Expression and distribution of transient receptor potential (TRP) channels in bladder epithelium

Abstract

The urothelium is proposed to be a sensory tissue that responds to mechanical stress by undergoing dynamic membrane trafficking and neurotransmitter release; however, the molecular basis of this function is poorly understood. Transient receptor potential (TRP) channels are ideal candidates to fulfill such a role as they can sense changes in temperature, osmolarity, and mechanical stimuli, and several are reported to be expressed in the bladder epithelium. However, their complete expression profile is unknown and their cellular localization is largely undefined. We analyzed expression of all 33 TRP family members in mouse bladder and urothelium by RT-PCR and found 22 specifically expressed in the urothelium. Of the latter, 10 were chosen for closer investigation based on their known mechanosensory or membrane trafficking functions in other cell types. Western blots confirmed urothelial expression of TRPC1, TRPC4, TRPV1, TRPV2, TRPV4, TRPM4, TRPM7, TRPML1, and polycystins 1 and 2 (PKD1 and PKD2) proteins. We further defined the cellular and subcellular localization of all 10 TRP channels. TRPV2 and TRPM4 were prominently localized to the umbrella cell apical membrane, while TRPC4 and TRPV4 were identified on their abluminal surfaces. TRPC1, TRPM7, and TRPML1 were localized to the cytoplasm, while PKD1 and PKD2 were expressed on the apical and basolateral membranes of umbrella cells as well as in the cytoplasm. The cellular location of TRPV1 in the bladder has been debated, but colocalization with neuronal marker calcitonin gene-related peptide indicated clearly that it is present on afferent neurons that extend into the urothelium, but may not be expressed by the urothelium itself. These findings are consistent with the hypothesis that the urothelium acts as a sentinel and by expressing multiple TRP channels it is likely it can detect and presumably respond to a diversity of external stimuli and suggest that it plays an important role in urothelial signal transduction.

the bladder epithelium, or urothelium, is a stratified epithelial tissue composed of basal, intermediate, and umbrella cell layers. The latter is a single layer of highly differentiated and polarized cells that have tight junctions and a highly impermeable apical plasma membrane, which contains uroplakin proteins assembled into paracrystalline arrays, and can expand and contract in size as the bladder fills and empties. Combined, these features contribute to a compliant tight barrier that prevents diffusion of urine constituents into the underlying tissue (23, 24, 37). In addition to its role as a barrier, the umbrella cell and subjacent intermediate and basal cell layers also have a sensory function and in response to various physical and chemical stimuli can release neurotransmitters (such as ATP and nitric oxide), which then communicate the state of the tissue's external environment to afferent neurons (3, 4). The response to mechanical and other stimuli may depend, in part, on the function of umbrella cell-associated ion channels, which when opened or closed can alter membrane potential (32, 61). Possible sensory channels include the epithelial sodium channel (ENaC), various mechanically sensitive potassium channels (33, 61), and nonselective cation channels whose identity are unknown but may play an important role in mechanotransduction (55, 61). Other potential ion channels with sensory activity expressed by the umbrella cells and the other urothelial cell layers include the purinergic P2X family channels and members of the transient receptor potential (TRP) family of channels.

TRP channels respond to a diversity of stimuli including mechanical forces, heat, osmotic stress, and a broad array of chemical compounds (14, 60), and may also play important roles in human physiology, pathology, and inherited diseases (43). The superfamily includes 33 members and in higher metazoans it is divided into 6 subfamilies: TRPC (canonical), TRPV (vanilloid), TRPM (melastatin), TRPA (ankyrin), TRML (mucolipin) and TRPP (polycystin). As examples, TRPV4 has been shown to play a role in pressure and osmotic sensation in blood vessels, airways, and renal vasculature and TRPM5, which is expressed in taste receptor cells throughout the oral cavity, is important for the perception of sweet, amino acid, and bitter tastes. TRP members also play important roles in human disease. Six mutations of the TRPC6 gene have been linked to the human proteinuric kidney disease known as focal and segmental glomerulosclerosis (FSGS), in which effacement of the podocyte foot processes causes the glomerular slit diaphragms to lose their integrity. Mutations in PKD1 and PKD2 (also known as polycystins 1 and 2) cause decreased Ca²⁺ influx into renal epithelial primary cilia, and can lead to polycystic kidney disease (PKD), which is characterized by the progressive development of large fluid-filled cysts in the kidney and ultimately organ failure (20, 25).

TRP family channels are likely to play important roles in regulating urothelial sensory perception and overall bladder function. For example, TRPV1−/− mice have abnormal bladder function characterized by a high frequency of low-amplitude, nonvoiding bladder contractions (10), and TRPV4−/− mice have few voiding contractions, and like TRPV1−/− mice have a higher frequency of non-voiding contractions (21). Furthermore, both of these TRP knockout mice show decreased ATP release upon distention of their bladders, possibly implicating TRPV1 and TRPV4 in bladder mechanotransduction. Other TRP channels that may be expressed in the urothelium include TRPA1, TRPM7, TRPM8, and TRPV2 (8, 18, 58). However, the expression and function of these TRP channels in the urothelium are not well understood, and there is little or no information about the expression and distribution of the other 27 TRP family members in the bladder proper. In this paper, we have defined the expression profile of the entire family of 33 TRP channels in whole bladder and in the urothelium by RT-PCR. Furthermore, we have performed cellular and subcellular immunolocalization of 10 TRP channels implicated in mechanosensation and membrane trafficking in urothelium and other tissues. We show that messenger RNA for 22 TRPs is expressed in the urothelium, and immunolocalization studies indicate a polarized distribution of TRPs on umbrella cells and urothelium. Our data further support the hypothesis that the urothelium is a dynamic sensory tissue that detects changes in the external environment through expression of multiple receptors and ion channels.

MATERIALS AND METHODS

Materials

Unless otherwise specified, all chemicals were obtained from Sigma (St. Louis, MO) and were of reagent grade or better.

Animals

Animals used in this study were Sprague-Dawley rats (weighing 250–300 g), and C57BL/6J mice (19–21 g). Rats and mice were euthanized by inhalation of 100% CO₂. After euthanasia and thoracotomy, the bladders were rapidly excised and processed as described below. All animal studies were carried out with the approval of the Beth Israel Deaconess Medical Center and University of Pittsburgh Institutional Animal Care and Use Committees.

Antibodies and Labeled Probes

Affinity-purified rabbit polyclonal anti-TRPC1 antibody and the corresponding control peptide were purchased from Sigma. Affinity-purified rabbit polyclonal anti-TRPC4 antibody and the corresponding control peptide were purchased from Alomone Labs (Jerusalem, Israel). Affinity-purified rabbit polyclonal anti-TRPV1 antibody and the corresponding control peptide were purchased from Enzo Life Sciences (Plymouth Meeting, PA). Affinity-purified rabbit polyclonal anti-TRPV2 antibody was a kind gift from Dr. David E. Clapham's laboratory (Children's Hospital of Boston, Boston, MA) (52). Affinity-purified rabbit polyclonal anti-TRPV4 antibody was a kind gift from Dr. David M. Cohen's laboratory (Oregon Health and Science University, Portland, OR) (54, 56, 57). Affinity-purified goat polyclonal anti-TRPM4 antibody (G-20) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal anti-TRPM4 whole serum was purchased from Abcam (Cambridge, MA). Affinity-purified goat polyclonal anti-TRPM7 antibody was purchased from Abcam. Affinity-purified rabbit polyclonal anti-TRPM7 antibody was also a kind gift from Dr. David E. Clapham's Laboratory (Children's Hospital of Boston) (30). Affinity-purified mouse monoclonal IgG1 anti-TRPM7 antibody was purchased from NeuroMab (Davis, CA). Rabbit polyclonal anti-PKD1 and anti-PKD2 anti-serums were kind gifts from Dr. Oxana Ibraghimov-Beskrovnaya's laboratory (Genzyme, Cambridge, MA) (20). An affinity-purified rabbit polyclonal anti-PKD1 antibody (NM005) was a gift from Dr. Angela Wandinger-Ness's laboratory (University of New Mexico) (47). Affinity-purified rabbit polyclonal anti-TRPML1 antibody was a gift from Dr. Kirill Kiselyov's laboratory (University of Pittsburgh) (28). Affinity-purified goat polyclonal anti-PGP9.5 antibody was purchased from Santa Cruz Biotechnology. Affinity-purified goat polyclonal anti-calcitonin gene-related peptide (CGRP) antibody was purchased from Abcam. Secondary donkey anti-rabbit/goat/rat/mouse antibodies conjugated to Alexa or horseradish peroxidase, and Topro-3 and rhodamine-phalloidin were purchased from Invitrogen-Molecular Probes (Carlsbad, CA).

RT-PCR Analysis

Excised bladders were placed in 1 ml lysis solution in a tissue grinder, and whole bladder RNA was extracted by an RNAqueous-4PCR kit following the manufacturer's protocol (Ambion, Austin, TX). Alternatively, the bladder was turned inside out onto a plastic rod, and urothelium was recovered by immersion into RNA lysis buffer for 2 min. RNA samples were treated with DNase I to remove potential genomic DNA contamination, and control reactions were performed in the absence of reverse transcriptase or in the presence of housekeeping gene primers (Fig. 1C). Reverse transcription was carried out according to instructions for the RETROscript (Ambion) kit using the standard PCR protocol. Primer pairs for each TRP channel are shown in Table 1. PCR products were run on a 2.0% (wt/vol) agarose gel and then stained with ethidium bromide to visualize the PCR products. Products were compared with a 100-bp ladder (PGC Scientific, Frederick, MD), which was used to estimate the size of the reaction products. The PCR products were excised from the gels, purified using a MiniElute Kit (Qiagen), and the sequence was verified by automated sequencing (GENEWIZ, Sotuh Plainfield, NJ).

Fig. 1.

Expression of transient receptor potential (TRP) channels in mouse bladder and urothelium. A: expression of message for the indicated TRP channels was detected by RT-PCR from total RNA isolated from mouse bladder. Specific TRP channel primers are given in Table 1. RT-PCR products were resolved on 2% agarose gels and visualized by staining with ethidium bromide. Numbers above or beneath the DNA bands are expected product sizes (in bp). B: RT-PCR analysis of TRP channel expression in RNA isolated from the urothelium. C: RT-PCR were performed in the absence of reverse transcriptase (left lane) or in the presence of a housekeeping gene primer (right lane) to ensure the quality of RNA and PCR. D: for TRP channels not detected in whole bladder, RT-PCR analysis was performed using RNA from positive control tissues including brain, kidney, and heart.

Table 1.

Primers used for PCR of TRP channels

TRP Channel	Sequence of Primers (5′-3′)	Expected Product Size, bp
TRPC1	CCTGTTATTTTAGCTGCTCATC	238
	TAAGTTCAAACGCTCTCAGAAT
TRPC2	AGAAACAGTTTGTAGCACATCC	250
	AAGAAGATAAGGAACCACAGGT
TRPC3	AAGCCCAGTATTAATGTCACTG	224
	CTACTCAGTGATGGTCTCTCGT
TRPC4	TTTCCTTACTGCCTTTCAGTTA	168
	CGGTAATTAAGAATGATTTCCA
TRPC5	AACAAGTTACAACTCGGCTCTA	247
	AAAAGGCAAATGATAATGACAG
TRPC6	AGACCGTTCATGAAGTTTGTAG	225
	TTCTTTACATTCAGCCCATATC
TRPC7	AGAATCAAGATGTGCCTCATAG	247
	CATTGACTTCATCGTTCTCTCT
TRPV1	AGCGAGTTCAAAGACCCAGA	233
	TTCTCCACCAAGAGGGTCAC
TRPV2	TGATGAAGGCTGTGCTGAAC	175
	CACCACAGGCTCCTCTTCTC
TRPV3	TGAGATCCTGAAGTACATCCTC	245
	ATTTCTTCCATTTCGTGTGTAG
TRPV4	AGAAAGGTCGTGGAGAAGCA	174
	ATCAGTCAGGCGCTTCTTGT
TRPV5	TTGGTGCCTCTCGCTACTTT	249
	AGCGCAGTAGGTCTCCAAAA
TRPV6	TTGAGCATGGAGCTGACATC	178
	GGGGTGAGTCCCTGGTTATT
TRPM1	AATGGAGATGTCAAGTTCAAAG	191
	TGGCTTCACAGAGAGTAAGTTT
TRPM2	TGGCTTCTAAGAGGAAAGTACA	206
	AGTCCTGAAGTTTTCCAAGATT
TRPM3	GGCAATCAAATATAGTCAAGGA	150
	ATGTTAGATCTTCCCACCTTTT
TRPM4	AGTTCCCCCTGGACTATAACTA	196
	CGCTTTAACATCTTCTCATCTC
TRPM5	AGAATGAAACTCATGTCTTTGG	173
	GTTAGACCTAAATAGCCCCATC
TRPM6	GTGCAGACGTGGTATAAAATCT	249
	TTCATCACCATTGTTGTTATTG
TRPM7	CCTCATGAAGACCATTTTCTAA	210
	ACAACTGTAACCTTCCTCACAG
TRPM8	CGTTGTCTTCGCTTATTTCTAC	219
	TTTGAGTCCAGTTGTCTAAACC
TRPA1	CCACATGACAGAAGTCCTAGTT	231
	GCAGGAGTCTTACTGATCACAT
PKD1	CCCACTCAGTCTTCTGTGTTAT	176
	CTTTGGTGGAGACAGTGTAGTT
PKD1L1	TTGTCTGACAGCCTAGAACTTT	243
	GGAGCACATCTTTCCACTAATA
PKD1L2	TTGAAGACCTGGTAGACTATGG	215
	GTTGTCAAAGAGGTACTGGAGA
PKD1L3	ACAAACATGACATCAGACACAC	192
	CTGACTGGTTGAACTCTGAAAT
PKDREJ	CCATGGTTACTAAATTTGCTGT	219
	AAAGCCTCACATTGTACTCATC
PKD2	ACAGATGAGAGATGACTTGGAG	203
	TCACCAGTACTTGGAACTCTTC
PKD2L1	ACAGCTCTGTGAAGTAGCATTT	200
	GTTACTGGAACGTAGGAAGACA
PKD2L2	TACAGCAAGTACACAGTGGAAA	249
	CAGGGAGAAATCAATAAAAACA
TRPML1	CCCTGATCACTAATTGAGAAAA	202
	TAAAATCTGGTGGGTTTTAGTG
TRPML2	GATTTTCTGGAGTTGATGAAGA	188
	TGTCTTGTAGTGCTGCTTACAG
TRPML3	GAAAATGCAGCAGAAGAGTTAC	233
	TAATCTGTATTTTCCGGAGTTG

TRP, transient receptor potential.

Western Blot Analysis of TRP Channels in the Urothelium

Mouse or rat urothelial tissue was obtained by pinning the isolated bladder onto a rubber mat using pins and then gently scraping the epithelium with a cell scraper (17-mm scraper length; Sarstedt, Newton, NC). The cells were lysed in 0.5% SDS lysis buffer (50 mM triethanolamine, pH 8.6, 100 mM NaCl, 5 mM EDTA, and 0.5% wt/vol SDS) containing a protease inhibitor cocktail (5 μg/ml leupeptin, 5 μg/ml antipain, 5 μg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride). Alternatively, cells were lysed in radioimmunoprecipitation assay buffer (RIPA; 50 mM Tris, pH 8.0, 150 mM NaCl, 1% vol/vol NP-40, 0.5% wt/vol deoxycholic acid, 0.1% wt/vol SDS) containing Complete Mini Protease Inhibitor Cocktail tablets (Roche). Proteins were resolved by SDS-PAGE and transferred to Immobilon-P, and the blots were probed with TRP channel-specific antibodies as previously described (62). Images were scanned with an ArtixScan 1800f flatbed scanner (Microtek International, Carson, CA), the contrast was corrected with Photoshop (San Jose, CA), and the images were imported into, and figures generated with Adobe Illustrator CS3 (San Jose, CA).

Immunofluorescence Labeling of TRP Channels in the Urothelium

Excised bladders were fixed in 4% wt/vol paraformaldehyde dissolved in 100 mM sodium cacodylate (pH 7.4) buffer for 2 h at room temperature. In some cases, tissue was fixed by 100% methanol (4°C) for 5 min or in 10% vol/vol acetic acid, 40% vol/vol ethanol in phosphate-buffered saline for 40 min at 4°C. Fixed tissue was cut into small pieces with a razor blade, cryoprotected, frozen, sectioned, and incubated with primary antibodies (1:100–1:500 dilution) for 2 h at room temperature as described previously (62). After washing away of unbound primary antibody, the sections were incubated with a mixture of Alexa 488-conjugated secondary antibody (diluted 1:100), rhodamine-phalloidin (1:50), and Topro-3 (1:1,000). The sections were washed with PBS, postfixed with 4% wt/vol paraformaldehyde, and mounted under coverslips with p-diaminobenzidine-containing mounting medium.

Scanning Laser Confocal Analysis of Fluorescently Labeled Cells

Imaging was performed on a TCS-SL confocal microscope equipped with argon and green and red helium-neon lasers (Leica, Deerfield, IL). Images were acquired by sequential scanning with a ×100 (1.4 numerical aperture) planapochromat oil objective and the appropriate filter combinations. Settings were as follows: photomultipliers set to 600–800 V, 1 Airy disk, and Kalman filter (n = 4). Serial (z) sections were captured with a 0.25-μm step size. The images (512 and 512 pixels) were saved as TIFF files. The OpenLab program (PerkinElmer) was used to project the serial sections into one image. The contrast level of the final images was adjusted in Adobe Photoshop, and the images were imported into Adobe Illustrator CS3.

RESULTS

Multiple TRP Channels are Expressed in Mouse Bladder and Urothelium

In our initial analysis we examined the mRNA expression profile of TRP channels in whole bladder and isolated urothelium. Mice were utilized in these studies because sequences for all of the TRP channels are known and because of the relative ease of future genetic manipulations in this animal model. Of 33 TRP members, we demonstrated that the majority (27) were expressed in whole bladder tissue by RT-PCR (Fig. 1A). These included five of seven TRPC members (TRPC1–5), five of six TRPV members (TRPV1–4 and TRPV6), seven of eight TRPM isoforms (TRPM1–7), seven of eight TRPPs (PKD1–2, PKD1L2–3, PKDREJ, and PKD2L1–2), and all three TRPML members (TRPML1–3). TRPA1 was not detected. Of these 27 proteins, 22 TRP members were expressed specifically in urothelium (Fig. 1B), including three of six TRPC members (TRPC1–2 and TRPC4), five of six TRPV members (TRPV1–4 and TRPV6), five of eight TRPMs (TRPM2 and TRPM4–7), seven of eight TRPPs (PKD1–2, PKD1L2–3, PKDREJ, and PKD2L1–2), and two of three TRPML members (TRPML1–2). Thus message for two thirds (22/33) of the TRP family was detected in urothelium by RT-PCR. For those six TRP members that were not detected in either whole bladder or urothelium, positive control reactions using brain, kidney, or heart tissues were performed and products of the expected sizes were observed (Fig. 1D), confirming that primers for these particular isoforms were able to amplify specific products from tissues known to express these proteins. These experiments thus establish that a rich diversity of TRP family members is expressed in the bladder and in the urothelium.

Western Blot Analysis Confirms Expression of TRP Channels in the Urothelium

Of the 22 TRP channels associated with the urothelium, we chose 10 for further analysis based on the availability of antibodies, and previous reports of their involvement in mechanotransduction, osmotic sensation, or membrane traffic (43, 60). Western blot analysis confirmed that TRPC1, TRPC4, TRPV1, TRPV2, TRPV4, TRPM4, TRPM7, TRPML1, PKD2, and PKD1 were expressed in the urothelium (Fig. 2). The TRPC1-specific antibody recognized a protein with an apparent molecular mass of ∼91 kDa (Fig. 2A), which is the nominal molecular mass of the protein, and control peptide totally abolished the signal. Similar to a previous report (53), a lower molecular mass protein species was also observed and may represent a TRPC1 proteolytic fragment. The anti-TRPC4 antibody detected a single protein species of ∼90 kDa (Fig. 2B). TRPC4 has four protein variants, with the full-length species containing 974 amino acids and a predicted molecular mass of ∼112 kDa. The protein species we observed is likely to be a variant that contains 564 amino acids and has been reported previously (19). The anti-TRPV1 antibody weakly detected a protein species of 75 kDa, and this binding was abolished by the control peptide (Fig. 2C). The anti-TRPV2 antibody detected a single protein species of ∼86 kDa (Fig. 2D), which is the predicted size of this protein. The anti-TRPV4 antibody we employed, which was used in several previous studies (54, 56, 57), detected a major protein species of 131 kDa (Fig. 2E). This is larger than the expected molecular mass of 98 kDa and represents tissue-specific glycosylation (56), or some other posttranslational processing event. We also detected a faint protein species at ∼82 kDa (Fig. 2E), which could be the smaller molecular variant of TRPV4 or a proteolytic fragment. There are three reported TRPM4 splice variants with predicted molecular masses of ∼136, ∼55, and ∼48 kDa. All three protein variants were apparently expressed in the urothelium (Fig. 2F). The anti-TRPM7 antibody detected a protein species of ∼250 kDa as previously reported (Fig. 2G) (30). The anti-TRPML1 antibody detected two protein species of ∼ 66 and ∼ 70 kDa (Fig. 2H), which are the nominal size of the two predicted splice variants of this protein. We also detected a small 36-kDa fragment, which may represent a cleaved form of TRPML1 (28). For PKD1, we detected a large protein species (∼500 kDa) that is consistent with the previously reported molecular mass of this protein in kidney epithelium (Fig. 2I) (47). Proteolytic processing of PKD1 can yield up to five cleaved fragments (35), and we observed three smaller molecular species with corresponding molecular mass that were close to the calculated molecular mass (Fig. 2I). The anti-PKD2 antibody, which was used in previous studies (20), detected two protein species with approximate molecular masses of 109 kDa (Fig. 2J). The larger protein species may represent a glycosylated species and has been described previously (12). Taken together, these results confirm that multiple TRP channel proteins are expressed in the urothelium.

Fig. 2.

Western blot analysis of select TRP channels in mouse urothelium. Lysates of mouse or rat urothelium (25 μg of protein) were resolved by SDS-PAGE, and Western blots were probed with antibodies specific for the indicated TRP channel. The major protein species are indicated on the left by arrowheads, and the migration of molecular size markers is indicated to the right of each panel.

TRP Channels are Expressed at the Cell Surface and Intracellularly in Bladder Urothelium

To define the cellular distribution of the TRP channels, bladder tissue was immunolabeled with the above TRP-specific antibodies and then examined by confocal microscopy. The tissue was also incubated with rhodamine-phalloidin and Topro-3 to label the cortical actin cytoskeleton (which defines cellular boundaries) and the nuclei, respectively. However, in tissues fixed with methanol or acetic acid the rhodamine-phalloidin did not stain well, and in these cases we incubated the tissues with anti-claudin 4 or anti-aquaporin-3 antibodies, which label the basolateral surface of the umbrella cells and the plasma membranes of the underlying intermediate and basal cell layers (see Fig. 3, A–C and H, for example) (1, 50).

Fig. 3.

Localization of TRP channels in mouse and rat urothelium. Cryosections of mouse (A–D, F, and G) or rat (E and H–J) bladder tissue were labeled with the indicated TRP channel antibodies (green) and either rhodamine phalloidin (D and G), or antibodies to claudin 4 (E and H–J) or aquaporin-3 (AQP3; A, B, C, and F; all displayed in red). Nuclei were labeled with ToPro-3 (blue). Far right: merged images. In some panels, a dashed white line indicates the apical surface of the umbrella cells. In B, TRPC4-positive fibrils below the basal cell layer are indicated by arrows. TRPV1-labeled filaments, likely afferent nerve processes, are indicated by asterisks in C. Scale bars = 10 μm.

Consistent with the RT-PCR data and Western blot analysis, all 10 TRP channels were localized within the urothelium (Fig. 3, A–J). TRPC1 labeled cytoplasmic structures in the umbrella cells, whereas much less staining was detected in the intermediate and basal cell layers (Fig. 3A). TRPC4 was distributed along the basolateral plasma membrane of the umbrella cells, but none was found along the apical membrane of these cells. In addition, TRPC4 was found on the surface of the intermediate and basal cells (Fig. 3B), and in fibrils below the basal cell layer that may be nerve fibers and possibly smooth muscle cells (arrows in Fig. 3B). Subsequent colocalization of TRPC4 with a specific neuron marker, PGP9.5, demonstrated that the TRPC4-positive fibrils were indeed nerve fibers (Fig. 4A). The TRPV1 antibody did not stain the urothelium but strongly labeled filamentous elements that were localized below and penetrated into the urothelium (Fig. 3C, asterisks). The signal was totally abolished by the control peptide. We felt these were likely to be the previously described TRPV1-positive afferent nerve fibers (5) and therefore tested this hypothesis in a colocalization experiment with a neuronal marker specific for afferent fibers, i.e, CGRP. As can be seen in Fig. 4B, there is precise colocalization of these two proteins, confirming that TRPV1 staining in urothelium is specific to nerve fibers.

Fig. 4.

Colocalization of TRPC4 and TRPV1 with neuron-specific markers, PGP9.5 and calcitonin gene-related peptide (CGRP) in bladder tissue. Bladder sections were labeled with the either TRPC4 (A) or TRPV1 (B) antibodies (green) and PGP9.5 or CGRP antibodies (red). Nuclei were labeled with ToPro-3 (blue). Far right: merged images. The colocalization of TRPC4/TRPV1 with PGP9.5/CGRP are indicated by arrows. Scale bars = 10 μm.

TRPV2 strongly labeled the apical plasma membrane of umbrella cells and was also present in the cytoplasm (Fig. 3D). However, there was no basolateral staining present in umbrella cells. TRPV4 was localized to the basolateral membrane of the umbrella cells and the plasma membrane of the intermediate and basal cells (Fig. 3E). TRPM4 was clearly localized to the apical but not basolateral plasma membrane of the umbrella cells (Fig. 3F). TRPM7 is ubiquitously expressed in many tissues, and we observed staining of TRPM7 in suburothelial tissues, possibly including fibroblasts and smooth muscle cells. It was abundantly expressed in the urothelium, with high expression in the umbrella cells (Fig. 3G). There was also some nuclear staining, which was confirmed by using two different antibodies and different staining treatments. TRPML1 was also strongly expressed in the urothelium and was distributed along the plasma membrane and on what appeared to be intracellular membranes, possibly lysosomes (Fig. 3H). PKD1 and PKD2 were found at the apical surface of the umbrella cells and along what appeared to be the plasma membranes, or closely apposed membranes, of the other cell layers (Fig. 3, I and J). In summary, multiple TRP channels were localized in the umbrella cells and urothelium with a polarized distribution pattern.

DISCUSSION

The bladder urothelium is proposed to serve as a sentinel that receives sensory input and responds in turn by release of mediators such as acetylcholine, adenosine, and ATP. These mediators then communicate the state of the urothelial extracellular environment to the underlying tissues (3, 4). A class of molecules that may play an important role in urothelial sensory function are the TRP family channels, of which six (TRPV1, TRPV2, TRPV4, TRPA1, TRPM7, and TRPM8) were previously identified in ex vivo or in vitro preparations of urothelium by RT-PCR, immunostaining, or functional assays (8–10, 18, 21). The goal of this study was to identify additional TRP family members that would further reveal the sensory repertoire of the urothelium. Using native urothelial tissue as a source, we detected message for a large number of TRPs in whole bladder with 27 of 33 family members expressed, and of these, 22 were also found in the urothelium. In the case of the 10 urothelial isoforms that were characterized in more detail, localization by immunofluorescence provided confirmation of their expression and distribution in the urothelium or associated tissues. For the remaining 12 TRPs, their expression should be treated with caution at this time.

Expression of TRPV1/2/4, TRPA1, and TRPM7/8 in the Urothelium

TRPV1/2/4, TRPM7/8, and TRPA1 were previously reported to be expressed in the urothelium (8–10, 18, 21). We confirmed the existence of TRPV1/2/4 and TRPM7 in whole bladder and urothelium, but we could not detect TRPA1 or TRPM8 using several sets of PCR primers or selective antibodies. Therefore, our work is in agreement with a recent publication that showed TRPM8 and TRPA1 mRNA expression is extremely low or undetectable in the urothelium (18).

Because of its sensitivity to heat, protons, and vanilloid compounds, and reported expression in the urothelium and subjacent afferent nerve fibers, TRPV1 has been proposed to act as an urothelial mechanosensor. However, urothelial expression has been questioned (17, 18, 59). In our studies, we detected relatively faint expression of TRPV1 by RT-PCR and Western blotting (Figs. 1B and 2C), and immunolocalization studies demonstrated distinctive staining of fibers that ran between and underneath urothelial cells, but no staining of the urothelium itself. The fibers were positively confirmed as neuronal processes by costaining with CGRP. At least for the antibody we employed in our studies, we find no evidence of urothelial TRPV1 expression and attribute the faint signals detected by RT-PCR and Western blotting to contamination of our urothelial preparations with afferent nerve fibers.

The expression of TRPV2 was recently described in primary cultures of urothelium and urothelial cancer cell lines (18, 58). Our studies expand on these findings by exploring the expression of this channel in native tissue. We observed that it is primarily expressed in umbrella cells, at or near the apical surface, with little signal detected in the intermediate and basal cell layers (Fig. 3D). TRPV2 responds to hypotonicity and mechanical stimuli in aortic myocytes (40) and transduces physical stimuli in mast cells through a protein kinase A-dependent pathway (51). In a similar fashion, the apically located TRPV2 may respond to stretch and stimulate urothelial membrane turnover and release of neurotransmitters.

Consistent with previous reports (21, 38), we observed that TRPV4 is localized at the basolateral plasma membrane of umbrella cells and the plasma membrane of intermediate and basal cells (Fig. 3E). TRPV4 appears to sense distension of the bladder and may modulate ATP release during the normal micturition reflex (38). TRPV4−/− mice exhibit an incontinent phenotype emphasizing an important role for this channel in bladder function (21). TRPV4 has also recently been shown to directly interact with the α2-integrin and the src tyrosine kinase and is proposed to act as a component of a molecular complex that functions in regulating the set point for inflammation during nerve injury (2). How TRPV4 in the urothelium senses mechanical force and contributes to the micturition reflex requires further study.

Expression of TRPC, TRPM, TRPML, and TRPP Family Members in the Urothelium

In addition to the TRPV subfamily, we also detected expression of TRPC, TRPM, TRPML, and TRPP subfamily members in the bladder and urothelium. TRPC1 is widely expressed in different tissues, including the brain, testis, ovaries, smooth muscle, endothelium, salivary glands, and liver (48). When TRPC1 is reconstituted in proteoliposomes, it is gated open by membrane stretch (36). However, it is apparently not an obligatory component of stretch-activated channel complexes in vascular smooth muscle cells (15). Therefore, it is not fully understood how TRPC1 responds to mechanical stimuli. TRPC1 is reported to be at the plasma membrane and at intracellular sites including the endoplasmic reticulum (ER) and Golgi apparatus (48). Although we observed little plasma membrane TRPC1 in the urothelium, this channel was abundantly expressed intracellularly in what may be the ER and/or Golgi. Interestingly, TRPC-4 or -5 can interact with TRPC1 to form a heteromer, which facilitates TRPC1 trafficking to the plasma membrane (7, 48). Therefore, TRPC1, possibly in a complex with TRPC4, may traffic to the umbrella cell plasma membrane in response to stretch and once there may contribute to mechanotransduction.

TRPC4 is intriguing because it colocalizes with junction-associated proteins including ZO-1, connexin 43, β-catenin, VE-cadherin, and the actin cytoskeleton to form a supramolecular signaling complex (22, 49). Indeed, it is recognized as an important cation channel in the vascular endothelium and smooth muscle and functionally responds to mechanical stretch through Ca²⁺ influx (22, 34). In the urothelium, TRPC4 was prominently localized to the plasma membrane of the basal/intermediate urothelium (Fig. 3B). Furthermore, there was clear localization of TRPC4 at lateral junctions of umbrella cells and cell-cell contacts, suggesting that TRPC4 might play an important role in urothelium adhesion and mechanotransduction.

Members of the TRPM family were also identified in the urothelium. TRPM4 is activated by membrane stretch and, as a result of monovalent cation conduction, elicits membrane depolarization and vasoconstriction in arterial myocytes (16, 39). TRPM4 also undergoes dynamic translocation from a vesicular pool to the plasma membrane in pancreatic β-cells and controls insulin secretion (13). In the urothelium, TRPM4 is localized to the apical membrane of the umbrella cells. Although nothing is known about its function in the urothelium, we speculate that it may function in umbrella cell apical membrane trafficking and depolarization upon mechanical stretch.

TRPM7 is a unique protein containing both ion channel and kinase activity. It is universally expressed and required for cell viability (41). In mice, knockout of TRPM7 is embryonically lethal (26). TRPM7 may reside in the synaptic vesicles of neurons, where it forms molecular complexes that facilitate neurotransmitter release (11, 30). It has recently been described as a mechanosensitive channel that translocates to the plasma membrane in response to shear stress (46) and may be directly gated by plasma membrane stretch (44, 45). We detected punctate staining of TRPM7 in umbrella cells, possibly in vesicles (Fig. 3G). It is therefore possible that in response to mechanical stretch TRPM7 may traffic to the plasma membrane where it may play an unknown role in mechanotransduction.

TRPML1 is present in late endosomes and lysosomes. Mutations of this gene cause mucolipidosis type IV (MLIV), an autosomal recessive, neurodegenerative lysosomal storage disorder (43). TRPML1 has been hypothesized to function in the late endocytic pathway, where it may regulate the ionic composition of late endosomes/lysosomes (6). We detected large numbers of TRPML1-positive vesicular structures in umbrella cells (Fig. 3H), which may represent late endosomes/lysosomes. Recent studies indicate that the major fate of endocytosed umbrella cell apical membranes is delivery to these degradative compartments (27). Thus TRPML may play an important role in umbrella cell apical membrane traffic and recycling and degradation of surface proteins.

Of significant interest is the expression of PKD1 and PKD2 in the urothelium. Mutations in PKD1, a >450-kDa protein with multiple extracellular domains, or PKD2, a nonselective cation channel, can result in various forms of PKD (42). These proteins interact with each other to form functional dimers, and PKD2 is also reported to form a heterodimer with TRPV4 (29). These proteins have been localized to the basolateral membrane and associated adhesion junctions, apically localized primary cilia, as well as intracellular organelles including the ER (20, 42, 47). PKD1 and PKD2 participate in cell-cell and cell-matrix interactions (47) and together form a nonselective cation channel that conducts Ca²⁺ in response to bending of primary cilia (42). Previous studies reported the expression of PKD1 in the urothelium, but no information was provided about its localization (25). We detected both PKD1 and PKD2 expression in the urothelium, and both localized prominently to the apical domain of the umbrella cells. Here, they may play some role in transducing sensory signals such as membrane stretch. Of some interest is the observation that the adult umbrella cell apical membrane lacks any cilia (3, 31), so apical PKD1/PKD2 function may not be confined solely to ciliary structures.

Summary

Once considered an inert barrier, the urothelium is now proposed to be a mechanosensor (4, 61). Our observation that 22 TRP channels may be expressed in this tissue provides additional support for this hypothesis. We further examined the subcellular localization of 10 TRP channels in the urothelium and found distinctive and nonredundant localization patterns: some family members resided on the apical membrane of umbrella cells, while others were on the basolateral membrane or present intracellularly. While the role of these channels in the urothelium is largely unknown, it is likely that they may act individually or as subunits of supramolecular signal complexes to detect changes in the extracellular milieu of the umbrella cells in both normal and abnormal bladder physiology. Thus the identification of the repertoire of urothelial TRP channels will direct investigators to promising molecular candidates for future studies.

GRANTS

We thank Dr. Bryce MacIver for insightful comments during the preparation of the manuscript.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.