was even greater than the amount of bone at the same location in intact radius bones. When pBMP-9 was injected into the defect site but no electroporation was applied, virtually no bone formed—similar to the effect of nonosteogenic gene delivery, and with no statistical significant difference between aforementioned groups. Figure 3b displays µCT images of representative samples from three groups: pBMP-9 with electroporation, pLuc with electroporation, and pBMP-9 without electroporation.

Similar to the µCT data, histological analysis indicated that bone formation and full regeneration of the bone defect was noted only in samples that had been electroporated using pBMP-9. In samples that had been either electroporated using pLuc or injected with pBMP-9 but not electroporated, no bone formed and connective tissue was evident in the defect site. Figure 3c depicts histological sections from representative samples from each of the experimental groups, which were stained with Masson's trichrome.

Structural analysis of bone formed at the fracture site

When structural parameters of the new bone were compared with those of native, intact, radii all parameters, except for trabecular number, differed in a statistically significant manner, although new bone values approached those of the native bone (Figure 4). The bone thickness of the newly formed bone (0.20 ± 0.02 mm) was significantly lower than that of native bone (0.31 ± 0.008 mm). Both bone separation and connectivity density were significantly greater in newly formed bone (0.11 ± 0.01 mm and 32.08 ± 7.29/mm3, respectively) than in native bone (0.05 ± 0.007 mm and 3.78 ± 1.26/mm3, respectively). There was no significant difference in trabecular number: the values were 5.45 ± 0.13/mm3 for new bone and 4.86 ± 0.13/mm3 for native bone. Bone volume density and bone mineral density in new bone (0.73 ± 0.08 mm/mm and 836 ± 34 mg HA/cm3, respectively) were significantly lower than those in native bone (0.977 ± 0.002 mm/mm and 1,100 ± 18 mg HA/cm3, respectively).

Figure 4.

Figure 4

Open in a new tab

Quantitative analysis of structural parameters of induced bone formation in the defect area. (a–f) Newly formed bone in the radial defect in mice in the pBMP with electroporation group (BMP-9) was compared to segments of native radii having the same dimensions (native). *P < 0.05, two-tailed t-test, n = 6 in each group. The structural parameters include: (a) bone thickness (mm); (b) trabecular number (1/mm); (c) bone separation (mm); (d) connectivity density (1/mm3); (e) bone volume density (BV/TV, mm/mm); and (f) bone mineral density (mg HA/cm3). BMP-9, bone morphogenetic protein 9.

Discussion

Bone regeneration is a complex process that includes multiple cellular and molecular events that must take place in a specific spatial and temporal order. On days 7–10 of fracture healing, the main events include chondrogenesis, inflammatory response, and bone formation from osteoprogenitor cells. These events are followed by recruitment of stem cells and osteoprogenitor cells and by subsequent bone formation.30 It is clear, then, that if one's aim is to regenerate a bone defect, one must carefully consider the cell's place in the therapeutic strategy.

A potential source for the cellular component could be either the host's progenitor cells or implanted stem cells. As previously reported, mesenchymal stem cells engineered to express BMPs can differentiate and contribute to the process of bone formation in vivo.8,13,29,31,32,33,34,35 To eliminate the need for mesenchymal stem cell grafting, expansion, and engineering, however, we studied the potential of direct gene delivery for bone formation and regeneration. Few attempts have been made to utilize in vivo electroporation for bone formation, and these have demonstrated the feasibility of this method when genes encoding for BMP are used, however in ectopic sites.19,20,21 In the present work, we targeted the HPC population: 13 days after a radial defect was created (3 days after plasmid injection followed by electroporation) we found HPCs in the defect site and, moreover, transgene expression in those cells. Our findings show that the HPCs indeed received and expressed the transgene, and thereby induced bone regeneration at the defect site.

Major technical challenges that arise when tissue-engineering modalities are used for bone augmentation are localization and shaping of the newly formed bone. Collagen sponges, used as carriers of rhBMP-2 and scaffolds for bone formation, were recently used for sinus floor augmentation with impressive results.36 Our data demonstrate a similar role for collagen sponges in regeneration of bone in the radial defect model we investigated (Figure 3). The collagen sponge provided a suitable scaffold for tissue formation in the defect site, in which HPCs were abundant. Our selection of needle electrodes was another factor affecting localization of bone formation as it limited the area in which the electrical pulse was administrated and in which the gene was delivered.37

After identifying the appropriate target cell population, one should carefully consider which gene should be delivered and what delivery technique will be used. Direct gene delivery has been used in small and large animal models to induce bone formation, both in ectopic sites and in defect regeneration models.12,20,22,38,39,40 It has repeatedly been shown that transient gene expression of members of the BMP family (BMP-2, -4, -6, and -9) is sufficient for bone formation.12,20,22,38,39,40 The transgene expression pattern noted in the present study is similar to the pattern found when ultrasound was used as a transfection agent;22 transgene expression was transient, ending as soon as 24 days postelectroporation. Our findings, therefore, are in accord with those in previous publications, and they support the hypothesis that brief expression of a BMP gene is enough for bone formation and regeneration.

A careful analysis of bone formation is necessary to evaluate the success of the regeneration technique used. In this study, both the µCT-based analysis and the histological analysis of newly formed bone in the defect site revealed differences between native bone and new bone created in the regeneration site. Bone volume found in regenerated defects was significantly higher than that found in native radii. Whereas bone thickness, bone volume density, and bone mineral density were found to be significantly higher in native bone; bone separation and connectivity density were significantly lower in native bone, compared with new bone found in the defect site; the trabecular number was lower also, but not significantly. Taken together, these data indicate that bone found in the defect site is immature and its structure does not resemble that of fully mature bone. However, based on observations made by us in a similar defect regeneration model, in which mesenchymal stem cells expressing BMP-2 were implanted, we can infer that bone formed in the defect site will remodel in time and will eventually exhibit structural and biomechanical properties that are more similar to those of native bone.41

As mentioned before, multiple fractures and nonunion fractures pose major challenges to orthopedics,1 and while autologous bone grafts are the gold-standard treatment for such conditions, they may result in morbidity at the donor site.2 rhBMP-2 and rhBMP-7 are the only biological solutions currently available to avoid bone harvesting.3,4 Our work suggests another clinical route, in which localized transient expression of an osteogenic gene in the defect site promotes bone regeneration. Whereas recombinant protein therapy demands use of megadoses of the protein,6 our technique requires relatively inexpensive plasmid DNA in small amounts. It is important to note, however, that this particular bone regeneration technology needs to be more thoroughly explored. To test its ability to bridge clinically relevant bone defects a large animal model study should be performed. However, recent publication encourages the notion that in vivo electroporation can be applicable in large animal models and subsequently in humans; Marshall et al. report that plasmid delivery through electroporation significantly increased cardiac expression of vascular endothelial growth factor in a pig model compared with injection of plasmid alone.42

The use of other means of nonviral gene delivery should also be explored, especially the use of ultrasound, which can be easily extended to the clinical setting.22 In addition, viral vectors that do not integrate into the cells' genome, could also serve as a potential safe therapy in cases on bone repair. For example, recombinant adeno–associated virus-coated allografts, induce temporary localized transgene expression, which is sufficient to induce bone repair and graft revitalization.43,44,45,46 We envision that direct gene delivery for regeneration of massive bone defects will play a central role in orthopedics in the future.

Materials and Methods

Plasmids. Plasmids encoding for the genes luciferase (pLuc) and BMP-9 (pBMP-9) were amplified using standard procedures and purified using an EndoFree Kit (Qiagen, Valancia, CA). pBMP is a kind gift from Dr Gregory A. Helm, University of Virginia, Charlottesville, VA.

Surgical procedure. The Hebrew University of Jerusalem's Institutional Animal Care and Use Committee approved all animal procedures, which were consistent with guidelines established in the Guide for the Care and Use of Laboratory Animals (http:/www.nap.edu/openbook.php?record_id=5140; accessed 1 May 2010). All animals were provided with water and food ad libitum throughout the duration of the study. In all in vivo experiments mice (C3H/Hen females, 8–10 weeks old) were anesthetized with a mixture of xylazine and ketamine (0.15% xylazine and 0.85% ketamine), which was injected intraperitoneally at 1 µl/g body weight. The method by which we created a nonunion segmental radial fracture was based on a previously described protocol.8 Briefly, female C3H/HeN mice, each between 8 and 10 weeks of age, were anesthetized in the manner described above. The skin was cut and a 1.5-mm long defect was created in the right radius bone. A 1.5-mm long collagen sponge (DuraGen; Integra Neurosciences, Plainsboro, NJ) was implanted into the defect and the skin was sutured. Surgery was performed in 27 mice, and the animals were randomly allocated to one of the following groups: (i) pBMP-9 with electroporation (n = 6); (ii) pBMP-9 without electroporation (n = 4); (iii) pLuc with electroporation (n = 9); (iv) no gene delivery (n = 8).

Electroporation. Regeneration of bone in the radial defect was induced by pBMP-9 injection followed by in vivo electroporation 10 days after the operation. A mixture of pBMP-9 in phosphate-buffered saline (50 µg pBMP-9 in 18 µl phosphate-buffered saline ×1) was injected into the radial defect site in six mice by using a 27-gauge needle under fluoroscopic guidance. Immediately after the injection, in vivo electroporation was performed. Using needle electrodes, which were placed at both sides of the radial defect (1–2 mm apart) under fluoroscopic guidance, electrical pulses were delivered directly to the defect site (Figure 5). To generate these electrical pulses, we used an ECM 830 electroporator (BTX, Harvard Apparatus, Holliston, MA; kindly provided by Prof Israel Vlodavsky, Cancer and Vascular Biology Research Center, The Bruce Rappaport Faculty of Medicine, Haifa, Israel). For each procedure we used eight 100-V pulses at 20 msec per pulse with a 100-msec interval between pulses. The optimal amount of plasmid had been determined in preliminary studies. To monitor gene expression in the defect site (and for use as a control), the same procedure was performed in four animals using 50 µg pLuc in 18 µl phosphate-buffered saline × 1. In a different group, 50 µg pBMP-9 was injected into radial defects in four mice 10 days postoperation and no electroporation was performed. All radii were harvested 5 weeks after electroporation and/or plasmid injection, and analyzed for bone formation by performing µCT and histological studies.

Figure 5.

Figure 5

Open in a new tab

Setup of the electroporation system. A 1.5-mm long defect was made in the mouse radius, and a collagen sponge was placed in the defect site. Ten days after surgery pLuc or pBMP-9 was injected into the defect site, and electroporation was immediately performed using needle electrodes. (a) Mouse ready for electroporation. The animal is mounted on the fluoroscope detector and needle electrodes are placed. (b) Locations of the electrodes and the needle used for plasmid injection are verified using the fluoroscope.

Histological analysis of scaffold population by recipient cells. To evaluate the population of the scaffold implanted in the defect site, three mice were sacrificed at 5, 7, or 10 days postoperation. Tissue samples were removed and then processed and stained with hematoxylin and eosin for histological analysis in a manner described previously.22 Briefly, tissue samples were fixed in 70% ethanol, passed through a graded series of ethanol solutions, and embedded in paraffin. Sections (5 µm thick) were cut from each paraffin block by using a motorized microtome (Leica Microsystems, Wetzlar, Germany). Hematoxylin and eosin staining was performed to evaluate the morphological characteristics of the tissue. Our analysis showed that on day 10 postoperation the implanted collagen sponge was populated by HPCs (Figure 1), and thus this time point was chosen for gene delivery.

Imaging of luciferase expression in the fracture site. Luciferase expression in the defect site was quantified using a bioluminescence imaging system, as described previously.47 Briefly, this cooled charge-coupled device tracking system consists of a cooled charge-coupled device camera (model LN/CCD-1300EB) equipped with an ST-133 controller and a 50-mm Nikon lens (Roper Chemiluminescence Imaging System; Roper Scientific, Princeton Instrument, Trenton, NJ). In this system, a pseudocolor image represents light intensity (blue signifies least intense and red most intense). The integrated light is the result of a 2-minutes exposure and acquisition. Before light detection, the mice were anesthetized with a ketamine–xylazine mixture. Ten minutes before: we monitored light emission, the animals were given intraperitoneal injections of beetle luciferin (Promega, Madison, WI) in phosphate-buffered saline (126 mg/kg body weight). The mice were then exposed to the cooled charge-coupled device system and the composite image was transferred to a personal computer by using a plug-in module for further analysis.

Transgene expression in isolated HPCs. To verify transgene expression in HPCs that had been isolated from the defect site, an additional group of five mice underwent surgery as described earlier. Ten days after the radial defect had been created, 25 µg pLuc was injected into the defect site and electroporation was performed, as we already described. Three days later, gene activity was imaged using the bioluminescence imaging system and found to be localized to the defect site. The mice were then sacrificed, and cells were isolated from retrieved scaffolds, using a method previously described.48 Briefly, collagen sponges that had been implanted in the defect site were retrieved and washed thoroughly with sterile phosphate-buffered saline. Explants were minced into small pieces using sterile tools and digested in a collagenase solution (3 mg/ml collagenase D; Roche Diagnostics, Mannheim, Germany) in Dulbecco's modified Eagle's medium at 37 °C. The digestion solution was centrifuged (5 minutes, 4 °C, 1,200 r.p.m.), and the digested cells were plated in a culture dish in complete Dulbecco's modified Eagle's medium containing 20% fetal bovine serum. Total RNA was purified from the isolated cells 24 hours after cell isolation by using TRIzol reagent (Invitrogen Life Technologies, Paisley, UK) according to the manufacturer protocol. Reverse transcription-PCR was performed using 2 µg total RNA. Real-time PCR was performed for the Luc gene by using an ABI 7400 Real Time PCR system (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. The following primers were used: Luc forward primer: GACGAACACTTCTTCATCGTTGAC; reverse primer: GGGTGTTGGAG CAAGATGGA; TaqMan probe: fam- CTGAAGTCTCTGATTAAGTAC-bq.

Analysis of bone formation and structure. Mice were sacrificed 5 weeks after gene delivery; their front right limbs were harvested, fixed in 10% formalin, and scanned using a high-resolution µCT system (Desktop µCT 40; Scanco Medical AG, Bassersdorf, Switzerland). Analysis was performed as previously described.41 Microtomographic slices were acquired at 1,000 projections and reconstructed at a spatial nominal resolution of 20 µm. A constrained three-dimensional Gaussian filter (σ = 0.8 and support = 1) was used to partly suppress the noise in the volumes. The mineralized tissue was segmented using a global thresholding procedure. In addition to the visual assessment of structural images, morphometric indexes were determined from the microtomographic datasets by using direct three-dimensional morphometry. Structural metrics measured using µCT are closely correlated with those measured using standard histomorphometry.49 The following morphometric indexes were determined: (i) total volume of bone tissue, including new bone and cavities (total volume, mm3); (ii) volume of bone tissue (bone volume, mm3); (iii) bone tissue density, the bone volume/total volume ratio; (iv) bone mineral density (mg hydroxyapatite/cm3); (v) Bone thickness (mm); (vi) trabecular number (1/mm); (vii) bone separation (mm); and (viii) connectivity density (1/mm3). All structural parameters of the newly formed bone were compared with untreated contralateral radii. Following µCT analysis samples were processed histologically as noted, and stained using Masson's trichrome.

Statistical analysis. A two-tailed Student's t-test was performed to determine significant differences between experimental and control groups. The P value was set at a value of <0.05. Results are presented as means ± SE.

Acknowledgments

We would like to acknowledge Boris Rubinsky from the School of Computer Science and Engineering, at the Hebrew University of Jerusalem, for his tremendous help with the electroporation process. We also thank Israel Vlodavsky from the Cancer and Vascular Biology Research Center, The Bruce Rappaport Faculty of Medicine, Technion, Haifa, Israel for his help. This research was partially supported by funds from The Eshkol Scholarship for PhD Students, the Ministry of Science, Culture and Sport, State of Israel, and The Foulkes Foundation Fellowship, London, UK (N.K.-B.). We also acknowledge funding from the National Institutes of Health Grants No. R01AR056694-01A1 and R01DE019902-01 (D.G., Z.G., W.T. and G.P.).

REFERENCES

  1. Pountos I, Jones E, Tzioupis C, McGonagle D., and, Giannoudis PV. Growing bone and cartilage. The role of mesenchymal stem cells. J Bone Joint Surg Br. 2006;88:421–426. doi: 10.1302/0301-620X.88B4.17060. [DOI] [PubMed] [Google Scholar]
  2. Kneser U, Schaefer DJ, Polykandriotis E., and, Horch RE. Tissue engineering of bone: the reconstructive surgeon's point of view. J Cell Mol Med. 2006;10:7–19. doi: 10.1111/j.1582-4934.2006.tb00287.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Biasibetti A, Aloj D, Di Gregorio G, Massè A., and, Salomone C. Mechanical and biological treatment of long bone non-unions. Injury. 2005;36 Suppl 4:S45–S50. doi: 10.1016/j.injury.2005.10.013. [DOI] [PubMed] [Google Scholar]
  4. De Biase P., and, Capanna R. Clinical applications of BMPs. Injury. 2005;36 Suppl 3:S43–S46. doi: 10.1016/j.injury.2005.07.034. [DOI] [PubMed] [Google Scholar]
  5. Govender S, Csimma C, Genant HK, Valentin-Opran A, Amit Y, Arbel R, et al. Recombinant human bone morphogenetic protein-2 for treatment of open tibial fractures: a prospective, controlled, randomized study of four hundred and fifty patients. J Bone Joint Surg Am. 2002;84-A:2123–2134. doi: 10.2106/00004623-200212000-00001. [DOI] [PubMed] [Google Scholar]
  6. Valentin-Opran A, Wozney J, Csimma C, Lilly L., and, Riedel GE. Clinical evaluation of recombinant human bone morphogenetic protein-2. Clin Orthop Relat Res. 2002. pp. 110–120. [DOI] [PubMed]
  7. Dai KR, Xu XL, Tang TT, Zhu ZA, Yu CF, Lou JR, et al. Repairing of goat tibial bone defects with BMP-2 gene-modified tissue-engineered bone. Calcif Tissue Int. 2005;77:55–61. doi: 10.1007/s00223-004-0095-z. [DOI] [PubMed] [Google Scholar]
  8. Moutsatsos IK, Turgeman G, Zhou S, Kurkalli BG, Pelled G, Tzur L, et al. Exogenously regulated stem cell-mediated gene therapy for bone regeneration. Mol Ther. 2001;3:449–461. doi: 10.1006/mthe.2001.0291. [DOI] [PubMed] [Google Scholar]
  9. Peterson B, Zhang J, Iglesias R, Kabo M, Hedrick M, Benhaim P, et al. Healing of critically sized femoral defects, using genetically modified mesenchymal stem cells from human adipose tissue. Tissue Eng. 2005;11:120–129. doi: 10.1089/ten.2005.11.120. [DOI] [PubMed] [Google Scholar]
  10. Shen HC, Peng H, Usas A, Gearhart B, Fu FH., and, Huard J. Structural and functional healing of critical-size segmental bone defects by transduced muscle-derived cells expressing BMP4. J Gene Med. 2004;6:984–991. doi: 10.1002/jgm.588. [DOI] [PubMed] [Google Scholar]
  11. Turgeman G, Pittman DD, Müller R, Kurkalli BG, Zhou S, Pelled G, et al. Engineered human mesenchymal stem cells: a novel platform for skeletal cell mediated gene therapy. J Gene Med. 2001;3:240–251. doi: 10.1002/1521-2254(200105/06)3:3<240::AID-JGM181>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
  12. Betz OB, Betz VM, Nazarian A, Pilapil CG, Vrahas MS, Bouxsein ML, et al. Direct percutaneous gene delivery to enhance healing of segmental bone defects. J Bone Joint Surg Am. 2006;88:355–365. doi: 10.2106/JBJS.E.00464. [DOI] [PubMed] [Google Scholar]
  13. Gafni Y, Pelled G, Zilberman Y, Turgeman G, Apparailly F, Yotvat H, et al. Gene therapy platform for bone regeneration using an exogenously regulated, AAV-2-based gene expression system. Mol Ther. 2004;9:587–595. doi: 10.1016/j.ymthe.2003.12.009. [DOI] [PubMed] [Google Scholar]
  14. Kang Q, Sun MH, Cheng H, Peng Y, Montag AG, Deyrup AT, et al. Characterization of the distinct orthotopic bone-forming activity of 14 BMPs using recombinant adenovirus-mediated gene delivery. Gene Ther. 2004;11:1312–1320. doi: 10.1038/sj.gt.3302298. [DOI] [PubMed] [Google Scholar]
  15. Li JZ, Hankins GR, Kao C, Li H, Kammauff J., and, Helm GA. Osteogenesis in rats induced by a novel recombinant helper-dependent bone morphogenetic protein-9 (BMP-9) adenovirus. J Gene Med. 2003;5:748–756. doi: 10.1002/jgm.412. [DOI] [PubMed] [Google Scholar]
  16. Schreiber RE, Blease K, Ambrosio A, Amburn E, Sosnowski B., and, Sampath TK. Bone induction by AdBMP-2/collagen implants. J Bone Joint Surg Am. 2005;87:1059–1068. doi: 10.2106/JBJS.D.02025. [DOI] [PubMed] [Google Scholar]
  17. Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science. 2003;302:415–419. doi: 10.1126/science.1088547. [DOI] [PubMed] [Google Scholar]
  18. Teichler ZD. US gene therapy in crisis. Trends Genet. 2000;16:272–275. doi: 10.1016/s0168-9525(00)02025-4. [DOI] [PubMed] [Google Scholar]
  19. Abdelaal MM, Tholpady SS, Kessler JD, Morgan RF, Ogle RC. BMP-9-transduced prefabricated muscular flaps for the treatment of bony defects. J Craniofac Surg. 2004;15:736–741. discussion 742–734. doi: 10.1097/00001665-200409000-00007. [DOI] [PubMed] [Google Scholar]
  20. Kawai M, Bessho K, Kaihara S, Sonobe J, Oda K, Iizuka T, et al. Ectopic bone formation by human bone morphogenetic protein-2 gene transfer to skeletal muscle using transcutaneous electroporation. Hum Gene Ther. 2003;14:1547–1556. doi: 10.1089/104303403322495052. [DOI] [PubMed] [Google Scholar]
  21. Kishimoto KN, Watanabe Y, Nakamura H., and, Kokubun S. Ectopic bone formation by electroporatic transfer of bone morphogenetic protein-4 gene. Bone. 2002;31:340–347. doi: 10.1016/s8756-3282(02)00825-6. [DOI] [PubMed] [Google Scholar]
  22. Sheyn D, Kimelman-Bleich N, Pelled G, Zilberman Y, Gazit D., and, Gazit Z. Ultrasound-based nonviral gene delivery induces bone formation in vivo. Gene Ther. 2008;15:257–266. doi: 10.1038/sj.gt.3303070. [DOI] [PubMed] [Google Scholar]
  23. Gehl J. Electroporation: theory and methods, perspectives for drug delivery, gene therapy and research. Acta Physiol Scand. 2003;177:437–447. doi: 10.1046/j.1365-201X.2003.01093.x. [DOI] [PubMed] [Google Scholar]
  24. Golzio M, Teissié J., and, Rols MP. Cell synchronization effect on mammalian cell permeabilization and gene delivery by electric field. Biochim Biophys Acta. 2002;1563:23–28. doi: 10.1016/s0005-2736(02)00369-3. [DOI] [PubMed] [Google Scholar]
  25. Wells DJ. Electroporation and ultrasound enhanced non-viral gene delivery in vitro and in vivo. Cell Biol Toxicol. 2010;26:21–28. doi: 10.1007/s10565-009-9144-8. [DOI] [PubMed] [Google Scholar]
  26. Pelled G, Ben-Arav A, Hock C, Reynolds DG, Yazici C, Zilberman Y, et al. Direct gene therapy for bone regeneration: gene delivery, animal models and outcome measures. Tissue Eng Part A Rev. 2010;16:13–20. doi: 10.1089/ten.teb.2009.0156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yamaguchi A. Regulation of differentiation pathway of skeletal mesenchymal cells in cell lines by transforming growth factor-beta superfamily. Semin Cell Biol. 1995;6:165–173. doi: 10.1006/scel.1995.0023. [DOI] [PubMed] [Google Scholar]
  28. Yamaguchi A, Komori T., and, Suda T. Regulation of osteoblast differentiation mediated by bone morphogenetic proteins, hedgehogs, and Cbfa1. Endocr Rev. 2000;21:393–411. doi: 10.1210/edrv.21.4.0403. [DOI] [PubMed] [Google Scholar]
  29. Aslan H, Zilberman Y, Arbeli V, Sheyn D, Matan Y, Liebergall M, et al. Nucleofection-based ex vivo nonviral gene delivery to human stem cells as a platform for tissue regeneration. Tissue Eng. 2006;12:877–889. doi: 10.1089/ten.2006.12.877. [DOI] [PubMed] [Google Scholar]
  30. Einhorn TA. The science of fracture healing. J Orthop Trauma. 2005;19 10 Suppl:S4–S6. doi: 10.1097/00005131-200511101-00002. [DOI] [PubMed] [Google Scholar]
  31. Aslan H, Zilberman Y, Kandel L, Liebergall M, Oskouian RJ, Gazit D, et al. Osteogenic differentiation of noncultured immunoisolated bone marrow-derived CD105+ cells. Stem Cells. 2006;24:1728–1737. doi: 10.1634/stemcells.2005-0546. [DOI] [PubMed] [Google Scholar]
  32. Gazit D, Turgeman G, Kelley P, Wang E, Jalenak M, Zilberman Y, et al. Engineered pluripotent mesenchymal cells integrate and differentiate in regenerating bone: a novel cell-mediated gene therapy. J Gene Med. 1999;1:121–133. doi: 10.1002/(SICI)1521-2254(199903/04)1:2<121::AID-JGM26>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
  33. Hasharoni A, Zilberman Y, Turgeman G, Helm GA, Liebergall M., and, Gazit D. Murine spinal fusion induced by engineered mesenchymal stem cells that conditionally express bone morphogenetic protein-2. J Neurosurg Spine. 2005;3:47–52. doi: 10.3171/spi.2005.3.1.0047. [DOI] [PubMed] [Google Scholar]
  34. Sheyn D, Pelled G, Zilberman Y, Talasazan F, Frank JM, Gazit D, et al. Nonvirally engineered porcine adipose tissue-derived stem cells: use in posterior spinal fusion. Stem Cells. 2008;26:1056–1064. doi: 10.1634/stemcells.2007-0858. [DOI] [PubMed] [Google Scholar]
  35. Steinhardt Y, Aslan H, Regev E, Zilberman Y, Kallai I, Gazit D, et al. Maxillofacial-derived stem cells regenerate critical mandibular bone defect. Tissue Eng Part A. 2008;14:1763–1773. doi: 10.1089/ten.tea.2008.0007. [DOI] [PubMed] [Google Scholar]
  36. Triplett RG, Nevins M, Marx RE, Spagnoli DB, Oates TW, Moy PK, et al. Pivotal, randomized, parallel evaluation of recombinant human bone morphogenetic protein-2/absorbable collagen sponge and autogenous bone graft for maxillary sinus floor augmentation. J Oral Maxillofac Surg. 2009;67:1947–1960. doi: 10.1016/j.joms.2009.04.085. [DOI] [PubMed] [Google Scholar]
  37. Granot Y, Ivorra A, Maor E., and, Rubinsky B. In vivo imaging of irreversible electroporation by means of electrical impedance tomography. Phys Med Biol. 2009;54:4927–4943. doi: 10.1088/0031-9155/54/16/006. [DOI] [PubMed] [Google Scholar]
  38. Egermann M, Baltzer AW, Adamaszek S, Evans C, Robbins P, Schneider E, et al. Direct adenoviral transfer of bone morphogenetic protein-2 cDNA enhances fracture healing in osteoporotic sheep. Hum Gene Ther. 2006;17:507–517. doi: 10.1089/hum.2006.17.507. [DOI] [PubMed] [Google Scholar]
  39. Ishihara A, Zekas LJ, Weisbrode SE, Bertone AL. Comparative efficacy of dermal fibroblast-mediated and direct adenoviral bone morphogenetic protein-2 gene therapy for bone regeneration in an equine rib model. Gene Ther. 2010;17:733–744. doi: 10.1038/gt.2010.13. [DOI] [PubMed] [Google Scholar]
  40. Kawai M, Bessho K, Maruyama H, Miyazaki J., and, Yamamoto T. Human BMP-2 gene transfer using transcutaneous in vivo electroporation induced both intramembranous and endochondral ossification. Anat Rec A Discov Mol Cell Evol Biol. 2005;287:1264–1271. doi: 10.1002/ar.a.20245. [DOI] [PubMed] [Google Scholar]
  41. Kallai I, van Lenthe GH, Ruffoni D, Zilberman Y, Müller R, Pelled G, et al. Quantitative, structural, and image-based mechanical analysis of nonunion fracture repaired by genetically engineered mesenchymal stem cells. J Biomech. 2010;43:2315–2320. doi: 10.1016/j.jbiomech.2010.04.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Marshall WG, Jr, Boone BA, Burgos JD, Gografe SI, Baldwin MK, Danielson ML, et al. Electroporation-mediated delivery of a naked DNA plasmid expressing VEGF to the porcine heart enhances protein expression. Gene Ther. 2010;17:419–423. doi: 10.1038/gt.2009.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ito H, Koefoed M, Tiyapatanaputi P, Gromov K, Goater JJ, Carmouche J, et al. Remodeling of cortical bone allografts mediated by adherent rAAV-RANKL and VEGF gene therapy. Nat Med. 2005;11:291–297. doi: 10.1038/nm1190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Koefoed M, Ito H, Gromov K, Reynolds DG, Awad HA, Rubery PT, et al. Biological effects of rAAV-caAlk2 coating on structural allograft healing. Mol Ther. 2005;12:212–218. doi: 10.1016/j.ymthe.2005.02.026. [DOI] [PubMed] [Google Scholar]
  45. Nasu T, Ito H, Tsutsumi R, Kitaori T, Takemoto M, Schwarz EM, et al. Biological activation of bone-related biomaterials by recombinant adeno-associated virus vector. J Orthop Res. 2009;27:1162–1168. doi: 10.1002/jor.20860. [DOI] [PubMed] [Google Scholar]
  46. Schwarz EM.2000The adeno-associated virus vector for orthopaedic gene therapy Clin Orthop Relat Res379 Suppl): S31–S39. [DOI] [PubMed]
  47. Bar I, Zilberman Y, Zeira E, Galun E, Honignan A, Turgeman G, et al. Molecular Imaging of the skeleton: quantitative real time bioluminescence in transgenic mice. J Bone and Mineral Res. 2003;18:570–578. doi: 10.1359/jbmr.2003.18.3.570. [DOI] [PubMed] [Google Scholar]
  48. Sakaguchi Y, Sekiya I, Yagishita K, Ichinose S, Shinomiya K., and, Muneta T. Suspended cells from trabecular bone by collagenase digestion become virtually identical to mesenchymal stem cells obtained from marrow aspirates. Blood. 2004;104:2728–2735. doi: 10.1182/blood-2003-12-4452. [DOI] [PubMed] [Google Scholar]
  49. Müller R, Van Campenhout H, Van Damme B, Van Der Perre G, Dequeker J, Hildebrand T, et al. Morphometric analysis of human bone biopsies: a quantitative structural comparison of histological sections and micro-computed tomography. Bone. 1998;23:59–66. doi: 10.1016/s8756-3282(98)00068-4. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES