Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2010 Nov 12;77(1):163–171. doi: 10.1128/AEM.01673-10

Real-Time PCR Assay To Differentiate Listeriolysin S-Positive and -Negative Strains of Listeria monocytogenes▿

Evelyn M Clayton 1, Colin Hill 1,2,*, Paul D Cotter 2,3,*, R Paul Ross 2,3
PMCID: PMC3019701  PMID: 21075895

Abstract

Due to the severity of the food-borne infection listeriosis, strict legislation governs the detectable and permissible limits at which Listeria monocytogenes is permitted in foods. These requirements, coupled with the ubiquitous nature of L. monocytogenes strains and the potential for epidemic outbreaks, mean that the pathogen can devastate affected sectors of the food industry. Although almost all L. monocytogenes strains have the potential to cause listeriosis, those implicated in the vast majority of epidemics belong to a subset of strains belonging to evolutionary lineage I. It has been established that a significant proportion of these strains, including those implicated in the majority of outbreaks, produce an additional hemolysin, designated listeriolysin S (LLS), which may be responsible for the enhanced virulence of these strains. In order to ultimately establish this definitively, it is important to first be able to rapidly discriminate between LLS-positive and -negative strains. Here, after essential genes within the LLS-encoding cluster, Listeria pathogenicity island 3, were identified by deletion mutagenesis, a real-time PCR assay which targets one such gene, llsX, was developed as a means of identifying LLS-positive L. monocytogenes. The specificity of the assay was validated against a panel of 40 L. monocytogenes strains (20 of which were LLS positive) and 25 strains representative of other Listeria species. Furthermore, 1 CFU of an LLS-positive strain per 25 g/ml of spiked foods was detected in less than 30 h when the assay was coupled with culture enrichment. The detection limit of this assay was 10 genome equivalents.


The Gram-positive intracellular pathogen Listeria monocytogenes is the etiological agent of listeriosis, a predominantly food-borne infection with well-defined risk groups, which include neonates, pregnant women, the elderly, and immunocompromised individuals. Initial manifestations of the infection are often nonspecific (e.g., influenza-like symptoms and gastroenteritis), with more severe clinical consequences (e.g., septicemia, meningitis, encephalitis, perinatal infections, and abortion) developing in susceptible populations (6, 18, 24, 36, 47, 56). Related outbreaks are most commonly associated with a diverse range of ready-to-eat (RTE) meats, dairy products, vegetables, and fish (3, 12, 16, 46, 53, 54). Although the incidence of listeriosis appears to be decreasing in the United States and other industrialized countries, increases have been reported for some European countries (5, 11, 28, 30, 32, 34). Occurrences of sporadic and epidemic cases are fortunately rare compared to those of other food-borne diseases. However, as a consequence of its pathogenicity, L. monocytogenes carries the highest hospitalization rates among known food-borne pathogens (91%), with additional long-term sequelae reported in many cases (26). In the United States, 20% of all clinical infections result in death, and related fatalities are estimated to reach 500 per annum (5). Indeed, after salmonellosis, listeriosis is the second most frequent cause of food-borne infection-related deaths in Europe and the United States, and in addition to the associated human costs, such outbreaks also have considerable financial implications for the food industry (1). Unfortunately, L. monocytogenes is especially problematic due to its ubiquitous nature, intrinsic physiological resistance to various environmental stresses, ability to grow at a wide range of temperatures (0 to 45°C), and propensity to persist within food processing centers and retail and distribution outlets for long periods of time (14, 52). In light of the high fatality rates associated with the infection (6), strict legislation governs both the detection limits and permissible levels of L. monocytogenes in RTE foods. The U.S. Food and Drug Administration (FDA) maintains a zero-tolerance policy (absent in 25 g of food), while in Europe, legislation (no. 2073/2005) imposes a zero-tolerance policy in respect to certain foods destined for high-risk consumer groups and otherwise limits these bacteria to below 100 CFU/g (12a). As a consequence, large quantities of foods are deemed unsuitable for human consumption each year and destroyed. Unsurprisingly, the associated economic burden is significant and is further compounded by product recalls, which incur annual costs that are estimated to reach $1.2 to 2.4 billion in the United States (23).

However, given that not all L. monocytogenes strains have an equal capacity to cause disease, the application of stringent zero-tolerance policies to all L. monocytogenes strains is questionable. Indeed, more than 90% of human listeriosis cases are caused by three specific L. monocytogenes serotypes, belonging to lineage I (i.e., serotypes 1/2b and 4b) and lineage II (i.e., serotype 1/2a), with serotype 4b implicated in the majority of listeriosis epidemics (17, 29, 38). Thus, if assays which could differentiate between high- and low-virulence potential strains of L. monocytogenes were to be developed, one could envisage the introduction of different tolerance levels reflective of the virulence of the strain, in a manner analogous to that which already exists for Escherichia coli strains with a high virulence potential (e.g., E. coli O157:H7). However, the lack of a molecular explanation for the enhanced virulence of certain strains has hampered previous developments along these lines (9). Recently, premature stop codon (PMSC) mutations in the inlA gene, which encodes the key virulence factor internalin A (InlA), have been reported worldwide (13, 19, 27, 41, 45). InlA facilitates the uptake of L. monocytogenes by epithelial cells that express the human isoform of E-cadherin, and mutations of InlA appear to be responsible for attenuated mammalian virulence (40, 55). Such PMSC mutations have been identified among serotypes of lineages I and II, have seldom been found in epidemic clone strains of serotype 4b, and have thus provided a molecular marker for single-nucleotide polymorphism (SNP) genotyping assays (55). Alternative explanations exist in that it has also been established that a subset of strains of lineage I L. monocytogenes produce an additional virulence factor known as listeriolysin S (LLS), which is a cytolysin belonging to the extended family of streptolysin S (SLS)-like peptides (8). SLS factors are associated predominantly with group A streptococci, for which they significantly enhance the pathogenicity of carrier strains by contributing to cytotoxicity, inflammatory activation, and polymorphonuclear neutrophil (PMN) resistance, thereby playing a role in necrosis and systemic spread (42). SLS-like factors are also present in some of the most notorious Gram-positive pathogens, including Staphylococcus aureus and Clostridium botulinum. Studies have demonstrated that LLS plays a role in the survival of L. monocytogenes in PMNs and also contributes to its virulence in the mouse model (8). It has been noted that the production of LLS is induced by oxidative stress, and it has been suggested that this pattern of induction could enhance the ability of LLS-positive L. monocytogenes to escape from the phagosome of macrophages, a key event in L. monocytogenes pathogenicity (8). The LLS cluster, designated Listeria pathogenicity island 3 (LIPI-3), has been identified only in lineage I strains and most notably in several strains which have been implicated in epidemic outbreaks. Indeed, relatively few outbreak strains analyzed to date lack LIPI-3 (8). Should it be definitively established that LLS is responsible for the enhanced virulence of a subset of lineage I strains, the ability to distinguish between LLS-positive and LLS-negative strains on the basis of the presence or absence of the associated genes would be highly desirable.

In this study, the essential nature of several genes within LIPI-3 with respect to LLS production was established through deletion mutagenesis. A real-time PCR (RT-PCR) assay employing fluorescence resonance energy transfer (FRET) hybridization probe technology was employed to detect one such gene, the llsX gene, as a means of identifying LLS-positive L. monocytogenes strains. When coupled with culture enrichment, this assay enabled the detection of as low as 1 CFU of an LLS-positive L. monocytogenes strain per 25 ml/g of milk or cooked ham in less than 30 h.

MATERIALS AND METHODS

Bacterial strains, culture media, and growth conditions.

Table 1 lists the panel of 40 L. monocytogenes strains used in this study, 20 of which were LLS positive (8). A further 25 strains representing other Listeria species (9 strains of L. innocua, 6 of L. seeligeri, 5 of L. ivanovii, 1 of L. grayi, 3 of L. welshimeri, and 1 of L. murrayi) are listed in Table 2. The streptolysin S producer Streptococcus pyogenes MGAS5005 and Staphylococcus aureus RF-122, which possesses genes potentially encoding stapholysin S, were also included. All strains were obtained from the Food Microbiology Microbial Collection (University College, Cork, Ireland) and were stored at −80°C in 40% glycerol and cultured at 37°C for 16 h before use. Listeria spp. and S. aureus were cultured in brain heart infusion (BHI) broth/agar (Oxoid, Hampshire, United Kingdom), and Streptococcus pyogenes was cultured in tryptone soy broth (Oxoid) supplemented with 0.6% yeast extract (Difco, Detroit, MI) (TSB-YE).

TABLE 1.

Listeria monocytogenes isolates screened by the llsX gene real-time PCR assay

Strain no. Equivalent name(s) Source Lineage Serotype Listeriolysin S status llsX PCR result
33104a F2365, JI-119, TS43 California outbreak, 1985 I 4b + +
33386a NI-225, H7550 Clinical (U.S. outbreak, 1998-1999) I 4b + +
33411b TS50, L.4760, FSL N3-022 Food (Halifax, Canada, outbreak, 1981) I 4b + +
33410b F4565, FSL N3-008 Clinical (Los Angeles, California, outbreak, 1985) I 4b + +
33233a H7858 Food (U.S. outbreak, 1998-1999) I 4b + +
33423a G6003 Food I 1/2b + +
33186a 20674-01 Animal I 1/2b + +
33176a 20240-954 Animal I 1/2b + +
33126a 7034 Animal I 1/2b + +
33116 ATCC 19117 Animal I 4d + +
33083a F1109 Food I 4b + +
33068a 8058 Animal I 1/2b + +
33015a 12375 Unknown I 4b + +
33008a RM2387 Food I 4b + +
33120 ATCC 19118 Animal I 4e + +
33420b NI-227, H7738 Food (U.S. outbreak, 1998-1999) I 4b + +
33032a OB001186 Food I 1/2b + +
DPC-4608, SLCC1694 Unknown I 1/2b + +
CD1078c Chicken I 1/2b + +
SLCC4157 Cow milk I 4d + +
33413a Ts45 Food (United Kingdom outbreak, 1988) I 4b − −
CD749c Ground beef I Non-4 − −
CD1198c Ground turkey II Non-4 − −
CD1121c Ground beef I 4b − −
CD1061c Pork sausage II Non-4 − −
CD1059c Pork sausage II 1/2 − −
33226a LMB0456 Unknown II 3c − −
33225a LMB0455 Unknown II 3a − −
33115a 93-500 Arabian oryx III 4c − −
33090a 7675 Animal I 1/2b − −
33077a 98-18140 Bovine tissue III 4b − −
33028a OB001102 Food I 1/2b − −
33013a ScottA Clinical (Massachusetts outbreak, 1983) I 4b − −
33007a RM2218 Food I 4b − −
CD1028c Pork sausage II Non-4 − −
NCTC7973 Clinical II 1/2a − −
CD243c Silage II 1/2a − −
CD241c Silage II 3 − −
CD1742c Pork sausage II Non-4 − −
F5817 Clinical (Massachusetts outbreak, 1983) I Non-4 − −
a

Strain acquired from Todd Ward (Agricultural Research Service, U.S. Department of Agriculture).

b

Strain acquired from Martin Wiedmann (International Life Sciences Institute).

c

Strain acquired from Catherine Donnelly (Department of Nutrition and Food Sciences, University of Vermont).

TABLE 2.

Other Listeria species screened by the llsX real-time PCR assay

Species Strain Equivalent name(s) Source llsX PCR result
L. innocua FH2333a Lettuce −
FH1890a Uncooked sausage −
FH2070a Uncooked hamburgers −
FH2117a Ham −
FH2332a Uncooked hamburgers −
FH2327a Salad/peppers −
FH2381a Frozen sausage rolls −
CD692b Dairy plant environment −
SLCC5326 Unknown −
L. ivanovii CD588b NB U4-1 Dairy plant environment −
CD291b LA29 Brie cheese −
CD165b Unknown −
CD293b LA31 Brie cheese −
CD264b Silage Silage −
L. grayi CD671b ATCC 25400 Corn stalks −
L. seeligeri CD944b Dairy plant environment −
CD931b Dairy plant environment −
CD930b Dairy plant environment −
CD943b Dairy plant environment −
CD166b ATCC 35967 Soil −
FH2062a Breakfast (cooked) −
L. welshimeri CD114b ATCC 35897 Plant −
FH1874a Omelette −
FH1968a Caesar salad −
L. murrayi F12 ATCC 25403, CLIP12517, NCTC10814 Corn stalks and leaves −
a

Strain acquired from the Public Health Microbiology Laboratory, St. Finbarr's Hospital (Douglas, Cork, Ireland).

b

Strain acquired from Catherine Donnelly (Department of Nutrition and Food Sciences, University of Vermont).

Genomic DNA isolation and quantification.

Unless otherwise stated, genomic DNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1) per the methodology described by Hoffman and Winston (21) with some modifications. Single colonies were used to inoculate 10-ml volumes of BHI broth. Following overnight incubation at 37°C, cells (1.5 ml) were harvested by centrifugation at 10,000 × g. Cells were resuspended in 200 μl of lysis buffer (2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-HCl [pH 8], 1 mM EDTA), 300 μl of acid-washed beads, and 200 μl of phenol-chloroform/isoamyl alcohol, and the mixture was vortexed for 5 min. The aqueous phase was transferred to a sterile tube, and the DNAs were precipitated with 600 μl of cold 96% ethanol and 20 μl of 5 M ammonium acetate at −20°C for several hours. Following precipitation, DNAs were pelleted by centrifugation, washed in 70% ethanol, air dried and, finally, resuspended in 50 μl of PCR-grade water and stored at −20°C. All reagents were obtained from Sigma, St. Louis, MO. A rapid DNA purification method using Chelex-100 chelating ion exchange resin (Bio-Rad Laboratories, Hercules, CA) was employed to facilitate colony PCR when appropriate. For this, approximately 20 colonies were suspended in a solution of Chelex-100 (5% [wt/vol] sterile distilled H2O [dH2O]), heated in a boiling-water bath for 12 min and rapidly cooled on ice. Clear cell lysates containing PCR-ready nucleic acid templates were collected after centrifugation at 15,000 × g for 10 min and stored at 4°C.

Deletion mutagenesis by double-crossover homologous recombination.

A deletion mutagenesis strategy was employed to investigate the contribution of the individual genes of the LIPI-3 cluster in L. monocytogenes F2365LLSCΔhly by following the methodology described by Cotter et al. (8). Deletion mutants were generated using a splicing-by-overlap-extension (SOE) procedure (22). Briefly, two PCR fragments from the DNA flanking each gene were generated with the oligonucleotide primer pairs soeA/soeB and soeC/soeD (Table 3). The products were mixed in a 1:1 ratio and combined by SOE PCR using the oligonucleotide pair soeA and soeD. The resultant product was cloned into the temperature-sensitive shuttle vector pKSV7, and the spliced product was introduced into the L. monocytogenes genome in place of the intact gene through double-crossover homologous recombination as previously described (8). The impact of each deletion was assessed by spotting 10 μl of whole-cell suspensions onto Columbia blood agar (Oxoid) containing 5% defibrinated horse blood (TCS Biosciences, Buckingham, United Kingdom) and 1 mU/ml sphingomyelinase (Sigma).

TABLE 3.

SOE primers used for deletion mutagenesis studies

LIPI-3 gene Primer designation and sequence
llsG soeA, (EcoRI)GACTGCAGAATGTGATAGGATG
soeB, ATGCACATGCACCTCATAAC
soeC, GTTATGAGGTGCATGTGCATGCAGTGAACAGGAGGTACTGA
soeD, (BamHI)CTGGATCCAAAATATTCTAATC
llsH soeA, (XbaI)AATCTAGACAACGAAAGTTTTG
soeB, CTTGTCCATAAATAACTCAT
soeC, CATGAGTTATTTATGGACAAGTTTATTATACTCAAGGTATAG
soeD, (SmaI)TTCCCCGGGTCGATCATTTTGCTGTT
llsX soeA, (EcoRI)TAAGAATTCCCGGATATTGATGC
soeB, AGATTACAAACAATCCTTTC
soeC, GAAAGGATTGTTTGTAATCTTCGACTATGAGAAAAAAGGC
soeD, (SmaI)GTACCCGGGCTTTGCTCAAGCAC
llsY soeA, (EcoRI)TTGAATTCTCTAGATGTAGAT
soeB, GTCTGCGTTCCTATTCTAATATC
soeC, CGATATTAGAATAGGAACGCAGACCTAAAGGAGCTGATGAGTAGTG
soeD, (SmaI)TCACCCGGGCTAAAAATAATCCTGTCC
llsD soeA, (XbaI)CATCTAGATTGATGTTTGTTC
soeB, AATAGGGTAAGAACTAGAGCC
soeC, GGCTCTAGTTCTTACCCTATTATGAAGAAATTGGAGGTGTGGT
soeD, (SmaI)CTTCCCGGGCAGGAAACCATACAATAC
llsP soeA, (XbaI)GTTCTAGATAATTTGGATGATA
soeB, GCATACCTGGAAATAATGTG
soeC, CACATTATTTCCAGGTATGCGAGAACCACCGTAATTGGTAA
soeD, (SmaI)TAACCCGGGTGAGCAGCAATTTCCTC
lmof2365_1120 soeA, (XbaI)TTTCTAGAGTTCGTACTAGTA
soeB, CGTTCCCCCTCCTTTTTAGAGCA
soeC, TGCTCTAAAAAGGAGGGGGAACGAACAATATTGTTTGACTATG
soeD, (SmaI)AATCCCGGGTCTAAATCTTCTACCCC

PCR primer pairs and FRET hybridization probes for real-time PCR.

Oligonucleotide primers and a FRET probe pair targeting the llsX gene of L. monocytogenes strain F2365 (National Center for Biotechnology Information [NCBI] reference sequence number NC_002973.6; gene locus lmof2365_1115) were designed by following published guidelines (7) and synthesized by Tib Molbiol (Berlin, Germany) (Table 4). The primer pair llsXF and llsXR amplify a 200-bp fragment of llsX, and the hybridization probe pair llsXFL and llsXLC recognize internal sequences within the amplified product. The probes are separated by a single nucleotide which allows a strong FRET signal to occur and are designed to anneal to the antisense strand due to a lower number of guanine bases. The donor probe llsXFL was labeled with fluorescein at its 3′ end, the acceptor probe llsXLC was labeled with light cycler 670 (LC 670) at its 5′ end, and subsequent fluorescence was measured with the Cy5 channel of the LightCycler 480 instrument (Roche Diagnostics, Mannheim, Germany).

TABLE 4.

Oligonucleotide primers and hybridization probes used in the llsX real-time PCR assay

Primer Sequence Position
llsXF TTATTGCATCAATTGTTCTAGGG 35-57
llsXR CCCCTATAAACATCATGCTAGTG 213-235
llsXFL ACTCTTTTAATGTGCCATCATTCATGTG 109-136
llsXLC ATGTAACCTAAACCAATAGCCACAAAGCA 79-107

L. monocytogenes llsX real-time PCR assay.

Real-time PCR amplification was performed using LightCycler FastStart DNA HybProbe master mix (Roche). Each PCR incorporated 2 μl of template DNAs, 10× LightCycler buffer (with the magnesium chloride adjusted to 3 mM), 0.3 μM hybridization probes, and 0.5 μM primers and adjusted to a final volume of 20 μl with nuclease-free PCR-grade water (Roche). The cycling parameters included an initial denaturation step of 95°C for 10 min followed by 45 cycles of denaturation at 95°C, annealing at 60°C, and elongation at 72°C for 10 s each. Subsequent analysis was carried out using the absolute quantification/second-derivative-maximum method of the LightCycler software. Genomic DNA from L. monocytogenes strain F2365 served as a positive control for llsX, and a negative control, in which the template was replaced with nuclease-free PCR-grade water, was included in each run.

Culture enrichment of food samples.

Retail samples of pasteurized milk and cooked ham were investigated in this study. A two-step enrichment process using Fraser broth was used to improve the sensitivity of Listeria detection by following the methodology described by O'Grady et al., with some modification (43). Two samples of each food (25 g/ml) were prepared in three independent experiments as follows: one sample served as a control, and the second was spiked with approximately 1 CFU of an overnight culture of L. monocytogenes strain F2365, i.e., 100 μl of a 10−8 dilution of an overnight culture of L. monocytogenes strain F2365 which had been freshly subcultured over 5 h. Plate count assays on BHI agar determined an average CFU content of 10 per ml. Samples were homogenized for 2 min in sterile plastic Stomacher filter bags (Seward, Norfolk, United Kingdom) containing 225 ml of half Fraser broth (Oxoid). The samples were incubated for 22 h at 30°C in 500-ml sterile conical flasks with shaking at 200 rpm (water bath model SW22; Julabo, Seelbach, Germany). A secondary enrichment was then performed whereby 100 μl of each preenrichment sample was transferred into 10 ml of full-strength Fraser broth and incubated at 37°C for 4 h with shaking as before. Crude DNA templates were prepared for real-time PCR analysis from 1.5-ml volumes of secondary enrichment broth as follows. Cell pellets were collected after centrifugation, washed three times in 300 μl of washing buffer (75 mM NaCl, 25 mM EDTA, 20 mM Tris [pH 7.5]), and resuspended in 200 μl of a 5% Chelex-100 solution containing 0.4 mg/ml proteinase K (Roche). Suspensions were incubated for 30 min at 56°C and then boiled, and the clear cell lysates containing the PCR-ready nucleic acid template were collected after centrifugation as described above. In parallel, the secondary enrichment broth was streaked onto Listeria selective agar (LSA; Oxoid).

RESULTS

Deletion of genes within the LIPI-3 gene cluster.

Previous in silico investigations have suggested that the presence of Rho-independent terminators flanking the lls gene cluster (llsA, llsG, llsH, llsX, llsB, llsY, llsD, and llsP) mark the boundaries of LIPI-3 (8). It was also suggested that LIPI-3 was acquired during the evolution of lineage I isolates and noted that a number of these isolates have apparently undergone reductive genome evolution, resulting in the loss of LIPI-3. Indeed, genes flanking the presumptive island (e.g., the lmof2365_1111 and lmof2365_1120 genes) are found in tandem in some LIPI-3-negative strains (8). In silico analysis of the cluster has revealed similarities with the clusters responsible for production of SLS, a potent bacteriocin-like streptococcal cytolytic peptide which undergoes posttranslational heterocycle formation, and of the bacteriocin microcin B17 (33, 57). For example, the putative ATP binding cassette (ABC) transport machinery coded by the llsGH genes is represented by three open reading frames (ORFs) (sagGHI) in the SLS-associated gene cluster (e.g., Streptococcus pyogenes MGAS8232, NCBI sequence reference number NC_003485.1). The llsB and llsD genes resemble sagB and sagD, respectively (8), llsP is thought to be the equivalent of sagE (18% identity and 36% similarity), and llsY shares a 19.5% identity and 37.6% similarity with sagC. In contrast, the llsX gene does not share any homology to any known gene.

A series of deletion mutants were generated to establish which of these genes are required for LLS production (Fig. 1). These deletions were generated in the L. monocytogenes F2365LLSCΔhly background (8). In this strain, the lls genes are constitutively expressed through replacement of the inducible PLLS promoter with the constitutive highly expressed Listeria promoter (PHELP; LLSC), thereby facilitating an assessment of hemolytic activity on blood agar (8). This assessment of LLS-associated hemolytic activity is facilitated by the absence of the listeriolysin O (LLO)-encoding hly gene in this strain, as the hemolytic activity of LLO had the potential to mask that of LLS (8). In addition to the previously generated ΔllsB version of this strain (8), we also created a number of additional derivatives of F2365LLSCΔhly in which the llsG, llsH, llsX, llsY, llsD, llsP, and lmof2365_1120 genes were independently deleted. Blood agar-based assays with this selection of mutants established that the six lls genes located immediately downstream of the structural gene llsA (i.e., llsG-llsD) are essential for LLS activity, whereas the deletion of the llsP gene had no effect on the hemolytic phenotype. Similarly, deletion of the downstream lmof2365_1120 gene, predicted to encode an AraC-like regulatory protein, had no effect on LLS activity.

FIG. 1.

FIG. 1.

Arrangement of the proposed listeriolysin S gene cluster mapped from L. monocytogenes strain F2365 (NCBI reference sequence number NC_002973.6 [lmof2365_1111-lmof2365_1120]) using the Clone Manager program (version 7; Science and Educational software, NC). Hemolysis of Columbia blood agar (5% defibrinated horse blood) of F2365cΔhly in which the lls genes are under the control of the constitutive highly expressed Listeria promoter (PHELP). Locations (I to VIII) of the oligonucleotide primer pair binding sites (soeA/soeD) used to delete each of the lls genes (llsG-lmof2365_1120) by splicing by overlap extension PCR. The resulting hemolytic phenotype of each deletion is indicated underneath. *, deletion mutant previously created (8).

Specificity of the L. monocytogenes llsX-specific real-time PCR assay.

While a number of genes were established to be essential for LLS production, it was the llsX gene that was chosen as a strain-specific diagnostic marker for LIPI-3, since no gene equivalent exists among other sag-like gene clusters or indeed in the NCBI database (8). The putative LlsX protein is a potential membrane spanning signal peptide of unknown function. Basic local alignment search tool (BLAST) analysis was used to confirm that the PCR primers and FRET hybridization probes which were designed to target a 200-bp region of the gene did not correspond to any other microbial DNA sequence in the nucleotide databases (2). Initial optimizations of the real-time PCR assay were performed with purified DNA from the reference strain L. monocytogenes F2365 (in which LIPI-3 was first identified [8]) to ensure specific amplification of llsX. Accordingly, amplification of a single product 200 bp in length was verified by agarose gel electrophoresis (not shown). No amplification was detected from Streptococcus pyogenes MGAS5005 and S. aureus RF-122, which contain related gene clusters (streptolysin S and the potentially encoding stapholysin S). A rapid screening method, in which Chelex-100 chelating ion exchange resin was used to extract the PCR-ready template directly from cell colonies, was then employed to evaluate the specificity of the real-time PCR assay. The capacity of the PCR to detect L. monocytogenes strains that harbor the llsX gene was demonstrated against a panel of 65 Listeria strains. All LLS-positive L. monocytogenes strains generated good amplification curves. Strains CD1078 and DPC4608/SLCC1694, which were previously reported to be LLS negative (8), are also LLS positive by RT-PCR which is likely due to the enhanced sensitivity of real-time PCR compared to that of conventional PCR. No amplification was generated from LLS-negative L. monocytogenes or a selection of other Listeria species.

Sensitivity of the assay.

The quantification and detection limits of the real-time PCR assay were determined using purified genomic DNA isolated from L. monocytogenes F2365. Amplification reactions included a range of duplicated dilutions of DNA equivalent to 100,000 target molecules down to 1 target molecule (estimated by a relative genome size of 2.94 fg [50]). DNA concentrations were verified by Nanodrop analysis (Thermo Scientific). Logarithms of DNA concentrations were plotted against their relative crossing points, which were determined by the second derivative maximum method. PCR efficiency (E) was calculated from the slope of the standard curve by the formula E = 10−1/slope, the optimal value of which is 2.0 (when the slope of the regression curve is −3.32), representing 100% doubling with each cycle. The E value, calculated over five logs representing 100,000 to 10 target cell equivalents, was 1.805 (or 90.25% doubling with each PCR cycle), and the slope was −3.9, indicating that the assay is suitable to detect the llsX gene when 10 cells or more are present and therefore can be employed for quantification purposes (Fig. 2).

FIG. 2.

FIG. 2.

Real-time PCR amplifications of serial dilutions of L. monocytogenes F2365 DNA equivalent to 100,000 to 10 target molecules. Solid squares, 100,000 cell equivalents; solid circles, 10,000 cell equivalents; triangles, 1,000 cell equivalents; inverted triangles, 100 cell equivalents; +, 10 cell equivalents; and left-facing triangles, H2O. Duplicate logarithms of DNA concentrations were plotted against their relative crossing points (inset). PCR efficiency (E) was calculated from the slope of the standard curve by the formula E = 10−1/slope and was 1.805; the slope was −3.9.

Adaptation of the real-time PCR assay for use in food.

The practical usefulness of the real-time PCR assay was determined by assessing its ability, when combined with culture enrichment (by following the methods described by O'Grady et al., with slight modifications [44]), to detect LLS-positive L. monocytogenes in retail samples of RTE foods (pasteurized milk and cooked ham). This approach taken by O'Grady and colleagues compares well with the current ISO standard method 11290-1 and has been proposed by these researchers as a potential alternative for the rapid detection of L. monocytogenes in food (44). The culture enrichment component of the rapid method is based on the ISO standard and includes 24 h of incubation in half-Fraser broth and 4 h of incubation in Fraser broth followed by DNA extraction and real-time PCR detection. The method can be performed in 2 working days compared to 7 days for the ISO standard method. We used Chelex-100 resin as a rapid means of extracting real-time PCR-ready template DNAs and adapted the method to detect the llsX gene of LIPI-3. Following culture enrichment, the assay enabled the detection of low levels of L. monocytogenes (1 CFU per 25 g/ml). When coupled with real-time PCR and Chelex-100 PCR-template purification, it was possible to reduce the time taken for culture enrichment from the recommended 72 h to 26 h. The nonspiked control samples were consistently negative.

DISCUSSION

To address the extensive labor and time required for the detection and identification of L. monocytogenes by conventional means, a number of rapid and highly sophisticated real-time PCR-based technologies have been developed (4, 44, 48, 50, 51). More specifically, such technologies are attractive due to the fact that culture-based methods, which typically involve selective enrichment, culturing on selective media, and a battery of biochemical tests and serology, can take from 5 to 10 days from the initial presumptive identification of Listeria to the identification of isolated strains to the species level. Through the targeting of a variety of different species-specific L. monocytogenes markers, such as hlyA (48), prfA (51), or RNA sequences (4, 44), real-time PCR technologies operate at a greatly reduced cost and dramatically lower the turnaround time required to detect the pathogen. These assays utilize one of the many fluorescent detection chemistries available, including the fluorescent dye SYBR green and strain-specific hybridization probe technologies based on the FRET principle of hybridization/hydrolysis assays. Indeed, the latter technology is currently adopted in commercially available diagnostic kits for L. monocytogenes detection in food samples (e.g., LightCycler Foodproof Listeria monocytogenes detection kit; Roche/Biotecon Diagnostics). While almost all L. monocytogenes strains have the potential to cause infection, it has been acknowledged for some time that lineage I L. monocytogenes strains are more frequently associated with spontaneous and epidemic outbreaks of listeriosis (25, 58). Here, a real-time PCR assay was designed to target LLS; this assay can be used in conjunction with diagnostic kits for L. monocytogenes to differentiate between LLS-positive and LLS-negative forms of the pathogen. First, a series of deletion mutants were generated to investigate which of the lls genes are required for LLS production. The llsG and llsH genes are predicted to code for an ABC transport system (LlsG is predicted to contain an ATP-binding domain, while LlsH has six membrane-spanning domains) potentially responsible for LLS export. Indeed, similar arrangements have been noted among bacteriocin transporters, and the proteins are predicted to dimerize at the cytoplasmic membrane to form an active translocation complex (20). Disruption of these genes resulted in the elimination of LLS activity from F2365LLSCΔhly. It has been previously established that the elimination of llsB, a homolog of sagB, results in a loss of LLS activity in this strain (8). Similarly, the elimination of the llsY or llsD genes, which as a consequence of being homologs of the sag genes sagC and sagD, respectively, and predicted to encode biosynthetic enzymes (8), also resulted in a loss of LLS activity. Interestingly, no loss of LLS activity was observed following the deletion of the llsP gene, which is annotated as a CAAX amino-terminal putative metalloprotease gene. It is becoming increasingly apparent that several bacteriocin clusters contain a gene encoding an endopeptidase of this class. These endopeptidases are proposed to contribute to bacteriocin immunity, i.e., self-protection, or bacteriocin maturation and transportation. Indeed, a novel immunity function has been demonstrated for the sagE and pncO genes of streptococci, the skkI gene of Lactobacillus sakei, and the plnI and plnLR genes of Lactobacillus plantarum (10, 31, 37). It may be that LLS evolved from a bacteriocin-like peptide to a peptide that lacks antibacterial activity (data not shown), thereby explaining why the llsP gene is not essential. The nonessential role of LlsP is consistent with the observation that an LLS chimeric peptide which retains an N-terminal leader (in the relevant case, a SagA leader is retained) retains in vitro hemolytic activity (39). A Δlmof2365_1120 strain also retained LLS activity. While these investigations indicate that neither the llsP nor the lmof2365_1120 gene is essential for LLS production, these results are generated using a strain in which LLS is constitutively expressed; thus, we cannot exclude the possibility that these genes have roles which contribute to the regulation of LLS production in wild-type strains.

The llsX gene was chosen as a strain-specific diagnostic marker for LIPI-3 as a consequence of its essential nature and the fact that no gene equivalent exists among other sag-like gene clusters (8). The specificity of the llsX real-time PCR assay was validated against a panel of 40 L. monocytogenes strains (20 of which were LLS positive). Further investigations focused on assessing the detection limits of the assay. In this respect, the capacity of the assay to accurately detect down to 10 cell equivalents of targeted cells per PCR was demonstrated and compares well to that of published real-time PCR assays for L. monocytogenes (43). The practical usefulness of the real-time PCR assay was determined by assessing its ability to detect LLS-positive L. monocytogenes in retail samples of RTE foods (e.g., pasteurized milk and cooked ham) and enabled the detection of 1 CFU per 25 g/ml of food samples, which complies with international recommendations of the Association of Official Analytical Chemists (AOAC) (15). To achieve this, it was necessary to employ selective culture enrichment whereby a rapid method which combines an enrichment step with real-time PCR, previously described by O'Grady et al. (43), was employed and adapted to target the llsX gene as a marker for the LIPI-3 cluster. This method has been described as a potential alternative to the ISO 11290-1 standard method and can be performed in 2 working days compared to 7 days for the ISO standard. Accordingly, the time taken for the enrichment procedure was significantly reduced, from 72 h to 26 h, when coupled with real-time PCR. Furthermore, our method incorporated a rapid PCR template purification step which utilized Chelex-100 resin, thus avoiding the need for expensive and tedious DNA isolation/purification procedures. Specifically designed for extraction of the PCR-ready template, the ion exchange resin attenuates potential PCR inhibition by scavenging polyvalent metal ions which catalyze the degradation of nucleic acids. Additionally, the resin has also been reported to improve cell lysis of Gram-positive bacteria (35, 49).

The development of a better understanding of LLS production and its contribution to virulence could potentially lead to a reassessment of the levels of L. monocytogenes that are tolerated in food, with limits being dependent on the virulence potential of the strain isolated. Should that be the case, having the ability to distinguish between LLS-positive and LLS-negative isolates will allow more effective and targeted control measures to be introduced by the food industry and the development of more effective therapeutic strategies by clinicians.

Acknowledgments

This study was funded by the Enterprise Ireland Commercialization fund.

Work for this study was performed at the University College Cork, Cork, Ireland.

We thank Todd Ward (Agricultural Research Service, U.S. Department of Agriculture), Martin Wiedmann (International Life Sciences Institute), and Catherine Donnelly (Department of Nutrition and Food Sciences, University of Vermont) for providing a number of Listeria strains.

Footnotes

▿

Published ahead of print on 12 November 2010.

REFERENCES

  • 1.Allerberger, F., and M. Wagner. 2010. Listeriosis: a resurgent foodborne infection. Clin. Microbiol. Infect. 16:16-23. [DOI] [PubMed] [Google Scholar]
  • 2.Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Anonymous. 2008. Outbreak of Listeria monocytogenes infections associated with pasteurized milk from a local dairy—Massachusetts, 2007. Morb. Mortal. Wkly. Rep. 57:1097-1100. [PubMed] [Google Scholar]
  • 4.Aparecida de Oliveira, M., E. G. Abeid Ribeiro, A. M. Morato Bergamini, and E. C. Pereira De Martinis. 2010. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR. Food Microbiol. 27:19-23. [DOI] [PubMed] [Google Scholar]
  • 5.Bennion, J. R., F. Sorvillo, M. E. Wise, S. Krishna, and L. Mascola. 2008. Decreasing listeriosis mortality in the United States, 1990-2005. Clin. Infect. Dis. 47:867-874. [DOI] [PubMed] [Google Scholar]
  • 6.Berche, P. 2005. Pathophysiology and epidemiology of listeriosis. Bull. Acad. Natl. Med. 189:507-516; discussion, 516-521. [PubMed] [Google Scholar]
  • 7.Caplin, B. E., R. P. Rasmussen, P. S. Bernard, and C. T. Wittwer. 1999. The most direct way to monitor PCR amplification for quantification and mutation detection. Biochemica 1:5-8. [Google Scholar]
  • 8.Cotter, P. D., L. A. Draper, E. M. Lawton, K. M. Daly, D. S. Groeger, P. G. Casey, R. P. Ross, and C. Hill. 2008. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes. PLoS Pathog. 4:e1000144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Crossman, L., A. Cerdeno-Tarraga, and N. R. Thomson. 2004. Chalk and cheese. Nat. Rev. Microbiol. 2:528-529. [DOI] [PubMed] [Google Scholar]
  • 10.Datta, V., S. M. Myskowski, L. A. Kwinn, D. N. Chiem, N. Varki, R. G. Kansal, M. Kotb, and V. Nizet. 2005. Mutational analysis of the group A streptococcal operon encoding streptolysin S and its virulence role in invasive infection. Mol. Microbiol. 56:681-695. [DOI] [PubMed] [Google Scholar]
  • 11.Denny, J., and J. McLauchlin. 2008. Human Listeria monocytogenes infections in Europe: an opportunity for improved European surveillance. Euro Surveill. 13:8082. [PubMed] [Google Scholar]
  • 12.Donnelly, C. W. 2001. Listeria monocytogenes: a continuing challenge. Nutr. Rev. 59:183-194. [DOI] [PubMed] [Google Scholar]
  • 12a.European Commission. 2005. Commission regulation (EC) no. 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs. Off. J. Eur. Union L338:1-26. [Google Scholar]
  • 13.Felicio, M. T., T. Hogg, P. Gibbs, P. Teixeira, and M. Wiedmann. 2007. Recurrent and sporadic Listeria monocytogenes contamination in alheiras represents considerable diversity, including virulence-attenuated isolates. Appl. Environ. Microbiol. 73:3887-3895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Freitag, N. E., G. C. Port, and M. D. Miner. 2009. Listeria monocytogenes: from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 7:623-628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gasanov, U., D. Hughes, and P. M. Hansbro. 2005. Methods for the isolation and identification of Listeria spp. and Listeria monocytogenes: a review. FEMS Microbiol. Rev. 29:851-875. [DOI] [PubMed] [Google Scholar]
  • 16.Gormley, F. J., C. L. Little, K. A. Grant, E. de Pinna, and J. McLauchlin. 2010. The microbiological safety of ready-to-eat specialty meats from markets and specialty food shops: a UK wide study with a focus on Salmonella and Listeria monocytogenes. Food Microbiol. 27:243-249. [DOI] [PubMed] [Google Scholar]
  • 17.Gray, M. J., R. N. Zadoks, E. D. Fortes, B. Dogan, S. Cai, Y. Chen, V. N. Scott, D. E. Gombas, K. J. Boor, and M. Wiedmann. 2004. Listeria monocytogenes isolates from foods and humans form distinct but overlapping populations. Appl. Environ. Microbiol. 70:5833-5841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hamon, M., H. Bierne, and P. Cossart. 2006. Listeria monocytogenes: a multifaceted model. Nat. Rev. Microbiol. 4:423-434. [DOI] [PubMed] [Google Scholar]
  • 19.Handa-Miya, S., B. Kimura, H. Takahashi, M. Sato, T. Ishikawa, K. Igarashi, and T. Fujii. 2007. Nonsense-mutated inlA and prfA not widely distributed in Listeria monocytogenes isolates from ready-to-eat seafood products in Japan. Int. J. Food Microbiol. 117:312-318. [DOI] [PubMed] [Google Scholar]
  • 20.Havarstein, L. S., D. B. Diep, and I. F. Nes. 1995. A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol. Microbiol. 16:229-240. [DOI] [PubMed] [Google Scholar]
  • 21.Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267-272. [DOI] [PubMed] [Google Scholar]
  • 22.Horton, R. M., Z. L. Cai, S. N. Ho, and L. R. Pease. 1990. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8:528-535. [PubMed] [Google Scholar]
  • 23.Ivanek, R., Y. T. Grohn, L. W. Tauer, and M. Wiedmann. 2004. The cost and benefit of Listeria monocytogenes food safety measures. Crit. Rev. Food Sci. Nutr. 44:513-523. [DOI] [PubMed] [Google Scholar]
  • 24.Jackson, K. A., M. Iwamoto, and D. Swerdlow. 2010. Pregnancy-associated listeriosis. Epidemiol. Infect. 138:1503-1509. [DOI] [PubMed] [Google Scholar]
  • 25.Jeffers, G. T., J. L. Bruce, P. L. McDonough, J. Scarlett, K. J. Boor, and M. Wiedmann. 2001. Comparative genetic characterization of Listeria monocytogenes isolates from human and animal listeriosis cases. Microbiology 147:1095-1104. [DOI] [PubMed] [Google Scholar]
  • 26.Jemmi, T., and R. Stephan. 2006. Listeria monocytogenes: food-borne pathogen and hygiene indicator. Rev. Sci. Tech. 25:571-580. [PubMed] [Google Scholar]
  • 27.Jonquieres, R., H. Bierne, J. Mengaud, and P. Cossart. 1998. The inlA gene of Listeria monocytogenes LO28 harbors a nonsense mutation resulting in release of internalin. Infect. Immun. 66:3420-3422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kasper, S., S. Huhulescu, B. Auer, I. Heller, F. Karner, R. Wurzner, M. Wagner, and F. Allerberger. 2009. Epidemiology of listeriosis in Austria. Wien. Klin. Wochenschr. 121:113-119. [DOI] [PubMed] [Google Scholar]
  • 29.Kathariou, S. 2002. Listeria monocytogenes virulence and pathogenicity, a food safety perspective. J. Food Prot. 65:1811-1829. [DOI] [PubMed] [Google Scholar]
  • 30.Khatamzas, E., H. Hughes, K. A. Grant, J. McLauchlin, and I. C. Bowler. 2010. The increasing prevalence of listeriosis: what are we missing? QJM 103:519-522. [DOI] [PubMed] [Google Scholar]
  • 31.Kjos, M., L. Snipen, Z. Salehian, I. F. Nes, and D. B. Diep. 2010. The ABI proteins and their involvement in bacteriocin self-immunity. J. Bacteriol. 192:2068-2076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Koch, J., and K. Stark. 2006. Significant increase of listeriosis in Germany: epidemiological patterns 2001-2005. Euro Surveill. 11:85-88. [PubMed] [Google Scholar]
  • 33.Li, Y. M., J. C. Milne, L. L. Madison, R. Kolter, and C. T. Walsh. 1996. From peptide precursors to oxazole and thiazole-containing peptide antibiotics: microcin B17 synthase. Science 274:1188-1193. [DOI] [PubMed] [Google Scholar]
  • 34.Little, C. L., S. M. Pires, I. A. Gillespie, K. Grant, and G. L. Nichols. 2010. Attribution of human Listeria monocytogenes infections in England and Wales to ready-to-eat food sources placed on the market: adaptation of the Hald Salmonella source attribution model. Foodborne Pathog. Dis. 7:749-756. [DOI] [PubMed] [Google Scholar]
  • 35.Liu, D. 2008. Preparation of Listeria monocytogenes specimens for molecular detection and identification. Int. J. Food Microbiol. 122:229-242. [DOI] [PubMed] [Google Scholar]
  • 36.Low, J. C., and W. Donachie. 1997. A review of Listeria monocytogenes and listeriosis. Vet. J. 153:9-29. [DOI] [PubMed] [Google Scholar]
  • 37.Lux, T., M. Nuhn, R. Hakenbeck, and P. Reichmann. 2007. Diversity of bacteriocins and activity spectrum in Streptococcus pneumoniae. J. Bacteriol. 189:7741-7751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.McLauchlin, J. 1990. Distribution of serovars of Listeria monocytogenes isolated from different categories of patients with listeriosis. Eur. J. Clin. Microbiol. Infect. Dis. 9:210-213. [DOI] [PubMed] [Google Scholar]
  • 39.Mitchell, D. A., S. W. Lee, M. A. Pence, A. L. Markley, J. D. Limm, V. Nizet, and J. E. Dixon. 2009. Structural and functional dissection of the heterocyclic peptide cytotoxin streptolysin S. J. Biol. Chem. 284:13004-13012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Nightingale, K. K., R. A. Ivy, A. J. Ho, E. D. Fortes, B. L. Njaa, R. M. Peters, and M. Wiedmann. 2008. inlA premature stop codons are common among Listeria monocytogenes isolates from foods and yield virulence-attenuated strains that confer protection against fully virulent strains. Appl. Environ. Microbiol. 74:6570-6583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Nightingale, K. K., K. Windham, K. E. Martin, M. Yeung, and M. Wiedmann. 2005. Select Listeria monocytogenes subtypes commonly found in foods carry distinct nonsense mutations in inlA, leading to expression of truncated and secreted internalin A, and are associated with a reduced invasion phenotype for human intestinal epithelial cells. Appl. Environ. Microbiol. 71:8764-8772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nizet, V., B. Beall, D. J. Bast, V. Datta, L. Kilburn, D. E. Low, and J. C. De Azavedo. 2000. Genetic locus for streptolysin S production by group A Streptococcus. Infect. Immun. 68:4245-4254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.O'Grady, J., S. Sedano-Balbas, M. Maher, T. Smith, and T. Barry. 2008. Rapid real-time PCR detection of Listeria monocytogenes in enriched food samples based on the ssrA gene, a novel diagnostic target. Food Microbiol. 25:75-84. [DOI] [PubMed] [Google Scholar]
  • 44.O'Grady, J., M. Ruttledge, S. Sedano-Balbas, T. J. Smith, T. Barry, and M. Maher. 2009. Rapid detection of Listeria monocytogenes in food using culture enrichment combined with real-time PCR. Food Microbiol. 26:4-7. [DOI] [PubMed] [Google Scholar]
  • 45.Olier, M., F. Pierre, J. P. Lemaitre, C. Divies, A. Rousset, and J. Guzzo. 2002. Assessment of the pathogenic potential of two Listeria monocytogenes human faecal carriage isolates. Microbiology 148:1855-1862. [DOI] [PubMed] [Google Scholar]
  • 46.Petruzzelli, A., G. Blasi, L. Masini, L. Calza, A. Duranti, S. Santarelli, S. Fisichella, G. Pezzotti, L. Aquilanti, A. Osimani, and F. Tonucci. 2010. Occurrence of Listeria monocytogenes in salami manufactured in the Marche region (Central Italy). J. Vet. Med. Sci. 72:499-502. [DOI] [PubMed] [Google Scholar]
  • 47.Roberts, A. J., and M. Wiedmann. 2003. Pathogen, host and environmental factors contributing to the pathogenesis of listeriosis. Cell. Mol. Life Sci. 60:904-918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Rodriguez-Lazaro, D., M. Hernandez, M. Scortti, T. Esteve, J. A. Vazquez-Boland, and M. Pla. 2004. Quantitative detection of Listeria monocytogenes and Listeria innocua by real-time PCR: assessment of hly, iap, and lin02483 targets and AmpliFluor technology. Appl. Environ. Microbiol. 70:1366-1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Rodriguez-Lazaro, D., A. Jofre, T. Aymerich, M. Garriga, and M. Pla. 2005. Rapid quantitative detection of Listeria monocytogenes in salmon products: evaluation of pre-real-time PCR strategies. J. Food Prot. 68:1467-1471. [DOI] [PubMed] [Google Scholar]
  • 50.Rodriguez-Lazaro, D., A. Jofre, T. Aymerich, M. Hugas, and M. Pla. 2004. Rapid quantitative detection of Listeria monocytogenes in meat products by real-time PCR. Appl. Environ. Microbiol. 70:6299-6301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Rossmanith, P., M. Krassnig, M. Wagner, and I. Hein. 2006. Detection of Listeria monocytogenes in food using a combined enrichment/real-time PCR method targeting the prfA gene. Res. Microbiol. 157:763-771. [DOI] [PubMed] [Google Scholar]
  • 52.Swaminathan, B., and P. Gerner-Smidt. 2007. The epidemiology of human listeriosis. Microbes Infect. 9:1236-1243. [DOI] [PubMed] [Google Scholar]
  • 53.Tham, W., H. Ericsson, S. Loncarevic, H. Unnerstad, and M. L. Danielsson-Tham. 2000. Lessons from an outbreak of listeriosis related to vacuum-packed gravad and cold-smoked fish. Int. J. Food Microbiol. 62:173-175. [DOI] [PubMed] [Google Scholar]
  • 54.Uyttendaele, M., P. Busschaert, A. Valero, A. H. Geeraerd, A. Vermeulen, L. Jacxsens, K. K. Goh, A. De Loy, J. F. Van Impe, and F. Devlieghere. 2009. Prevalence and challenge tests of Listeria monocytogenes in Belgian produced and retailed mayonnaise-based deli-salads, cooked meat products and smoked fish between 2005 and 2007. Int. J. Food Microbiol. 133:94-104. [DOI] [PubMed] [Google Scholar]
  • 55.Van Stelten, A., and K. K. Nightingale. 2008. Development and implementation of a multiplex single-nucleotide polymorphism genotyping assay for detection of virulence-attenuating mutations in the Listeria monocytogenes virulence-associated gene inlA. Appl. Environ. Microbiol. 74:7365-7375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Vazquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Dominguez-Bernal, W. Goebel, B. Gonzalez-Zorn, J. Wehland, and J. Kreft. 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14:584-640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wessels, M. R. 2005. Streptolysin S. J. Infect. Dis. 192:13-15. [DOI] [PubMed] [Google Scholar]
  • 58.Yde, M., N. Botteldoorn, S. Bertrand, J. Collard, and K. Dierick. 2010. Microbiological and molecular investigation of an increase of human listeriosis in Belgium, 2006-2007. Euro Surveill. 15:19482. [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES