Different Genetic Elements Carrying the tet(W) Gene in Two Human Clinical Isolates of Streptococcus suis

Abstract

The genetic support for tet(W), an emerging tetracycline resistance determinant, was studied in two strains of Streptococcus suis, SsCA and SsUD, both isolated in Italy from patients with meningitis. Two completely different tet(W)-carrying genetic elements, sharing only a tet(W)-containing segment barely larger than the gene, were found in the two strains. The one from strain SsCA was nontransferable, and aside from an erm(B)-containing insertion, it closely resembled a genomic island recently described in an S. suis Chinese human isolate in sequence, organization, and chromosomal location. The tet(W)-carrying genetic element from strain SsUD was transferable (at a low frequency) and, though apparently noninducible following mitomycin C treatment, displayed a typical phage organization and was named ΦSsUD.1. Its full sequence was determined (60,711 bp), the highest BLASTN score being Streptococcus pyogenes Φm46.1. ΦSsUD.1 exhibited a unique combination of antibiotic and heavy metal resistance genes. Besides tet(W), it contained a MAS (macrolide-aminoglycoside-streptothricin) fragment with an erm(B) gene having a deleted leader peptide and a cadC/cadA cadmium efflux cassette. The MAS fragment closely resembled the one recently described in pneumococcal transposons Tn6003 and Tn1545. These resistance genes found in the ΦSsUD.1 phage scaffold differed from, but were in the same position as, cargo genes carried by other streptococcal phages. The chromosome integration site of ΦSsUD.1 was at the 3′ end of a conserved tRNA uracil methyltransferase (rum) gene. This site, known to be an insertional hot spot for mobile elements in S. pyogenes, might play a similar role in S. suis.

tet(W) is an emerging tetracycline resistance determinant whose host range, including Gram-positive, Gram-negative, aerobic, and anaerobic bacteria, is second only to that of tet(M) among ribosomal protection tet genes (26). tet(W) was first identified in the rumen anaerobe Butyrivibrio fibrisolvens (3), where it was associated with a transposable chromosomal element. It was subsequently detected in several other bacteria of the animal and human gastrointestinal tract, associated with either conjugative or nonconjugative elements (1, 5, 13, 14, 19, 29-31, 33, 37).

In 2008 we first described tet(W) in Streptococcus suis, in a human isolate from a sporadic case of meningitis in Italy (23). S. suis, a major swine pathogen worldwide, is emerging as a zoonotic agent, the most common human clinical manifestations being meningitis and sepsis (20, 39). Most cases of human S. suis infection have originated in Southeast Asia, where pig rearing is widespread, and large outbreaks have occurred in China (20). In industrialized countries human infections are rare, albeit probably underdiagnosed, and usually arise as sporadic cases. The growing interest in this emerging pathogen is reflected by recent whole-genome sequencing studies of selected isolates directed at elucidating the occurrence and evolution of the genetic determinants of its pathogenicity and drug resistance (7, 18, 43). High rates of tetracycline resistance have been reported in both human and pig isolates of S. suis (17, 22, 41, 44). Before our report (23), tet(M) and tet(O) were the only tetracycline resistance determinants identified in S. suis (8, 35, 38, 42); quite recently, tet(L) (18), mosaic tet(O/W/32/O) (25), and tet(W) itself (25, 43) have also been reported.

The present study reports the molecular characterization of the tet(W) gene-carrying elements in two human S. suis isolates, the one detected first (23) and another tet(W)-positive isolate from another patient with meningitis reported in a recent survey in Italy (25). The two genetic elements, both carrying erm(B) besides tet(W), were completely different. In the former isolate, the tet(W)-carrying element was almost identical, apart from an erm(B)-containing insertion, to a genomic island occurring in a recently sequenced S. suis genome. In the latter, the tet(W) gene was associated with a new transferable element resembling a phage that also carried other antibiotic (macrolide, aminoglycoside, and streptothricin) and heavy metal (cadmium) resistance genes.

MATERIALS AND METHODS

Bacterial strains.

Two S. suis strains, SsCA and SsUD, both isolated from cerebrospinal fluid in two patients with meningitis, were investigated. They were characterized for several features in a recent survey of S. suis isolates in Italy (25) and found to represent related but distinct clones, both belonging to serotype 2 and sequence type 1 (ST1). Both SsCA and SsUD were resistant to tetracycline [MICs, 16 and 8 μg ml⁻¹, respectively; genotype tet(W)] and to erythromycin [MICs, >256 μg ml⁻¹ and 4 μg ml⁻¹, respectively; genotype, both erm(B)]. Cultures were maintained in glycerol at −70°C and subcultured twice on sheep blood agar before use in the following experiments.

Antimicrobials and susceptibility tests.

Tetracycline, erythromycin, streptomycin, and kanamycin were purchased from Sigma Chemical Co., St. Louis, MO. MICs were determined by broth microdilution as recommended by the Clinical and Laboratory Standards Institute (9). Susceptibility to cadmium sulfate (BDH Laboratory Supplies, Poole, United Kingdom) was determined by a spectrophotometric assay as described elsewhere (24).

Amplification experiments.

The principal primer pairs used in PCR experiments are listed in Table 1. DNA preparation and amplification and electrophoresis of PCR products were carried out by established procedures and according to the reported conditions for the use of individual primer pairs. The Ex Taq system (TaKaRa Bio, Shiga, Japan) was used when the expected PCR products exceeded 3 kb in size. For inverse PCR, total genomic DNA was digested with AclI, BfoI, or HindIII (Roche Applied Science, Basel, Switzerland) and self-ligated overnight using T4 DNA ligase (Invitrogen, Carlsbad, CA). The ligated DNA was precipitated, centrifuged, dried, and suspended in 100 μl of Tris-EDTA buffer prior to use as a template in PCR.

TABLE 1.

Principal oligonucleotide primer pairs used

Gene	Primer designation	Sequence (5′-3′)	Reference	Expected product size (bp)
Inverse PCR
tet(W)	tetW-R	ATTTTCATGTGATTGTCCTCC	This study
tet(W)	tetW-F	CTGCTATATGCCAGCGGAGC	This study
erm(B)	ermB-F	TGCCAGCGGAATGCTTTCATC	This study
erm(B)	ermB-R	TATTTGGTTGAGTACCTTTTC	This study
tet(W)-carrying element from strain SsCA
orf464-GZ1a	luci-F	ATGTAGAGTCCACCATCAAG	This study
orf1-SsCAb	DNApol-F	CACTATGCCGACAGGTATGG	This study	6,650
orf1-SsCA	DNApol-R	CCATACCTGTCGGCATAGTG	This study
orf11-SsCA	hp-F	ATACAACGGAATGACGGC	This study	11,278
orf10-SsCA	trse-R	GCTCGGCTACCATACTGTCC	This study
orf16-SsCA	traG-F	AAAAGGTCGCTCTGTTCG	This study	3,615
orf16-SsCA	traG-R	CCGTGAATATGGTCGGCAG	This study
orf496-GZ1	heli-F	ATGTTCAGGACAGACTTATCG	This study	8,258
orf496-GZ1	heli-R	TCGTGTGTTCGGCACTTCG	This study
orf496-GZ1	heli-F2	CGATTATGAAGCAGAGGTT	This study	7,294
orf496-GZ1	heli-R2	TTGCTTCAAAATGCTGTGC	This study
orf501-GZ1	coll-F	GTAAAGACAAGTGAGGACGG	This study	7,254
orf501-GZ1	coll-R	AGCAGATAACCTTCGGACG	This study
orf509-GZ1	lysyltRNA-F	ACTTCTGGCAAGAGATGAGC	This study	8,221
tet(W)-carrying element from strain SsUD
orf596-GZ1	rum-F	GCATCTCACTTATCCAGCCC	This study
cadC	cadC-R	GGGCAACACTAGAAATATCT	This study	2,205
orf15-SsUDc	ϕpol-R	CTCATCCCAAACAAAATC	This study
orf26-SsUD	ϕendo-R	CCATAAGGTACTAGGTTAG	This study	9,866
orf24-SsUD	ϕSAM-F	GATTGTGGCTGATACCTACG	This study
orf45-SsUD	ϕmtail-R	CCGTATCCATTCCAGAGG	This study	14,856
orf44-SsUD	ϕhp-F	CCAGTTCAGGAAGTAGCCC	This study
orf51-SsUD	ϕamid-R	CCTTTCCTGCTTCTGTGATG	This study	9,421
orf50-SsUD	ϕholin-F	TAAAACAAATCAACGAGAGGTG	This study
orf598-GZ1	glf-R	CCTCGTTTCCAGGTCTTCG	This study	14,051
Probes
tet(W)	x-F	GAATTCTTGCCCATGTAGAC	32
tet(W)	x-R	AAGAGCGGTACACCTCCG	32	229
tet(W)	y-F	CCAGGTAAAAAAGGATGAAGT	32
tet(W)	y-R	GGGCTGGATGACTGGCTTG	This study	142
erm(B)	z-F	TCATCTATTCAACTTATCGTC	This study
erm(B)	z-R	CTGTGGTATGGCGGGTAAG	This study	340

^aNumbered according to the reported sequence of the genome of Streptococcus suis GZ1 (accession no. CP000837).

^bNumbered according to the reported sequence from S. suis SsCA (accession no. FN396364).

^cNumbered according to the reported sequence of ΦSsUD.1 (accession no. FN997652).

DNA sequencing and sequence analysis.

PCR products were purified using Montage purification columns (Millipore Corporation, Bedford, MA). Sequencing was carried out (bidirectionally or by primer walking) using ABI Prism (Perkin-Elmer Applied Biosystems, Foster City, CA) with dye-labeled terminators. Sequences were analyzed using the Sequence Navigator software package (Perkin-Elmer). Open reading frames (ORFs) were predicted using the ORF Finder software (http://ncbi.nlm.nih.gov/gorf/gorf.html). Criteria to design a potential ORF were the existence of a start codon and a minimum coding size of 50 amino acids. Sequence similarity searches were carried out using BLAST (http://www.ncbi.nlm.nih.gov).

Transfer experiments.

Three tetracycline- and erythromycin-susceptible strains of different species were used as recipients in mating experiments: S. suis v36RF, a rifampin- and fusidic acid-resistant derivative of pig strain v36 (25); Streptococcus pyogenes 12RF (15); and Enterococcus faecalis JH2-2. Transfer of tetracycline resistance was performed on a membrane filter (40), selecting on suitable tetracycline concentrations. Frequency of transfer was expressed as the number of transconjugants per recipient. Transfer experiments were done a minimum of three times.

PFGE and hybridization experiments.

Macrorestriction with SmaI endonuclease (Roche) and pulsed-field gel electrophoresis (PFGE) analysis were performed as described elsewhere (25). Southern blotting and hybridization assays were done as described previously (15), using probes obtained by PCR with the oligonucleotide primer pairs reported in Table 1.

Phage induction.

For phage induction, the S. suis test strains were grown overnight in Todd-Hewitt (plus yeast extract) liquid medium (Difco Laboratories, Detroit, MI) at 37°C in 5% CO₂. The overnight culture was diluted 1:100 with prewarmed medium, grown to an optical density at 600 nm (OD₆₀₀) of 0.2, divided into 50-ml aliquots, and treated with mitomycin C (0.2 to 2 μg ml⁻¹; Sigma) or with nothing (control). Growth and lysis were monitored by optical density. S. pyogenes m46 was used as a positive control of induction (6).

Nucleotide sequence accession numbers.

The nucleotide sequences reported in this paper have been submitted to the GenBank/EMBL sequence database under the following accession numbers: FN396364, tet(W)-flanking region from strain S. suis SsCA; FN997652, complete genome sequence of ΦSsUD.1, with its chromosome integration site; and FN677480, left and right junctions of the SsUD.1 element in S. pyogenes T12RF-1 (transconjugant).

RESULTS AND DISCUSSION

The genetic organization of the tet(W)-carrying elements from the two S. suis strains was determined by combining PCR, inverse PCR, and DNA sequencing. SsCA and SsUD were eventually found to harbor two completely different genetic elements, which shared a short tet(W)-containing segment (2,940 bp) slightly larger than the gene (1,920 bp). In particular, the coding sequences of the tet(W) genes from strains SsCA and SsUD, both containing a SmaI restriction site, displayed 99.17% identity. In BLASTN assays, the most significant database matches were with the tet(W) gene of Arcanobacterium pyogenes 52785-99 (accession no. DQ519395) for the gene of strain SsCA (99.48% identity) and with the tet(W) gene of S. suis GZ1 (accession no. CP000837) for the gene of strain SsUD (99.95% identity).

tet(W)-carrying element from strain SsCA.

Repeated mating experiments using strain SsCA as the donor yielded no detectable transfer of tetracycline resistance to susceptible recipients of three different species (S. suis v36RF, S. pyogenes 12RF, and E. faecalis JH2-2).

A 16,318-bp region surrounding tet(W) was sequenced. It contained 16 putative ORFs [numbered orf1 to orf16, tet(W) being orf5]. orf1 to orf11 and orf14 to orf16 were homologous to and were arranged in the same order as orf8 to orf18 and orf21 to orf23, respectively, of the tet(W)-containing genomic island of S. suis GZ1 (∼47 kb; accession no. CP000837), a highly pathogenic ST1 human isolate (43) (Fig. 1). Remarkably, orf12 and orf13 of the SsCA sequenced region were identified as the erm(B) gene and its leader peptide, respectively. The 16 ORFs and their main characteristics as indicated by BLASTP analysis are detailed in Table S1 in the supplemental material. PCR experiments demonstrated that strain SsCA shared the entire genomic island of strain GZ1, with a similar genetic organization and the same chromosomal location (immediately downstream of the lysyl-tRNA synthetase chromosomal gene).

FIG. 1.

Genetic organization of the tet(W)-carrying element of S. suis strain SsCA. The sequenced tet(W)-flanking region of 16,318 bp (accession no. FN396364) is aligned with the corresponding region of the tet(W)-carrying genomic island of S. suis GZ1 (accession no. CP000837), shown with its chromosomal junctions. The ORFs, indicated as arrows pointing in the direction of transcription, are numbered consecutively: orf1 to orf16 in the sequenced region of SsCA and orf1 to orf44 in the genomic island of GZ1 (i.e., orf465 to orf508 in the GZ1 genome). ORFs are depicted as white arrows except for tet(W) (striped), erm(B) (spotted), and chromosomal genes (black; A, luciferase; B, lysyl-tRNA synthetase). Gray areas between ORF maps denote ≥90% amino acid identity. The major primer pairs also shown are those that, based on positive PCRs with amplicons of expected sizes, indicated that the entire genomic island of strain GZ1 is found in strain SsCA, with a similar genetic organization and the same chromosomal location.

tet(W)-carrying element from strain SsUD.

In mating experiments with strain SsUD as the donor, tetracycline was successfully transferred, though to only one (S. pyogenes 12RF) of the susceptible recipients and at a low frequency (7 × 10⁻⁹). Remarkably, the transconjugants carried not only tet(W) but also erm(B), suggesting a linkage of the two resistance genes in the transferred element. Phenotypically, the transconjugants exhibited the same tetracycline and erythromycin MICs as did the donor.

A representative transconjugant (designated T12RF-1) was used in experiments aimed at confirming and characterizing the mobile element. The results of SmaI PFGE analysis (Fig. 2A) and hybridization experiments using three specific DNA probes (Fig. 2B) were consistent with the insertion of an ∼60-kb element into the genome of the recipient.

FIG. 2.

PFGE and hybridization studies. (A) PFGE patterns of SmaI-digested genomic DNA of the transconjugant (S. pyogenes T12RF-1) (lane 1) and the recipient (S. pyogenes 12RF) (lane 2) from mating S. suis SsUD with S. pyogenes 12RF. White arrowheads indicate an ∼240-kb fragment of the recipient (lane 2) that disappeared and two new fragments of ∼230 kb and ∼70 kb, respectively, that appeared in the transconjugant (lane 1). Lane M, molecular size markers (low-range PFG marker; New England Biolabs, Beverly, MA), with relevant sizes on the left. (B) Southern blotting and hybridization using three different probes: probes x and y, specific for DNA regions upstream and downstream, respectively, of the SmaI site internal to tet(W); and probe z, specific for the erm(B) gene. Lanes 1, transconjugant; lanes 2, recipient.

The transferable element from strain SsUD was completely sequenced beginning from the tet(W)- and the erm(B)-surrounding regions, and its chromosomal junctions were determined. Its size was 60,711 bp. The G+C content was 39.7%. Genome sequence analysis revealed 64 ORFs, of which 43 were transcribed in the same direction and 21 in the opposite direction. The new element displayed a typical prophage structure, with the modular organization of tailed bacteriophages. In particular, the highest BLASTN score was Φm46.1 (accession no. FM864213), the main element carrying mef(A) and tet(O) genes in S. pyogenes (6) (Fig. 3). Significant but lower homologies were detected with Φ10394.4 from S. pyogenes (accession no. AY445042) and λSa04 from Streptococcus agalactiae (accession no. CP000114). The new element was named ΦSsUD.1, even though multiple assays with mitomycin C provided no evidence of phage induction. The ORFs detected and their main characteristics as indicated by BLASTP analysis are detailed in Table S2 in the supplemental material.

FIG. 3.

ORF map and genome organization of the ΦSsUD.1 prophage and its alignment with the genome map of Φm46.1. Both ΦSsUD.1 and Φm46.1 are shown with their chromosomal junctions in S. suis SsUD and in S. pyogenes m46, respectively. The ORFs, indicated as arrows pointing in the direction of transcription, are numbered consecutively in the two prophages. ORFs are depicted as white arrows except for tet(W) (striped), other resistance genes (spotted), and chromosomal genes (black). Phage functional modules are identified by bars. Areas showing >70% homology between ORF maps are color coded, to denote different percent amino acid identities: light gray, 70 to 80%; medium gray, >80 to 90%; dark gray, >90%.

In the phage scaffold of ΦSsUD.1, the tet(W) gene (orf11) was part of an ∼5-kb segment of nonphage DNA, also containing orf10 and orf12, located between the lysogeny control and the DNA replication modules.

The erm(B) gene was the last ORF (orf64) of ΦSsUD.1 and was part of another segment of nonphage DNA (∼8 kb). Interestingly, it was part of a combination of resistance genes that closely resembled the so-called MAS (macrolide-aminoglycoside-streptothricin) fragment, reported in streptococci only in the species Streptococcus pneumoniae (36), specifically in transposons Tn6003 (11) and Tn1545 (10). Such a resistance gene combination includes erm(B) and an aminoglycoside-streptothricin resistance cluster (aadE-sat4-aphA-3). Compared to the MAS fragment of pneumococcal transposons Tn6003 and Tn1545, the erm(B) leader peptide (84 bp in the prototype sequence) was truncated, consisting only of the 37 nucleotides at the 3′ end in the prototype sequence. Further studies are needed to understand whether the erythromycin MIC of strain SsUD [4 μg ml⁻¹, lower than the MICs usually associated with erm(B)-mediated resistance] may be related to this alteration. Moreover, unlike the MAS fragment of pneumococcal transposons, erm(B) did not lack the stop codon and aadE was not truncated in ΦSsUD.1. This might reflect a different rearrangement of part of E. faecalis plasmid pRE25 (28) compared to that suggested for the pneumococcal MAS fragment (11).

A cadmium resistance cassette was detected between the tet(W) gene and the left end of ΦSsUD.1. It was formed by the two adjacent cadmium efflux genes cadC (orf2) and cadA (orf3), which were also detected, in streptococci, in Streptococcus thermophilus (27), S. agalactiae (34), and group G streptococci (12).

Consistent with the presence of other resistance determinants in addition to the tet(W) and erm(B) genes, the transconjugants, as well as the donor, exhibited 8- to 16-fold-higher streptomycin and kanamycin MICs than did the recipient and grew at an over-10-fold-greater cadmium concentration (data not shown).

The chromosome integration site of ΦSsUD.1 was found to be the same—at the 3′ end of a conserved tRNA uracil methyltransferase (rum) gene—in both S. suis SsUD and the S. pyogenes transconjugant. This integration site exactly corresponds to that described for Φm46.1 (6).

Concluding remarks.

tet(W), though still uncommon compared to more conventional genes such as tet(M) and tet(O), is emerging as a tetracycline resistance determinant in S. suis. The two S. suis strains investigated herein, both Italian isolates from patients with meningitis (23, 25), are two of the only three human isolates reported to harbor tet(W), the third being a Chinese isolate (GZ1) from a patient with septicemia (43). While sharing a short DNA segment containing tet(W), the two strains displayed diverse surrounding genetic environments and were eventually found to carry completely different genetic elements. Both elements carried erm(B), but the genetic environment surrounding it differed in the two elements. The one from strain SsCA exhibited a novel arrangement compared to recently reviewed genetic elements responsible for erythromycin resistance in streptococci (36). In the element from strain SsUD, erm(B) was part of a combination of resistance genes very similar to the so-called MAS fragment previously detected in S. pneumoniae transposons Tn6003 and Tn1545 (10, 11).

The tet(W)-carrying genetic element from strain SsCA was apparently nontransferable, and aside from an erm(B)-containing insertion, it closely resembled a genomic island recently described in S. suis GZ1 (43) in sequence, organization, and chromosomal location.

The mobile element from strain SsUD displayed a typical prophage organization and was named ΦSsUD.1 accordingly. Nevertheless, unlike Φm46.1 and Φ10394.4, where treatment with mitomycin C yields typical siphoviruses (2, 6), ΦSsUD.1 appeared to be noninducible. It proved transferable, at a low frequency, by using a filter conjugation technique. However, it cannot be excluded that phage induction did occur at a low, hardly detectable rate and that transfer occurred via an alternative mobilization mode. ΦSsUD.1 exhibits a new combination of antibiotic and heavy metal resistance genes, resulting from the copresence of the tet(W) gene, a MAS fragment, and a cadC/cadA cassette. Such resistance genes fitting in the ΦSsUD.1 phage scaffold differ from, but are in the same position as, cargo genes carried by other phages: for instance, cadC and cadA versus mef(A) in Φm46.1 (6) and Φ10394.4 (2), tet(W) versus a restriction/modification system in Φ10394.4 (2), and the erm(B)-containing MAS fragment versus tet(O) in Φm46.1 (6). ΦSsUD.1 appears to be a novel genetic element. In S. suis, no resistance genes have previously been detected in sequenced phage genomes (16, 21). The chromosome integration of ΦSsUD.1 into the S. suis rum gene, at the same site where Φm46.1 is integrated into the S. pyogenes rum gene, suggests that this site, known to be an insertional hot spot for mobile elements in S. pyogenes (4, 6), may play a similar role in S. suis.