Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Dec 9.
Published in final edited form as: Neuron. 2010 Dec 9;68(5):879–893. doi: 10.1016/j.neuron.2010.11.016

The Drosophila miR-310 cluster negatively regulates synaptic strength at the neuromuscular junction

Kazuya Tsurudome 1,*, Karen Tsang 1,*, Edward H Liao 1,*, Robin Ball 1, Jay Penney 1, Jr-Shiuan Yang 2, Fatima Elazzouzi 1, Tao He 3, Athar Chishti 4, Greg Lnenicka 3, Eric C Lai 2, A Pejmun Haghighi 1,#
PMCID: PMC3034365  NIHMSID: NIHMS253481  PMID: 21145002

SUMMARY

Emerging data implicate microRNAs (miRNAs) in the regulation of synaptic structure and function, but we know little about their role in the regulation of neurotransmission in presynaptic neurons. Here we demonstrate that the miR-310-313 cluster is required for normal synaptic transmission at the Drosophila larval neuromuscular junction. Loss of miR-310-313 cluster leads to a significant enhancement of neurotransmitter release, which can be rescued with temporally restricted expression of mir-310-313 in larval presynaptic neurons. Kinesin family member, Khc-73 is a functional target for miR-310-313 as its expression is increased in mir-310-313 mutants and reducing it restores normal synaptic function. Cluster mutants show an increase in the active zone protein Bruchpilot accompanied by an increase in electron dense T-bars. Finally, we show that repression of Khc-73 by miR-310-313 cluster influences the establishment of normal synaptic homeostasis. Our findings establish a role for miRNAs in the regulation of neurotransmitter release.

INTRODUCTION

The ability of neurons to modify their synaptic strength and remodel their synaptic structures, also called synaptic plasticity, is crucial for appropriate establishment of neuronal circuits during development and is required for higher brain functions such as learning and memory throughout life (Davis, 2006; Flavell and Greenberg, 2008; Ramocki and Zoghbi, 2008; Turrigiano, 2007). As such, many brain diseases are associated with defects in synaptic plasticity (Kreitzer and Malenka, 2007; Lynch et al., 2007; Walsh et al., 2002). Emerging data suggest that micro RNAs (miRNAs) participate in modulating synaptic structure and function by restricting the expression of target genes (Bicker and Schratt, 2008; Flynt and Lai, 2008; Karr et al., 2009; Rajasethupathy et al., 2009; Ruby et al., 2007; Simon et al., 2008). Micro RNAs are small non-coding RNAs that interact with sequences known as seeds in the 3′-UTR of target mRNAs, leading to translational suppression or degradation of the mRNA. Hundreds of miRNAs have been identified in a number of organisms from humans to worms and thousands of targets have been predicted for these miRNAs in a number of tissues (Bartel, 2009). Recent data has indicated a specific role for miRNAs in the regulation of neuronal structure and function. miRNA-dependent mechanisms have been shown to be important for memory storage in Drosophila (Ashraf et al., 2006) and for long-term synaptic plasticity in Aplysia (Rajasethupathy et al., 2009). In addition, recent findings have highlighted the role of miRNAs postsynaptically, in growth factor-dependent and activity-driven remodelling of dendrites (Schratt et al., 2006; Wayman et al., 2008), in the regulation of postsynaptic receptor expression (Edbauer et al., 2010; Karr et al., 2009; Simon et al., 2008), as well as in epithelial tissue, for scaling growth of dendritic arbors (Parrish et al., 2009). In spite of these and other recent findings, little is known about the function of miRNAs in presynaptic neurons and their potential participation in the regulation of synaptic strength.

We took advantage of available Gal4 enhancer trap inserts in Drosophila melanogaster to look for potential miRNAs that show specific expression during larval stages in motor neurons and identified a cluster of four miRNAs, miR-310-313. We found that the genetic loss of this cluster led to a significant enhancement of neurotransmitter release at the Drosophila larval neuromuscular junction, a defect that was fully restored by transgenic expression of the four miRNAs in a spatially and temporally restricted manner. While several hundred targets are predicted for this miRNA cluster, we identified Khc-73, a kinesin super family member, as a target that could account for the majority of synaptic defects in mir-310-313 mutants. We found that heterozygosity for Khc-73 significantly corrected the synaptic transmission defects in mir-310-313 mutants and over expression of Khc-73 in motor neurons mimicked the loss of function phenotype of miR-310-313 cluster. Furthermore, we demonstrated that loss of mir-310-313 or over expression of Khc-73 led to an increase in the accumulation of the active zone protein, Bruchpilot (Brp). Consistent with this finding, we found an increase in the appearance of electron dense structures at active zones in mir-310-313 mutant larvae. Finally, consistent with the role of Brp in facilitating the localization of the presynaptic calcium channel Cacophony (Cac), we found that heterozygosity for cac significantly reduced the increase in quantal release in mir-310-313 mutants. Based on our findings, we propose a model in which the miR-310 cluster regulates neurotransmitter release at presynaptic terminals by attenuating the expression of Khc-73 and thereby restricting the accumulation of Brp at active zones, ultimately modulating presynaptic calcium influx.

RESULTS

By screening GAL4 enhancer traps with a UAS-GFP-mCD8 reporter, we found that insertions upstream of the miR-310, -311, -312, -313 cluster (hereafter named the miR-310 cluster) exhibited activity in larval stage motor neurons (Figure 1A–C and S1A). We detected GFP expression in almost all neurons in the central nervous system (CNS) and in the ventral nerve cord (VNC) (Figure 1A and 1B) including in motor neurons (Figure 1C). This prompted us to evaluate the potential role of the miR-310 cluster in regulating synaptic growth during larval development. To do so, we mobilized the P-element insert P{GSV1}GSd033 (Mindorff et al., 2007) and generated a 1159 bp deletion (KT40). This excision removes the mir-310 cluster, but does not affect flanking protein-coding loci. We also retained a precisely excised line (KT2) as a control for our subsequent experiments (Figure S1A).

Figure 1. miR-310 cluster is transcribed in larval motor neurons and is a negative regulator of synaptic function.

Figure 1

Open in a new tab

(A–B) Gal4 insertion P{GawB}NP5941 in the miR-310-313 locus drives expression of UAS-mCD8-GFP in (A) CNS, motor axons and peripheral neurons but not in muscles in dissected whole 3rd instar larva (Scale bar is 500 μm) and (B) GFP is detectable in all neurons of the ventral nerve cord at varying degrees of intensity (Scale bar is 50μm) (C) Gal4 insertion P{GawB}NP4255 in the miR-310-313 locus drives expression of UAS-mCD8-GFP in a motor axon innervating muscle 4 in the 3rd abdominal segment (A3) (Scale bar is 10μm). (D) Muscle 4 NMJs of deficiency Df(2R)Exel6070 spanning the miR-310 cluster locus, heterozygote (top) and in trans to KT40 (P{GSV1}GSd033 imprecise excision) (bottom) co-stained with anti-Hrp (green) and anti-Dlg (red) (Scale bar is 10μm).

(E) EJPs, EJCs and mEJCs recorded from muscle 6 in the third abdominal segment in wandering third instar larvae in the following genotypes: wild-type (w1118), KT40/+, KT40/KT40, P{GSV1}GSd033 precise excision (KT2/KT2) and BG380/+; KT40/KT40; UAS-miR-310 cluster/+ (KT40 neuronal rescue). For EJPs and EJCs 10 consecutive superimposed traces recorded at 0.5 Hz stimulation rate are shown. For mEJCs sample traces of continuous recording in the absence of stimulation are shown.

(F) Quantification for mEJC, EJC and QC normalized to wild-type (w1118) for the indicated genotypes. One-way ANOVA, Games-Howell post hoc test

(G) Comparison of QC measurements using Failure analysis at 0.25 mM external [Ca2+]. w1118 (n=6) vs. KT40/KT40 (n=10), P=0.0024. KT2/KT2 (n=7) vs. KT40/KT40 (n=10), P=0.0099. KT40/KT40 vs. KT40/KT40 neuronal (elav-Gal4) rescue (n=8), P=0.0084 One-way ANOVA was used. *P<0.05, **P<0.01 and ***P<0.001. See S7 for details of statistical analysis.

The KT40 stock was homozygous viable and fertile with no visible morphological abnormalities; the same was true when KT40 was placed in trans to two different deficiency chromosomes that uncover the mir-310 cluster. We performed more detailed analysis of all three genotypes in parallel, but collectively refer to them as “KT40” mutants. Loss of the miR-310 cluster did not affect the gross morphology of synapses (Figure 1D) and we found no significant differences in the number of synaptic boutons and branch points per muscle surface area (MSA) at muscle 4 and muscle 6/7 NMJs between KT40 mutants and heterozygote controls (Figure S1B), indicating that the miR-310 cluster does not normally participate in the regulation of synaptic structural growth at the neuromuscular junction (NMJ).

miR-310 cluster is a negative regulator of synaptic function

Next, we tested whether loss of the mir-310 cluster could influence the functional properties of the NMJ. Our electrophysiological analysis revealed a significant increase in the size of evoked excitatory junctional potentials (EJPs) in KT40 mutant larvae (Figure 1E), with no associated change in muscle membrane potential (Figure S1F) or defect in Ca2+ cooperativity in KT40 mutant larvae (Figure S1G). To further evaluate the amount of neurotransmitter release, we measured synaptic currents using the voltage-clamp technique. We observed a dramatic increase in the average amplitude of evoked excitatory junctional currents (EJCs); however, the size of miniature EJCs (mEJC) were unaffected (Figure 1E, 1F, S1C and S1H). This resulted in a significant increase in quantal content (QC) (Figure 1F). We found no changes in quantal measurements in the precise excision line, KT2, indicating that the KT40 defects in neurotransmitter release are due to loss of mir-310-313 (Figure 1E and F). An alternative and direct way to measure changes in neurotransmitter release is failure analysis, where synaptic strength in low external calcium is measured by the proportion of the number of stimuli that evoke EJCs to those that fail. This measurement also revealed a significant increase in synaptic strength in larvae deficient for the miR-310 cluster (Figure 1G and S1I) compared to wild type or KT2 larvae. Finally, consistent with the enhancement in synaptic release, we observed a significant increase in the frequency of spontaneous release in KT40 mutant larvae compared to KT2 homozygous or w1118 control larvae (Figure S1J). These results establish the miR-310 cluster as a negative regulator of synaptic release at the NMJ.

miR-310 cluster is required in motor neurons during larval development

Members of the miR-310 cluster are maternally deposited and present in early embryos (Aravin et al., 2003; Leaman et al., 2005; Ruby et al., 2007). To test the effect of maternal contribution of the miR-310 cluster on synaptic transmission at the NMJ, we compared synaptic release in the KT40 homozygous progeny of KT40 homozygous and heterozygous females, and found no differences (data not shown). This suggested that the early embryonic expression of the miR-310 cluster does not substantially influence the regulation of synaptic strength in the larva. Based on these findings, we hypothesized that the role of the miR-310 cluster in regulating neurotransmitter release depends on its function in motor neurons during larval development. We tested this directly by driving a UAS-miR-310 cluster transgene with specific neuronal Gal4 drivers in KT40 mutants. Indeed, activation of the miR-310 cluster in motor neurons using BG380-Gal4, (Figure 1E and 1F) or pan-neuronally using elav-Gal4, (Figure S1C and S1D) could fully rescue the KT40 mutant phenotype. We further assessed the temporal requirement for miR-310 cluster using Gene-Switch elav-Gal4 (elav-GS-Gal4), that could be activated specifically during larval development (Nicholson et al., 2008); this also rescued KT40 (Figure S1E). Overexpression of miR-310 cluster alone with elav-GS (Figure S1E), BG380 or OK6 (data not shown) did not affect baseline neurotransmission. Finally, we tested whether individual members of the cluster can rescue KT40, and found that miR-313 but not miR-310 was able to rescue KT40 defects (S1K). While this finding may suggest that miR-313 is more relevant to the endogenous function of the cluster in motor neurons, it is difficult to assess whether the level of expression or individual specificity of these two miRNAs account for this difference. Altogether, these data demonstrate that the genetic requirement for the miR-310 cluster in regulating neurotransmitter release and synaptic activity can be localized to motor neurons during the period of rapid synaptic growth in larval development.

Khc-73 shows strong genetic interaction with KT40 mutants

Experimental and computational strategies predict that hundreds of transcripts are often directly targeted by individual miRNAs, suggesting that the phenotypic basis for the removal of a miRNA might not easily be attributable to particular changes in gene activity (Bartel, 2009). The four members of the miR-310 cluster share a seed region with miR-92, for which ~350 conserved targets have been predicted in Drosophilid genomes (http://www.targetscan.org) (Lewis et al., 2005). On the other hand, genetic analyses have revealed a growing number of instances for which substantial phenotypic aspects of miRNA mutant animals can be attributed to the derepression of one or a few target genes (Bushati and Cohen, 2007; Flynt and Lai, 2008). In theory, target genes that are coexpressed with miRNAs of interest are more likely to exhibit compelling functional effects, compared to targets with mutually exclusive expression relative to cognate miRNAs (Farh et al., 2005; Stark et al., 2005). Thus, we chose three target genes based on their high rank as a predicted target as well as their relevance to neuronal function: CrebA, lap (AP180 homologue) and Khc-73 (Kinesin Heavy Chain 73). While the role of CrebA in the nervous system has not been studied, both Khc-73 and Lap are expressed in motor neurons (Siegrist and Doe, 2005; Zhang et al., 1998). In particular, Lap has been shown to participate in neurotransmitter release regulation at the Drosophila larval NMJ (Zhang et al., 1998). Similarly, Khc-73 is highly expressed in the nervous system at late embryonic stages (Li et al., 1997) and is involved in early neural development (Siegrist and Doe, 2005). We tested the effect of heterozygosity for these three genes on the increase in quantal content in KT40 mutant larvae. Strikingly, we found a significant reduction in EJCs and QC when one copy of Khc-73 was removed but found no effect as a consequence of removal of one copy of crebA or lap (Figure 2A, 2B and S2). These results are consistent with Khc-73 being a key target of the miR-310 cluster. To examine the functional connection between miR-310 cluster and Khc-73 further, we reduced Khc-73 activity in KT40 mutant larvae, by neuronal specific expression of a knockdown transgene, UAS-Khc-73-RNAi (Siegrist and Doe, 2005). We found that overexpression of UAS-Khc-73-RNAi in motor neurons was able to fully suppress the increases in EJCs and in QC in KT40 mutant larvae (Figure 2A, 2C). This finding indicates that the increase in neurotransmitter release in KT40 larvae is a direct consequence of derepressing Khc-73 in motor neurons.

Figure 2. Reduction in Khc-73 leads to suppression of quantal content in KT40 mutants.

Figure 2

Open in a new tab

(A) EJCs and mEJCs for the indicated genotypes. Df(2R)Exel6285 was used as DfKhc-73. UAS-Khc-73-RNAi was driven by the pan-neuronal driver elav-Gal4.

(B and C) Quantifications for mEJC, EJC, and QC for the indicated genotypes, n=20, 19, 25, 21 for B and 20, 27, 20, 13 and 20 for C, respectively. One-way ANOVA: *P<0.05, **P<0.01 and ***P<0.001. See S7 for details.

(D) EJPs, EJCs and mEJCs for control (BG380-Gal4/+), Khc-73 overexpression (OE) (BG380-Gal4/+;UAS-HA:Khc-73/+) and Khc-73-RNAi overexpression (BG380-Gal4/+;UAS-Khc-73-RNAi/+). (E) Quantification of mEJC, EJC and QC for the genotypes in (D). n=19, 19 and 8, respectively. One-way ANOVA. *P<0.05, **P<0.01 and ***P<0.001. See S7 for details.

Next, we tested whether modulation of Khc-73 could directly influence synaptic activity. While reducing Khc-73 in motor neurons using a knockdown transgene (Siegrist and Doe, 2005) did not significantly affect synaptic transmission, overexpression of Khc-73 induced a strong increase in QC (Figure 2D and 2E), phenocopying the effect of deleting the miR-310 cluster, thus further supporting the link between Khc-73 and the miR-310 cluster.

miR-310 cluster controls levels of Khc-73 in motor neurons

The Khc-73 3′ UTR contains five sites for miR-310 cluster members and three of these sites (including a full 8-mer) are highly conserved amongst the 12 sequenced Drosophila species (Figure 3A). In Drosophila S2 cultured cells, overexpression of miR-310 cluster caused a significant repression of a luciferase sensor carrying the entire Khc-73 3′-UTR (p=0.00002), indicating that Khc-73 is sensitive to the activity of the miR-310 cluster (Figure 3B). We tested the importance of the predicted conserved miR-310 cluster sites on Khc-73 3′-UTR by mutating all three conserved sites (see Experimental Procedures); these mutations abolished the sensitivity of the luciferase sensor to the miR-310 cluster (Figure 3B). In addition, we detected a seed sequence within the coding region of Khc-73. Our analysis suggested that this seed also confers sensitivity to miR-310 cluster (Figure S3E), as substitution of two nucleotides within this 7-mer significantly abolished this sensitivity (Figure 3C).

Figure 3. Khc-73 is a target of the miR-310 cluster.

Figure 3

Open in a new tab

(A) Schematic of Khc-73 transcript with target sites for the miR-310 cluster indicated.

(B) Luciferase activity of vector control, Khc-73-3′UTR luciferase reporter (Khc-73 3′UTR), and Khc-73-3′UTR with miR-310 cluster sites mutated (Khc-73 3′UTR mutated) in response to the miR-310 cluster (pUAST-miR-310 cluster) and control pUAST-miR-306. ***P=2.02×10−5 Student’s t-test. (C) Luciferase activity of vector control, Khc-73 exon 14 7-mer, Khc-73 exon 14 7-mer mutated and Khc-73 3′UTR in response to miR-310 cluster and miR-306. Khc-73 exon 14 7-mer vs. psiCHECK vector control ***P=2.06×10−5. Khc-73 exon 14 7-mer vs. Khc-73 exon 14 7-mer mutated ***P=0.00125 Student’s t-test. (D) Western blot analysis of Khc-73 protein levels in wild-type (w1118) and KT40 mutants using a Khc-73 specific antibody. Actin is a loading control. (E–L) Motor neuron axon expression of HA:Khc-73 using BG380 Gal4: (E–F) UAS-HA:Khc-73 with Khc-73 3′UTR in (E) Control and (F) KT40/KT40. (G–H) UAS-Khc-73 without Khc-73 3′UTR in (G) Control and (H) KT40/KT40. (I–J) UAS-Khc-73 without Khc-73 3′UTR in (I) Control and (J) miR-310 cluster overexpression. (K–L) UAS-HA:Khc-73 without Khc-73 3′UTR and with exon 14 miR-310 cluster site mutated in (K) Control and (L) miR-310 cluster overexpression. Stained with anti-HA (green) and anti-HRP (red). (Scale is 10μm). See also Figure S3.

In order to examine the effect of loss of miR-310 cluster on endogenous Khc-73 protein, we generated a polyclonal Khc-73 antibody. With this antibody, we could detect a specific band at approximately 250 kD (as predicted) in Western blots using larval tissue (Figure 3D). Using this antibody, we tested whether we could detect changes in Khc-73 levels in KT40 mutants in western blots. Our analysis showed an enhancement of Khc-73 levels in KT40 mutants by an average of 50% (n=3, normalized to actin, p=0.034) (Figure 3D). Consistently, we found that strong overexpression of UAS-Khc-73-RNAi led to a reduction in Khc-73 protein levels (Figure S3A and S3B). We also tested this antibody in immunofluorescence experiments, but could not detect specific staining in tissue (data not shown), suggesting that Khc-73 may be expressed normally at low levels. In order to test the role of Khc-3′UTR in conferring sensitivity to miR-310 cluster in vivo we examined the expression of HA tagged Khc-73 transgenes with or without the 3′-UTR in the presence or absence of miR-310 cluster. The HA-Khc-73 transgene with the 3′-UTR, expressed using BG380-Gal4 motorneuronal driver, (Figure 3E) was not detectable in wild type larval axons, but removal of the miR-310 cluster increased its expression in axons (Figure 3F). On the other hand, the HA-Khc-73 transgene without the 3′UTR showed readily detectable expression in wild type axons, which was not dramatically changed in the absence of miR-310 cluster (Figure 3G and 3H). A direct comparison between different transgenes for their expression levels is difficult, as many factors can influence their expression at the transcriptional level; therefore we have only compared the expression of the same transgene driven with the same Gal4 driver in the presence or absence of miR-310. Our findings show that Khc-73 transgene with 3′ UTR is much more sensitive to the endogenous levels of miR-310.

Next, we examined the consequence of overexpression of miR-310 cluster. The signal for the HA-Khc-73 with the 3′-UTR was not detectable in wild type (Figure 3E) nor when miR-310 was overexpressed (data not shown); however, we found that the signal associated with HA-Khc-73 without the 3′-UTR had strong sensitivity to elevated levels of miR-310 cluster (Figure 3I and 3J). Based on the results described in 3C, we expected this sensitivity to be due to the presence of the seed within the coding region. We then tested directly whether this site is responsible by mutating it, and found that indeed the substitution of the same two nucleotides (without altering the Khc-73 amino acid sequence) was sufficient to abolish sensitivity to miR-310 cluster (Figure 3K and 3L). These results together provide strong evidence indicating that Khc-73 is the relevant target of miR-310 cluster in vivo and provide some of the first evidence for in vivo relationship between miRNAs and their targets through seed sequences within the coding region.

miR-310 cluster regulates Brp expression and function in a Khc-73-dependent manner

How could changes in Khc-73 lead to changes in synaptic strength? Kinesins comprise a large family of motor proteins, some of which function in axonal transport and localization of synaptic molecules (Hirokawa and Noda, 2008; Pack-Chung et al., 2007). Therefore, we evaluated the expression of a panel of synaptic molecules in KT40 mutant larvae. We observed no statistically significant differences for the levels of presynaptic vesicle associated proteins Synaptotagmin (Syt) and Drosophila vesicular glutamate transporter (VGLUT), or the postsynaptic markers Discs Large (Dlg) and Glutamate receptor III (GluRIII) (Figure S4A). Interestingly, we found that the level of Bruchpilot (Brp), a component of T-bars at active zones (Fouquet et al., 2009; Kittel et al., 2006) was significantly increased in synaptic boutons in KT40 mutant larvae (Figure 4A, 4B, S4A and S4B). As a functional link between the miR-310 cluster and Khc-73 would predict, we found a similar increase in Brp in response to overexpression of Khc-73 in motor neurons (Figure S4C and S4D). We also tested whether overexpression of Khc-73-RNAi can restore Brp levels in KT40 mutants and found that indeed this is the case (Figure 4A and 4B) (P=0.0337, n=12).

Figure 4. miR-310 cluster genetic interactions with Khc-73 and the active zone protein brp.

Figure 4

Open in a new tab

(A) Brp at muscle 4 NMJs in KT40 (middle panel) is increased in intensity compared to wild type control (top panel). Brp staining intensity returns to wild-type in KT40 mutants when Khc-73 is suppressed by RNAi (bottom panel). (B) Quantification of fluorescence intensity of Brp staining normalized to HRP and expressed as a percentage of wild-type. Control (BG380/+) vs. KT40 (BG380/+;KT40/KT40) P=0.0138. KT40 vs. KT40; UAS-Khc-73-RNAi (BG380/+; KT40/KT40; UAS-Khc-73-RNAi/+) P=0.0337. n=12. Student’s t-test. (C) EJCs and mEJCs for the indicated genotypes. Df(2R)Exel6285 was used as DfKhc-73. To induce UAS-Brp expression, first instar larvae were transferred to food containing 50μM RU486. (D) Quantifications for mEJC, EJC, and QC for the indicated genotypes in (C). n=16, 15 and 16, respectively. elav-GS/+ vs. elav-GS/UAS-Brp, P=2.3×10−4 for EJCs and P=7.1×10−5 for QC. elav-GS/UAS-Brp vs. DfKhc-73/+;elav-GS/UAS-Brp, P=9.4×10−4 for EJCs and P=4.8×10−4 for QC. One way ANOVA with Tukey post hoc test was performed for statistical analysis for comparisons (E) Quantifications for mEJC, EJC and QC for the indicated genotypes. Overexpression of UAS-Brp in motor neurons causes a significant increase in QC and the increase in QC in KT40 homozygous larvae was suppressed by removing one copy of Brp. (F) Quantifications for mEJC, EJC and QC for the indicated genotypes. No significant differences found for mEJC, EJC and QC, between larvae overexpressing UAS-Brp in motor neurons (n=15), KT40 homozygotes (n=10) or larvae both homozygote for KT40 and overexpressing UAS-Brp in motor neurons (n=9). One-way ANOVA was performed. See also Figure S4 and S7.

We further examined the relationship between Khc-73, miR-310 cluster and Brp levels and the consequence of changes in Brp levels on neurotransmitter release at the NMJ by conducting genetic interaction experiments. First, we tested the consequence of elevation of Brp levels in motor neurons and found that overexpression of UAS-Brp in neurons during larval stages or in all motor neurons can lead to a similar increase in quantal content (Figure 4C to 4E). Our model would predict that the increase in quantal content in response to Brp gain of function should be sensitive to changes in Khc-73 protein levels and/or function. We tested this by removing one copy of Khc-73 gene while overexpressing UAS-Brp during larval stages. Indeed, heterozygosity for Khc-73 was capable of suppressing the increase in QC associated with Brp gain-of-function back to wild type levels (Figure 4C and 4D). Then, we tested the consequence of loss of Brp on KT40 mutants. Heterozygosity for brp led to a significant reduction in the increase in QC normally observed in KT40 homozygous mutant larvae (Figure 4E). Finally, we examined synaptic function in KT40 mutant larvae while overexpressing UAS-Brp. Our model suggests that loss of miR-310, and consequently the elevated level/function of Khc-73, can act by enhancing the accumulation/function of Brp; therefore, one would predict little or no additive effect of overexpressing Brp in KT40 mutants. In support of our model, we did not detect any statistical difference in quantal content and EJCs between KT40 mutants and KT40 mutants overexpressing Brp (Figure 4F). These results further establish a genetic link between Khc-73, miR-310 cluster and Brp, and highlight the importance of this link for the normal regulation of synaptic function.

To evaluate the consequence of loss of Khc-73, we assessed the levels of Brp expression at the NMJ in response to strong overexpression of Khc-73-RNAi. In this case, we found a moderate but statistically significant decrease in the level of Brp expression at the NMJ (Brp/Hrp fluorescence intensity ratio was 100±5.65 for BG380/+;UAS-Dcr-2/+ vs. 83.04±2.55 for BG380/+;UAS-Dcr-2/Khc-73-RNAi; Khc-73-RNAi/+, n=9, p<0.019). Similarly, while moderate transgenic overexpression of UAS-Khc-73-RNAi did not have an effect on quantal content (Figure 2D and 2E), strong overexpression of two copies of UAS-Khc73-RNAi together with UAS-Dcr-2 during larval stages led to a reduction in QC (25.37±2.15 for UAS-Dcr-2/+; elav-GS/+ (n=12) vs.14.28±3.10 for UAS-Dcr-2/Khc-73-RNAi; elav-GS/Khc-73-RNAi (n=10), 50μM RU486, p=0.0069, Student’s t-test).

Furthermore, while moderate overexpression of UAS-miR-310 cluster did not have any effect on QC (Figure S1E) or Brp (data not shown), strong overexpression of the cluster led to a reduction in Brp expression at the NMJ as well as reduction in QC, as well as a strong decrease in Khc-73 protein (Figure S4E to S4J). These results provide strong support for an important role for Khc-73 in regulating expression and/or function of Brp in motor neurons.

Loss of mir-310 cluster leads to ultrastructural alterations at the NMJ: number of T-bars is increased

At presynaptic active zones, Brp is an essential component of the electron dense structures called T-Bars, found in apposition to postsynaptic densities; and its loss leads to a significant decrease in neurotransmitter release (Fouquet et al., 2009; Kittel et al., 2006). The increase in Brp fluorescence levels raises the possibility that the density of T-bars in presynaptic terminals is altered in KT40 mutant larvae. To test this possibility we conducted ultrastructural analysis of wild type and KT40 homozygous larvae at muscle 6, 7 and 12, NMJ Type Ib boutons. We found a statistically significant increase in the average number of T-bars per active zone in KT40 mutants as compared to wild type larvae (1.13 for KT40 vs. 0.96 for wild-type, P=0.042) (Figure 5A, 5B and 5D). The enhancement in the number of T-bars was not associated with a change in the average length of active zones (Figure S5A and S5B). Consistently, we found a statistically significant increase in the number of T-bars per active zone following overexpression of Khc-73 in motor neurons (1.12 for Khc-73 OE vs. 0.95 for wild-type, P=0.008) (Figure 5C and 5D). Our results are consistent with recent findings that Brp is a structural component of T-bars (Fouquet et al., 2009). We did not find a significant difference in the number of Brp puncta per synaptic area nor a significant difference in the size of Brp puncta when we compared KT40 and wild type larvae (data not shown), suggesting that our resolution at the level of light microscopy cannot reveal the ultrastructural changes accurately. We did not find a difference in the number of docked or clustered vesicles between KT40 and wild type; however, these parameters were increased in response to overexpression of Khc-73 (Figure S5C and S5D). Finally, we found a mild increase in the number of large synaptic vesicles (>60nm in diameter) in KT40 mutants; these large vesicles were only present in less than 40% of KT40 synapses. The role of these large vesicles is not entirely clear (Stimson et al., 2001).

Figure 5. KT40 mutants and Khc-73 overexpression in motor neurons increases the number of T-bars per synaptic density in type Ib boutons.

Figure 5

Open in a new tab

(A) wild-type, (B) KT40/KT40 and (C) Khc-73 overexpression (19 500× magnification, Scale bar 1 μm), Inset images (40 000× magnification, Scale bar is 100nm). (D) KT40 and Khc-73 OE larvae have an increase in the proportion of synaptic densities with two to three T-bars as compared to wild-type. (wild-type n=23, KT40 n=11, and Khc-73 OE n=9 boutons) See also Figure S5.

Presynaptic calcium influx is enhanced in mir-310 cluster mutant larvae

As Brp is thought to be responsible for accumulating calcium channels at presynaptic terminals, we predicted that the increase in Brp and thereby an increase in influx of Ca2+ may be responsible for the increase in QC in KT40 mutants. One reliable test for the relationship between changes in Ca2+ current and the amount of neurotransmitter release is the degree of paired-pulse facilitation (PPF) (Zucker and Regehr, 2002); PPF is attenuated when the initial Ca2+ inflow into the terminal is increased. We found that PPF in KT40 mutant larvae showed a higher sensitivity to increasing extracellular concentration of Ca2+ compared to wild type larvae (Figure S6A). In addition, if calcium influx was higher in KT40 mutants, one would expect a higher sensitivity to Ca2+ channel blockers for EJPs recorded from KT40 mutants compared to those recorded from wild type. Our results were consistent with this prediction, as 0.5 mM Ni2+ reduced both EJPs and QC significantly more in KT40 mutants compared to wild type (% block of QC: 50.12±5.03 for WT compared to 71.92± 2.12 for KT40, p<0.001) (Figure S6B and S6C). Resting membrane potential was not affected by Ni2+ (data not shown); however, there was a small reduction in the average size of mEJPs in both wild type and KT40 (Figure S6D), this is perhaps due to a direct blocking effect of Ni2+ on glutamate receptors. These results suggested to us that the underlying mechanism for the increase in QC in KT40 mutant larvae may be an increase in presynaptic Ca2+ influx. To test this further, we conducted genetic interaction experiments between KT40 and cacophony (cac), the Drosophila Cav2.1 calcium channel (Smith et al., 1996). We found that removal of a single copy of cac gene significantly suppressed the increase in EJCs and QC in KT40 mutants (Figure 6A and 6B). Similar genetic interactions have recently been reported between cacophony and GluRIIA (Frank et al., 2006; Frank et al., 2009). These findings together suggest that an increase in presynaptic calcium influx largely underlies the increase in QC observed in KT40 mutants.

Figure 6. miR-310 cluster shows strong genetic interaction with cacophony calcium channel subunit.

Figure 6

Open in a new tab

(A) EJCs and mEJCs in the indicated genotypes. Removal of one copy of cac (cacHC129) leads to a reduction in the size of EJCs in KT40 mutant larvae.

(B) Quantification for mEJC, EJC and QC for the indicated genotypes. * is p<0.05; ** is p<0.01 and ***is p<0.001. One-way ANOVA, Games-Howell (GH) post hoc test.

(C) Examples of Ca2+ transients measured in the Ib terminals innervating muscle fiber 6/7 during a single AP in KT40/KT40 and wild-type. The relative increase in [Ca2+]i was determined from the ΔF/F measured at the peak of single APs.

(D) Comparison of ΔF/F for KT40 vs control. The relative increase in calcium was measured at the peak of a single AP.

(E) Quantification of decay time constants of calcium transients for KT40 and control. There was no significant difference between the mutant and the control. n represents (number of boutons, number of animals).

(F) Representative pseudo-color images mapping the ΔF/F during the plateau of a 10 Hz train of APs. Warmer colors represent greater ΔF/F. Calibration bar: 0 to 30 % ΔF/F. Scale is 10 μm. See also Figure S6.

We directly examined presynaptic Ca2+ influx at NMJs of KT40 mutant and wild type larvae, by measuring Ca2+ transients produced by a single action potential (AP) or trains of APs in the type Ib terminals innervating muscle fibres 6/7 (Lnenicka et al., 2006). Using a dextran conjugated Oregon Green 488 BAPTA-1 (OGB-1) Ca2+ indicator, we measured the amplitude of the Ca2+ transients in KT40 mutant and control larvae. In KT40 mutant larvae Ca2+ transients, measured in terms of the change in fluorescence vs. baseline fluorescence (ΔF/F), were on average nearly twice as high as those in the control larvae (15.6±1.3% for KT40/KT40 vs. 7.9±1.5% for w1118, p<0.01) (Figure 6C and 6D). To rule out that a difference in buffering of internal calcium is responsible for the measured increase in Ca2+ influx, we compared the decay time constant (τdecay) of the calcium transients; slower Ca2+ buffering can result in a decrease in the [Ca2+]i τdecay (Neher, 1998). τdecay was nearly identical for KT40 and control (p>0.5) boutons (Figure 6E). The increase in calcium influx in KT40 mutant larvae was further highlighted by our measurements of the ΔF/F plateau following trains of APs. The [Ca2+]i plateau during an AP train is determined by the rate of Ca2+ influx and efflux (Tank et al., 1995); greater Ca2+ influx will result in a higher plateau. The plateau of the Ca2+ transients in the KT40 boutons was much greater than in control boutons: (10 Hz train, 19.4±2.7% for KT40/KT40 vs. 9.3±0.9% for w1118 p<0.01). Figure 6F shows representative boutons with colors representing the change in fluorescence associated with calcium influx after a 10 Hz train. These results together indicate that loss of miR-310 cluster can lead to an enhancement of calcium influx at the larval NMJ.

Retrograde compensation of neurotransmitter release in GluRIIA mutants depends on normal levels/activity of miR-310 cluster and Khc-73

At the Drosophila NMJ neurotransmitter release is tightly linked to the level of glutamate receptor (GluR) function via a retrograde signal (Frank et al., 2006; Petersen et al., 1997); loss of GluRIIA subunit (one of the five GluR subunits) induces a large compensatory increase in neurotransmitter release that is also associated with an increase in the number of T-bars per active zones (Haghighi et al., 2003; Reiff et al., 2002). Given the strong phenotypic similarities between mir-310 cluster mutants and GluRIIA mutant larvae, it was tempting to envision that a common mechanism may underlie the increase in QC in both mutants. To test this, we conducted genetic interaction experiments between KT40 and GluRIIA mutants. In GluRIIA mutant larvae the average amplitude of postsynaptic miniature potentials (mEJPs) and currents (mEJCs) is greatly reduced, but EJPs and EJCs remain at wild type levels indicating a large increase in QC (Figure 7A and 7B). We measured QC in larvae double mutant for KT40 and GluRIIA and found no additional increase in QC, suggesting that the underlying mechanisms in both cases may be similar. Then, we tested whether increasing levels of miR-310 cluster or decreasing levels of Khc-73 in motor neurons could suppress the increase in QC in GluRIIA mutants. Both these manipulations led to a strong suppression of QC increase normally seen in GluRIIA mutants (Figure 7A and 7B). These results together suggest that the regulation of Khc-73 by miR-310 cluster in motor neurons is essential for the ability of retrograde signalling at the NMJ to regulate presynaptic neurotransmitter release.

Figure 7. miR-310 cluster and Khc-73 participate in activity dependent synaptic homeostasis.

Figure 7

Open in a new tab

(A) Representative EJCs and mEJCs for the indicated genotypes. DfGluRIIA is Df(2L)clh4. (B) Quantifications for mEJC, EJC, and QC for the indicated genotypes. n=20, 12, 22, 20, 30, 12 and 24, respectively. The increase in QC of GluRIIASP16/DfGluRIIA is suppressed by overexpression of UAS-miR-310 cluster or UAS-Khc-73-RNAi, n=20, 12, 22, 20, 30. One way ANOVA was performed. See S7 for details of statistical analysis. * is p<0.05; ** is p<0.01 and ***is p<0.001.

DISCUSSION

miRNA-dependent regulation of synaptic strength

The abundance of miRNAs in the brain (Kosik, 2006) and the diversity of miRNA targets (Baek et al., 2008; Selbach et al., 2008) have offered the promise of great breakthroughs in understanding neuronal function and ultimately in designing therapeutic approaches. The characterization of in vivo functions of individual miRNAs and identification of their targets, however, has proven to be much more challenging than predicted. Our findings here provide some of the first evidence for the in vivo role of miRNAs in the presynaptic regulation of synaptic strength. We demonstrate that miR-310 cluster acts as a negative regulator of synaptic strength during the rapid synaptic growth period at the Drosophila larval NMJ. Genetic loss of function of miR-310 cluster leads to a massive increase in quantal content that can be fully rescued by transgenic expression of the four miRNAs in motor neurons in a temporally restricted manner during larval development. In addition, we demonstrate that the kinesin-3 family member Khc-73 is the primary mediator of this miRNA cluster in motor neurons. In C. elegans, the inhibitory action of miR-1 on MEF-2 in the postsynaptic muscle appears to control the retrograde regulation of neurotransmitter release at the NMJ (Simon et al., 2008). In Aplysia, miR-124 attenuates long-term facilitation by influencing CREB-mediated transcription in sensory neurons (Rajasethupathy et al., 2009). Our results complement these recent findings by demonstrating a key role for miR-310 cluster in regulating synaptic strength in presynaptic motor neurons. Furthermore, these emerging findings together suggest that a role for miRNAs in the regulation of synaptic strength may also be conserved at vertebrate synapses and further support the idea that abnormal miRNA function may be associated with nervous system diseases.

Khc-73 is the target for miR-310 cluster in motor neurons

Target prediction algorithms generate lists of hundreds of targets for individual miRNAs; however, the consensus remains that we know very little about the in vivo functions of miRNAs in the nervous system and whether their roles are generally mediated by many or few targets. Our genetic and biochemical evidence indicate that Khc-73 is the major functional target for miR-310 cluster in motor neurons. Heterozygosity for Khc-73 strongly suppresses the increase in quantal content in mir-310-313 mutant larvae, and similarly RNAi against Khc-73 fully rescues the mir-310-313 mutant phenotype. Also, we find that overexpression of Khc-73 in motor neurons leads to a very similar increase in quantal content as in KT40 mutants. In addition to genetic evidence, strong biochemical evidence shows that the miR-310 cluster most likely regulates Khc-73 translation during larval development. First, the 3′-UTR of Khc-73 contains multiple recognition sites that complement the seed sequence of miR-310 cluster members, and incorporation of the 3′-UTR of Khc-73 confers sensitivity to the miR-310 cluster in a luciferase reporter assay. Second, levels of endogenous Khc-73 protein are increased in KT40 mutants and are reduced when a miR-310 cluster transgene is overexpressed in motor neurons. Interestingly, in addition to the four binding sites for miR-310 cluster in the 3′-UTR of Khc-73, a binding site for miR-310 cluster is also present in the coding sequence of Khc-73. By mutating this site, we were able to remove the sensitivity to cluster overexpression; thus providing in vivo evidence for miRNA mediated repression through a site in the coding region.

Although, we have not ruled out the involvement of all potential targets of miR-310 cluster, our findings strongly suggest that miR-310 cluster’s function in regulating synaptic strength at the NMJ is largely mediated by one target gene, Khc-73.

How could changes in Khc-73 lead to changes in synaptic strength?

Our findings indicate that the action of the miR-310 cluster is largely mediated through its regulation of Khc-73 in motor neurons. Our model suggests that in the absence of miR-310 cluster, derepression of Khc-73 causes an up-regulation of Brp and an increase in Ca2+ influx presynaptically, leading to an increase in quantal content. Three lines of evidence support the idea that Khc-73 is either directly or indirectly controls accumulation or function of Brp at the NMJ. First, we find that overexpression of Khc-73 leads to an enhancement of Brp associated fluorescence at the terminals and an increase in the number of T-bars per active zone at the ultrastructural level. Second, we show that overexpression of Brp in motor neurons during larval stages is sufficient to induce an increase in quantal release and demonstrate that loss of one copy of the Khc-73 gene is capable of reverting this effect. Third, we find a moderate but statistically significant reduction in Brp accumulation at the NMJ in response to reduction in Khc-73 protein levels using transgenic RNAi.

Kinesins are known to act as transporters of synaptic molecules and organelles in both vertebrates and invertebrates (Hall and Hedgecock, 1991; Hirokawa et al., 2009; Okada et al., 1995; Saxton et al., 1991). In particular, a kinesin-3 related gene, Imac, plays an important role in the accumulation of synaptic molecules and assembly of T-bars in Drosophila (Pack-Chung et al., 2007). It is conceivable that Khc-73, as a family member, shares a similar function, especially in light of recent evidence that shows Khc-73 associates with microtubules (Kner et al., 2009). We did not find any evidence for the involvement of Khc-73 in fast axonal transport; however, we cannot rule out this possibility at this time, since at best we achieved only a mild reduction of Khc-73 protein. Future effort in generating a loss of function mutant Khc-73 will be essential to address this issue. To explore the relationship between Khc-73 and Brp further, we conducted co-immunoprecipitation experiments, but found no evidence for the presence of both proteins in the same complex (data not shown). Similarly, we found negligible colocalization between transgenically expressed HA-Khc-73 and endogenous Brp in axons (data not shown). These results suggest that the interaction between Brp and Khc-73 may be very transient and therefore not detectable using these approaches. Alternatively, these results might point to the possibility that an intermediate protein is involved. The latter scenario for the action of Khc-73 in motor neurons could be based on its interaction with the PSD-95 homologue Discs large (Dlg) (Siegrist and Doe, 2005), a function that is conserved in the human counterpart of Khc-73, Kif-13B (Hanada et al., 2000). Khc-73 has been shown to influence cortical polarity in neuroblasts through its interaction with Dlg (Siegrist and Doe, 2005). We did not observe a measureable change in Dlg immunofluorescence at the NMJ in KT40 mutant larvae; but this could be due to the fact that the large majority of Dlg signal at the NMJ is postsynaptic (Lahey et al., 1994), making the presynaptic change in Dlg too difficult to detect. Interestingly, loss of dlg leads to changes in the number of T-bars per active zone as well as changes in neurotransmitter release, defects which can be rescued presynaptically but not postsynaptically (Koh et al., 1999). On this basis, one might hypothesize that the increase in Khc-73 as a result of loss of miR-310 cluster, could lead to changes in Dlg accumulation or localization at presynaptic terminals and in turn lead to alterations in presynaptic T-bars and neurotransmitter release.

As one would expect, an increase in Brp at the NMJ might accompany an increase in accumulation and/or function of the calcium channel cacophony (cac). We found only a moderate 11% increase in Cac:GFP at the NMJ of KT40 mutant larvae (Control n=8, KT40 n=7, P=0.0084 Student’s t-test), but a significant increase in presynaptic calcium influx in response to presynaptic stimulation. In addition, we found that heterozygosity for the calcium channel cacophony leads to a significant suppression of the increase in quantal content in KT40 mutant larvae, supporting the idea that calcium channel activity and/or calcium influx was up-regulated in these mutants.

miR-310 cluster regulation of Khc-73 participates in establishment of activity dependent synaptic homeostasis at the NMJ

It is well accepted that activity dependent changes play an important role in sculpting synaptic structures and fine-tuning synaptic function (Flavell and Greenberg, 2008). Recent findings suggest that miRNA dependent mechanisms may also participate in linking synaptic activity to changes in gene expression. In cultured hippocampal neurons miR-134 links the action of BDNF, which is induced by activity, to an enhancement in dendritic spine formation by regulating the expression of LimK1 postsynaptically (Schratt et al., 2006). Similarly, miR-132 is upregulated in response to an increase in synaptic activity leading to repression of p250GAP and thereby enhancing dendritic growth (Wayman et al., 2008). And in C. elegans, miR-1 appears to link postsynaptic receptor activity to presynaptic neurotransmitter release by regulating levels of MEF-2 in the muscle (Simon et al., 2008). It is therefore conceivable that miR-310 cluster would also show sensitivity to synaptic activity. The Drosophila larval NMJ undergoes rapid structural and functional growth in a span of a few days (Gorczyca et al., 1993; Keshishian et al., 1993; Schuster et al., 1996). This rapid growth appears to be dependent on both anterograde and retrograde signals that regulate this homeostatic growth. A well described example of the involvement of retrograde signalling is the large compensation in presynaptic release in response to loss of GluRIIA (one of the five GluR subunits) (Frank et al., 2006; Petersen et al., 1997) or in response to acute blockage of postsynaptic receptors (Frank et al., 2006). Similar to our findings for miR-310 loss of function, loss of GluRIIA subunit is associated with an increase in the number of T-bars per active zones (Haghighi et al., 2003; Petersen et al., 1997; Reiff et al., 2002) as well as an increase in presynaptic calcium influx per bouton (Reiff et al., 2002). Our genetic interaction experiments suggest that miR-310 cluster activity and/or Khc-73 levels/function are required for the normal homeostatic compensation in GluRIIA mutant larvae. Increased activity of miR-310 cluster during larval stages can pose a strong inhibition on the ability of the organism to respond to loss of GluRIIA and achieve normal homeostatic compensation. In addition, we demonstrate that a mild reduction in Khc-73 levels in GluRIIA mutants has a similar inhibitory effect. In light of previous findings that cac can exert dominant genetic suppression on GluRIIA mutant larvae, our findings suggest that miR-310 cluster mutants and GluRIIA mutants may share common mechanisms for inducing an increase in quantal content.

Experimental Procedures

Fly stocks

For a detailed list of all flies see Supplemental Experimental Procedures. Flies were cultured on standard medium at 25°C except for Gene Switch experiments where RU486 was added to the media (50 μM).

Deletion of miR-310 cluster by P-element excision

The miR-310 cluster deletion KT40 was obtained by inducing the mobilization of P{GSV1}GSd033. Virgin females of genotype Δ2-3, Sb/Cyo were mated with P{GSV1}GSd033 homozygous males. Δ2-3, Sb/P{GSV1}GSd033 female progenies were selected, crossed to Sco/Cyo balancer males and white-eyed male Cyo positive progenies (indicative of P-element loss) were selected for lack of Sb and Sco. One hundred lines were generated from single males and genomic DNA extracts were screened by PCR with forward primer KT40 5′:GAAATCGCCACTCAACTTGG and reverse primer KT40 3′:AATGCAGCAGCTGTTATGGA corresponding to a region 5′ and 3′ to the miR-310-313 genetic locus (Figure. S1A). PCR products from putative deletions were then sequenced. KT40 contains an 1159 bp deletion removing all four predicted miR-310-311-312-313 transcripts. KT2 is a precise excision of P-element GSd033 which was verified by sequencing the PCR product from forward primer KT2_5′:AAACTGGCATTCCCGTCTTA and reverse primer KT2_3′:CTGGCAAGTCTGTGACGAAG flanking 1kb of the miR-310-313 genomic locus (Figure. S1A).

Luciferase Reporter Assay

Drosophila S2 R+ cells were seeded to 8 × 104 in a 96-well format and transfected with 25 ng of Khc-73 sensor or empty psiCHECK-2 (Promega), 12.5 ng ub-Gal4, and 25 ng UAS-miR-306 or UAS-miR-310 cluster plasmids. 72 h after transfection, the cells were lysed and subjected to Dual-Glo luciferase assay (Promega). Plates were analyzed on a Veritas plate luminometer (Turner Biosystems). Fold repression was normalized to the effect of pUAST-miR-306 construct (a non-cognate miRNA of Khc-73 3′UTR) on the different sensors. Two-tailed Student’s t-test with unequal variances was used to examine the significance of the effects of miR-310 cluster on Khc-73 sensors statistically.

Immunostaining

Wandering third instar larvae were dissected as previously described (Schuster et al., 1996). For details of antibody dilutions see Supplemental Experimental Procedures.

Khc-73 antibody

Anti-Khc-73 was produced in rabbits against a 20 amino acid peptide (corresponding to the last 20 amino acids of Khc-73) synthesized with a C-terminal cysteine and conjugated to KLH.

DNA Plasmids

pUAST-DsRed-miR-310-313 (UAS-miR-310 cluster) was generated by inserting an 800bp fragment miR-310-311-312-313 from 5′ to 3′ into the 3′UTR of pUAST-DsRed (Stark et al., 2003). To generate the Khc-73 3′-UTR sensor, the Khc-73 3′UTR sequence was amplified from genomic DNA of D. melanogaster by polymerase chain reaction with forward primer 5′-ataagaatgcggccgcTTGTACCCAAAGTGTTCGCAT-3′ and reverse primer 5′-ccgctcgagCCATTGCATGTTTGTATATTTGTAT-3′. This fragment was cloned into NotI and XhoI restriction sites downstream of Renilla luciferase gene in a psiCHECK2 vector (Promega) modified to contain these restriction sites. psiCHECK2 vector, in addition to having Renilla luciferase, contains the firefly luciferase gene which serves as a transfection control.

To mutate the three target sites of miR-310 cluster in Khc-73 3′UTR, the following primers were used with QuikChange Site Directed Mutagenesis Kit (Stratagene): dme-Khc73_mut1_Forward: AGGCAATTGCGTAGTTTCCAGAT TTCGAACACTTGAG. dme-Khc73_mut2_Forward: ATAATTAAGATCTTTCCA GAATTTCGTCTCCATATGACCTTTCCTGAGCTC. dme-Khc73_mut2_Reverse: GAGCTCAGGAAAGGTCATATGGAGACGAAATTCTGGAAAGATCTTAATTAT dme-Khc73_mut3_Reverse: CTTAAAGAGCCTAACACTTATCTGGAACTTTTCG GACGGGGTA.

psiCHECK vector with KHC-73 exon 14 7-mer was constructed from a PCR amplified fragment of Khc-73 with forward primer: KHC73_RB_exon_14_5′ GCA TTG CTT CGC CAG CTA CTA GT and reverse primer KHC73 RB_exon_map_exon 16_3′ CATCGAGGTACTCATCTCTTTGC using pUAST-HA:KHC-73 as template. It was then inserted into pBluKSM as a SacI/EagI fragment and subsequently cloned into psiCHECK vector as a SacI/SpeI fragment.

pUAST-HA:Khc-73_3UTR: full length construct containing the Khc-73 3′UTR was generated by replacing a 2.7kb AgeI/XhoI fragment of the Khc-73 insert in pUAST-HA:Khc-73 (Siegrist and Doe, 2005) with the 5.7kb AgeI/XhoI fragment from cDNA GH09175 containing the Khc-73 3′UTR.

Mutagenesis of the miR-310-313 site in exon 14 of Khc-73 was performed by PCR with QuikChange Site-Directed Mutagenesis Kit (Stratagene) using forward primer OED39: CCC AGG CTG TCT CCT GTA ACA ATC TGA GCA ACG AGG and reverse primer OED40: CCT CGT TGC TCA GAT TGT TAC AGG AGA CAG CCT GGG. Constructs were verified by sequencing.

Confocal imaging and bouton counts

Synapses were imaged using a ConfoCor LSM 510 META on an Axiovert 200M inverted microscope (Carl Zeiss, Inc.). For details see Supplemental Experimental Procedures.

Electrophysiology

Wandering third instar larvae were dissected in cold HL3 solution following standard protocol (Stewart et al., 1994). Spontaneous and evoked potentials were measured as previously described (Haghighi et al., 2003). Standard two-electrode voltage-clamp technique was used as described in (Ball et al., 2010).

Electron Microscopy

Wandering third instar larvae were dissected, prepared and embedded as described in Jia et al 1993 (Jia et al., 1993). Ultra-thin serial sections of 50 nm thickness were cut from muscle 6, 7 and 12 of hemisegments A2 and A3. Two wild-type w1118 (23 type Ib boutons), two KT40 larvae (11 type Ib boutons) and one OK6/+; UAS-HA:Khc-73/+ (9 type Ib boutons) larvae were used for this study. Electron micrographs were taken at a magnification of 24 400× for measurements, 19 500× and 40 000× for figures. Serial Reconstruction and analysis was conducted on Reconstruct v.1.1.0.0 Software (Fiala, 2005).

Calcium Imaging

The fluorescent changes during stimulations were recorded and the relative increase in [Ca2+]i was determined from the ΔF/F (calculated by the equation (fluorescence - resting fluorescence)/resting fluorescence), measured at the peak of single APs or at the plateau of AP trains. The [Ca2+]i τdecay after single APs was determined from the decay of ΔF/F, for single APs (Fig. 6E). Since the average size of boutons was similar for KT40 and control terminals, the larger Ca2+ transient was either due to greater Ca2+ influx or reduced fast Ca2+ buffer (resulting from less endogenous buffer or less OGB-1). For a detailed method of how to load the terminals see Lnenicka et al., 2006 (Lnenicka et al., 2006).

Statistical analysis

Data are presented as Mean ± SEM (n = number of NMJs unless otherwise indicated). Histograms, frequency distributions and fitted lines were generated using Origin 7.5 software (OriginLab Corporation). Statistical significance was determined using SPSS 6.1 software (SPSS Inc.). For EJC and mEJC amplitudes and quantal content measurements, the data were first subjected to a variance test. In the absence of a significant difference, One-way ANOVA followed by Tukey post-hoc test was applied. If there were differences in variance, Games-Howell post-hoc test was applied.

Supplementary Material

01
Supplemental experimental procedures - corrected reference

Acknowledgments

We would like to thank A. DiAntonio, H. Bellen, C. Doe, C. Goodman, H. Keshishian, S. Sigrist and D. Van Meyel for generously providing us with reagents and fly stocks. We would like to thank the Bloomington Stock Center, Drosophila Genetic Resource Center-Kyoto Institute of Technology-Kyoto Stock Centre (DGRC) and the Vienna Drosophila RNAi Center (VDRC) for fly stocks and the Developmental Studies Hybridoma Bank for monoclonal antibodies. We would also like to thank Ellis Cooper for comments on the manuscript, M. Warren-Paquin for assistance with imaging, Johanne Ouellette and Nella Serluca for EM technical support. We thank all past and present members of the Haghighi Lab. This work was supported by grants from CIHR and EJLB Foundation to A.P.H. who is a CRC holder. Work in E.C.L.’s group was supported by the Sidney Kimmel Cancer Foundation, the Alfred Bressler Scholars Fund and the NIH (R01-GM083300).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T. The Small RNA Profile during Drosophila melanogaster Development. Developmental Cell. 2003;5:337–350. doi: 10.1016/s1534-5807(03)00228-4. [DOI] [PubMed] [Google Scholar]
  2. Ashraf SI, McLoon AL, Sclarsic SM, Kunes S. Synaptic protein synthesis associated with memory is regulated by the RISC pathway in Drosophila. Cell. 2006;124:191–205. doi: 10.1016/j.cell.2005.12.017. [DOI] [PubMed] [Google Scholar]
  3. Baek D, Villen J, Shin C, Camargo FD, Gygi SP, Bartel DP. The impact of microRNAs on protein output. Nature. 2008;455:64–71. doi: 10.1038/nature07242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ball RW, Warren-Paquin M, Tsurudome K, Liao EH, Elazzouzi F, Cavanagh C, An BS, Wang TT, White JH, Haghighi AP. Retrograde BMP signaling controls synaptic growth at the NMJ by regulating trio expression in motor neurons. Neuron. 2010;66:536–549. doi: 10.1016/j.neuron.2010.04.011. [DOI] [PubMed] [Google Scholar]
  5. Bartel DP. MicroRNAs: Target Recognition and Regulatory Functions. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bicker S, Schratt G. microRNAs: tiny regulators of synapse function in development and disease. J Cell Mol Med. 2008;12:1466–1476. doi: 10.1111/j.1582-4934.2008.00400.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bushati N, Cohen SM. microRNA Functions. Annual Review of Cell and Developmental Biology. 2007;23:175–205. doi: 10.1146/annurev.cellbio.23.090506.123406. [DOI] [PubMed] [Google Scholar]
  8. Davis GW. Homeostatic Control of Neural Activity: From Phenomenology to Molecular Design. Annual Review of Neuroscience. 2006;29:307–323. doi: 10.1146/annurev.neuro.28.061604.135751. [DOI] [PubMed] [Google Scholar]
  9. Edbauer D, Neilson JR, Foster KA, Wang CF, Seeburg DP, Batterton MN, Tada T, Dolan BM, Sharp PA, Sheng M. Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132. Neuron. 2010;65:373–384. doi: 10.1016/j.neuron.2010.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science. 2005;310:1817–1821. doi: 10.1126/science.1121158. [DOI] [PubMed] [Google Scholar]
  11. Fiala JC. Reconstruct: a free editor for serial section microscopy. J Microsc. 2005;218:52–61. doi: 10.1111/j.1365-2818.2005.01466.x. [DOI] [PubMed] [Google Scholar]
  12. Flavell SW, Greenberg ME. Signaling Mechanisms Linking Neuronal Activity to Gene Expression and Plasticity of the Nervous System. Annual Review of Neuroscience. 2008;31:563–590. doi: 10.1146/annurev.neuro.31.060407.125631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Flynt AS, Lai EC. Biological principles of microRNA-mediated regulation: shared themes amid diversity. Nat Rev Genet. 2008;9:831–842. doi: 10.1038/nrg2455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fouquet W, Owald D, Wichmann C, Mertel S, Depner H, Dyba M, Hallermann S, Kittel RJ, Eimer S, Sigrist SJ. Maturation of active zone assembly by Drosophila Bruchpilot. J Cell Biol. 2009;186:129–145. doi: 10.1083/jcb.200812150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Frank CA, Kennedy MJ, Goold Carleton P, Marek KW, Davis Graeme W. Mechanisms Underlying the Rapid Induction and Sustained Expression of Synaptic Homeostasis. Neuron. 2006;52:663–677. doi: 10.1016/j.neuron.2006.09.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Frank CA, Pielage J, Davis GW. A presynaptic homeostatic signaling system composed of the Eph receptor, ephexin, Cdc42, and CaV2.1 calcium channels. Neuron. 2009;61:556–569. doi: 10.1016/j.neuron.2008.12.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gorczyca M, Augart C, Budnik V. Insulin-like receptor and insulin-like peptide are localized at neuromuscular junctions in Drosophila. J Neurosci. 1993;13:3692–3704. doi: 10.1523/JNEUROSCI.13-09-03692.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Haghighi AP, McCabe BD, Fetter RD, Palmer JE, Hom S, Goodman CS. Retrograde Control of Synaptic Transmission by Postsynaptic CaMKII at the Drosophila Neuromuscular Junction. Neuron. 2003;39:255–267. doi: 10.1016/s0896-6273(03)00427-6. [DOI] [PubMed] [Google Scholar]
  19. Hall DH, Hedgecock EM. Kinesin-related gene unc-104 is required for axonal transport of synaptic vesicles in C. elegans. Cell. 1991;65:837–847. doi: 10.1016/0092-8674(91)90391-b. [DOI] [PubMed] [Google Scholar]
  20. Hanada T, Lin L, Tibaldi EV, Reinherz EL, Chishti AH. GAKIN, a novel kinesin-like protein associates with the human homologue of the Drosophila discs large tumor suppressor in T lymphocytes. J Biol Chem. 2000;275:28774–28784. doi: 10.1074/jbc.M000715200. [DOI] [PubMed] [Google Scholar]
  21. Hirokawa N, Noda Y. Intracellular transport and kinesin superfamily proteins, KIFs: structure, function, and dynamics. Physiol Rev. 2008;88:1089–1118. doi: 10.1152/physrev.00023.2007. [DOI] [PubMed] [Google Scholar]
  22. Hirokawa N, Noda Y, Tanaka Y, Niwa S. Kinesin superfamily motor proteins and intracellular transport. Nat Rev Mol Cell Biol. 2009;10:682–696. doi: 10.1038/nrm2774. [DOI] [PubMed] [Google Scholar]
  23. Jia XX, Gorczyca M, Budnik V. Ultrastructure of neuromuscular junctions in Drosophila: comparison of wild type and mutants with increased excitability. J Neurobiol. 1993;24:1025–1044. doi: 10.1002/neu.480240804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Karr J, Vagin V, Chen K, Ganesan S, Olenkina O, Gvozdev V, Featherstone DE. Regulation of glutamate receptor subunit availability by microRNAs. J Cell Biol. 2009;185:685–697. doi: 10.1083/jcb.200902062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Keshishian H, Chiba A, Chang TN, Halfon MS, Harkins EW, Jarecki J, Wang L, Anderson M, Cash S, Halpern ME, et al. Cellular mechanisms governing synaptic development in Drosophila melanogaster. J Neurobiol. 1993;24:757–787. doi: 10.1002/neu.480240606. [DOI] [PubMed] [Google Scholar]
  26. Kittel RJ, Wichmann C, Rasse TM, Fouquet W, Schmidt M, Schmid A, Wagh DA, Pawlu C, Kellner RR, Willig KI, et al. Bruchpilot Promotes Active Zone Assembly, Ca2+ Channel Clustering, and Vesicle Release. Science. 2006;312:1051–1054. doi: 10.1126/science.1126308. [DOI] [PubMed] [Google Scholar]
  27. Kner P, Chhun BB, Griffis ER, Winoto L, Gustafsson MG. Super-resolution video microscopy of live cells by structured illumination. Nat Methods. 2009;6:339–342. doi: 10.1038/nmeth.1324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Koh YH, Popova E, Thomas U, Griffith LC, Budnik V. Regulation of DLG localization at synapses by CaMKII-dependent phosphorylation. Cell. 1999;98:353–363. doi: 10.1016/s0092-8674(00)81964-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kosik KS. The neuronal microRNA system. Nat Rev Neurosci. 2006;7:911–920. doi: 10.1038/nrn2037. [DOI] [PubMed] [Google Scholar]
  30. Kreitzer AC, Malenka RC. Endocannabinoid-mediated rescue of striatal LTD and motor deficits in Parkinson's disease models. Nature. 2007;445:643–647. doi: 10.1038/nature05506. [DOI] [PubMed] [Google Scholar]
  31. Lahey T, Gorczyca M, Jia XX, Budnik V. The Drosophila tumor suppressor gene dlg is required for normal synaptic bouton structure. Neuron. 1994;13:823–835. doi: 10.1016/0896-6273(94)90249-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Leaman D, Chen PY, Fak J, Yalcin A, Pearce M, Unnerstall U, Marks DS, Sander C, Tuschl T, Gaul U. Antisense-Mediated Depletion Reveals Essential and Specific Functions of MicroRNAs in Drosophila Development. Cell. 2005;121:1097–1108. doi: 10.1016/j.cell.2005.04.016. [DOI] [PubMed] [Google Scholar]
  33. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005;120:15–20. doi: 10.1016/j.cell.2004.12.035. [DOI] [PubMed] [Google Scholar]
  34. Li H-P, Liu Z-M, Nirenberg M. Kinesin-73 in the nervous system of Drosophila embryos. Proceedings of the National Academy of Sciences of the United States of America. 1997;94:1086–1091. doi: 10.1073/pnas.94.4.1086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lnenicka GA, Grizzaffi J, Lee B, Rumpal N. Ca2+ dynamics along identified synaptic terminals in Drosophila larvae. J Neurosci. 2006;26:12283–12293. doi: 10.1523/JNEUROSCI.2665-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lynch G, Kramar EA, Rex CS, Jia Y, Chappas D, Gall CM, Simmons DA. Brain-derived neurotrophic factor restores synaptic plasticity in a knock-in mouse model of Huntington's disease. J Neurosci. 2007;27:4424–4434. doi: 10.1523/JNEUROSCI.5113-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mindorff EN, O’Keefe DD, Labbe A, Yang JP, Ou Y, Yoshikawa S, van Meyel DJ. A gain-of-function screen for genes that influence axon guidance identifies the NF-kappaB protein dorsal and reveals a requirement for the kinase Pelle in Drosophila photoreceptor axon targeting. Genetics. 2007;176:2247–2263. doi: 10.1534/genetics.107.072819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Neher E. Usefulness and limitations of linear approximations to the understanding of Ca++ signals. Cell Calcium. 1998;24:345–357. doi: 10.1016/s0143-4160(98)90058-6. [DOI] [PubMed] [Google Scholar]
  39. Nicholson L, Singh GK, Osterwalder T, Roman GW, Davis RL, Keshishian H. Spatial and Temporal Control of Gene Expression in Drosophila Using the Inducible GeneSwitch GAL4 System. I. Screen for Larval Nervous System Drivers. Genetics. 2008;178:215–234. doi: 10.1534/genetics.107.081968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Okada Y, Yamazaki H, Sekine-Aizawa Y, Hirokawa N. The neuron-specific kinesin superfamily protein KIF1A is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell. 1995;81:769–780. doi: 10.1016/0092-8674(95)90538-3. [DOI] [PubMed] [Google Scholar]
  41. Pack-Chung E, Kurshan PT, Dickman DK, Schwarz TL. A Drosophila kinesin required for synaptic bouton formation and synaptic vesicle transport. Nat Neurosci. 2007;10:980–989. doi: 10.1038/nn1936. [DOI] [PubMed] [Google Scholar]
  42. Parrish JZ, Xu P, Kim CC, Jan LY, Jan YN. The microRNA bantam functions in epithelial cells to regulate scaling growth of dendrite arbors in drosophila sensory neurons. Neuron. 2009;63:788–802. doi: 10.1016/j.neuron.2009.08.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Petersen SA, Fetter RD, Noordermeer JN, Goodman CS, DiAntonio A. Genetic Analysis of Glutamate Receptors in Drosophila Reveals a Retrograde Signal Regulating Presynaptic Transmitter Release. Neuron. 1997;19:1237–1248. doi: 10.1016/s0896-6273(00)80415-8. [DOI] [PubMed] [Google Scholar]
  44. Rajasethupathy P, Fiumara F, Sheridan R, Betel D, Puthanveettil SV, Russo JJ, Sander C, Tuschl T, Kandel E. Characterization of small RNAs in aplysia reveals a role for miR-124 in constraining synaptic plasticity through CREB. Neuron. 2009;63:803–817. doi: 10.1016/j.neuron.2009.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ramocki MB, Zoghbi HY. Failure of neuronal homeostasis results in common neuropsychiatric phenotypes. Nature. 2008;455:912–918. doi: 10.1038/nature07457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Reiff DF, Thiel PR, Schuster CM. Differential regulation of active zone density during long-term strengthening of Drosophila neuromuscular junctions. J Neurosci. 2002;22:9399–9409. doi: 10.1523/JNEUROSCI.22-21-09399.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC. Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs. Genome Research. 2007;17:1850–1864. doi: 10.1101/gr.6597907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Saxton WM, Hicks J, Goldstein LS, Raff EC. Kinesin heavy chain is essential for viability and neuromuscular functions in Drosophila, but mutants show no defects in mitosis. Cell. 1991;64:1093–1102. doi: 10.1016/0092-8674(91)90264-y. [DOI] [PubMed] [Google Scholar]
  49. Schratt GM, Tuebing F, Nigh EA, Kane CG, Sabatini ME, Kiebler M, Greenberg ME. A brain-specific microRNA regulates dendritic spine development. Nature. 2006;439:283–289. doi: 10.1038/nature04367. [DOI] [PubMed] [Google Scholar]
  50. Schuster CM, Davis GW, Fetter RD, Goodman CS. Genetic dissection of structural and functional components of synaptic plasticity. I. Fasciclin II controls synaptic stabilization and growth. Neuron. 1996;17:641–654. doi: 10.1016/s0896-6273(00)80197-x. [DOI] [PubMed] [Google Scholar]
  51. Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, Rajewsky N. Widespread changes in protein synthesis induced by microRNAs. Nature. 2008;455:58–63. doi: 10.1038/nature07228. [DOI] [PubMed] [Google Scholar]
  52. Siegrist SE, Doe CQ. Microtubule-Induced Pins/G[alpha]i Cortical Polarity in Drosophila Neuroblasts. Cell. 2005;123:1323–1335. doi: 10.1016/j.cell.2005.09.043. [DOI] [PubMed] [Google Scholar]
  53. Simon DJ, Madison JM, Conery AL, Thompson-Peer KL, Soskis M, Ruvkun GB, Kaplan JM, Kim JK. The microRNA miR-1 regulates a MEF-2-dependent retrograde signal at neuromuscular junctions. Cell. 2008;133:903–915. doi: 10.1016/j.cell.2008.04.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Smith LA, Wang X, Peixoto AA, Neumann EK, Hall LM, Hall JC. A Drosophila calcium channel alpha1 subunit gene maps to a genetic locus associated with behavioral and visual defects. J Neurosci. 1996;16:7868–7879. doi: 10.1523/JNEUROSCI.16-24-07868.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Stark A, Brennecke J, Bushati N, Russell RB, Cohen SM. Animal MicroRNAs confer robustness to gene expression and have a significant impact on 3'UTR evolution. Cell. 2005;123:1133–1146. doi: 10.1016/j.cell.2005.11.023. [DOI] [PubMed] [Google Scholar]
  56. Stark A, Brennecke J, Russell RB, Cohen SM. Identification of Drosophila MicroRNA Targets. PLoS Biology. 2003;1:e60. doi: 10.1371/journal.pbio.0000060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Stewart BA, Atwood HL, Renger JJ, Wang J, Wu CF. Improved stability of Drosophila larval neuromuscular preparations in haemolymph-like physiological solutions. J Comp Physiol [A] 1994;175:179–191. doi: 10.1007/BF00215114. [DOI] [PubMed] [Google Scholar]
  58. Stimson DT, Estes PS, Rao S, Krishnan KS, Kelly LE, Ramaswami M. Drosophila stoned proteins regulate the rate and fidelity of synaptic vesicle internalization. J Neurosci. 2001;21:3034–3044. doi: 10.1523/JNEUROSCI.21-09-03034.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tank DW, Regehr WG, Delaney KR. A quantitative analysis of presynaptic calcium dynamics that contribute to short-term enhancement. J Neurosci. 1995;15:7940–7952. doi: 10.1523/JNEUROSCI.15-12-07940.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Turrigiano G. Homeostatic signaling: the positive side of negative feedback. Current Opinion in Neurobiology. 2007;17:318–324. doi: 10.1016/j.conb.2007.04.004. [DOI] [PubMed] [Google Scholar]
  61. Walsh DM, Klyubin I, Fadeeva JV, Cullen WK, Anwyl R, Wolfe MS, Rowan MJ, Selkoe DJ. Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature. 2002;416:535–539. doi: 10.1038/416535a. [DOI] [PubMed] [Google Scholar]
  62. Wayman GA, Davare M, Ando H, Fortin D, Varlamova O, Cheng HY, Marks D, Obrietan K, Soderling TR, Goodman RH, Impey S. An activity-regulated microRNA controls dendritic plasticity by down-regulating p250GAP. Proc Natl Acad Sci U S A. 2008;105:9093–9098. doi: 10.1073/pnas.0803072105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zhang B, Koh YH, Beckstead RB, Budnik V, Ganetzky B, Bellen HJ. Synaptic vesicle size and number are regulated by a clathrin adaptor protein required for endocytosis. Neuron. 1998;21:1465–1475. doi: 10.1016/s0896-6273(00)80664-9. [DOI] [PubMed] [Google Scholar]
  64. Zucker RS, Regehr WG. Short-Term Synaptic Plasticity. Annual Review of Physiology. 2002;64:355–405. doi: 10.1146/annurev.physiol.64.092501.114547. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS253481-supplement-01.pdf (331.8KB, pdf)
Supplemental experimental procedures - corrected reference
NIHMS253481-supplement-Supplemental_experimental_procedures_-_corrected_reference.doc (79.5KB, doc)

RESOURCES