How Stat1 mediates constitutive gene expression: a complex of unphosphorylated Stat1 and IRF1 supports transcription of the LMP2 gene. Chatterjee-Kishore M., Wright K.L., Ting J.P.-Y., Stark G.R. The EMBO Journal. 2000;19:4111–4122. doi: 10.1093/emboj/19.15.4111.
On page 4121 (Materials and methods), the subsection ‘ChIP assay’ should read as follows:
DNA-bound proteins were cross-linked in vivo essentially as described by Orlando et al. (1997). Briefly, cells were treated with one-tenth volume of 11% formaldehyde per volume of medium and lysed by sonication. Chromatin was recovered by isopycnic centrifugation in a continuous CsCl gradient (1.42 g/l). Aliquots were collected from the gradient and analyzed for the presence of chromatin of ∼0.6–1.0 kb. These fractions were pooled and the chromatin was purified by dialysis. DNA-bound Stat1 and IRF1 were immunoprecipitated. Cross-links were then reversed at 65°C and the co-immunoprecipitated DNA was purified by a single step phenol–chloroform/isoamyl alcohol extraction. Purified DNA was amplified in PCR using primers for the LMP2 ICS/GAS region and for the IRF1 GAS region. The following primers were used: (i) LMP2 prom (F), GACGAGGGCTCTAAGAGTCTA and LMP2 prom (R2), GTGGATCTCGATCGGTAACCG; (ii) IRF1 prom (F), CACCTAACCCTCGCGAGCCCC and IRF1 prom (R), CTAAGCCGACCAGCGCGCGCT. PCR conditions were as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, 58°C for 2 min, 72°C for 3 min, followed by an additional extension time of 15 min at 72°C and a soak cycle at 4°C. PCR products were analyzed in 1% agarose gels. The expected size of the amplified product for the LMP2 ICS-2/GAS region was 280 bp and for the IRF1 GAS region was 450 bp.