TMEM106B regulates progranulin levels and the penetrance of FTLD in GRN mutation carriers

Abstract

Objectives:

To determine whether TMEM106B single nucleotide polymorphisms (SNPs) are associated with frontotemporal lobar degeneration (FTLD) in patients with and without mutations in progranulin (GRN) and to determine whether TMEM106B modulates GRN expression.

Methods:

We performed a case-control study of 3 SNPs in TMEM106B in 482 patients with clinical and 80 patients with pathologic FTLD–TAR DNA-binding protein 43 without GRN mutations, 78 patients with FTLD with GRN mutations, and 822 controls. Association analysis of TMEM106B with GRN plasma levels was performed in 1,013 controls and TMEM106B and GRN mRNA expression levels were correlated in peripheral blood samples from 33 patients with FTLD and 150 controls.

Results:

In our complete FTLD patient cohort, nominal significance was identified for 2 TMEM106B SNPs (top SNP rs1990622, p_allelic = 0.036). However, the most significant association with risk of FTLD was observed in the subgroup of GRN mutation carriers compared to controls (corrected p_allelic = 0.0009), where there was a highly significant decrease in the frequency of homozygote carriers of the minor alleles of all TMEM106B SNPs (top SNP rs1990622, CC genotype frequency 2.6% vs 19.1%, corrected p_recessive = 0.009). We further identified a significant association of TMEM106B SNPs with plasma GRN levels in controls (top SNP rs1990622, corrected p = 0.002) and in peripheral blood samples a highly significant correlation was observed between TMEM106B and GRN mRNA expression in patients with FTLD (r = −0.63, p = 7.7 × 10⁻⁵) and controls (r = −0.49, p = 2.2 × 10⁻¹⁰).

Conclusions:

In our study, TMEM106B SNPs significantly reduced the disease penetrance in patients with GRN mutations, potentially by modulating GRN levels. These findings hold promise for the development of future protective therapies for FTLD.

Frontotemporal lobar degeneration (FTLD) is a progressive neurodegenerative disorder accounting for 5%–10% of all patients with dementia and 10%–20% of patients with dementia with an onset before age 65 years.^1,2 In recent years, major advances have been made in our understanding of both the neuropathologic and genetic bases of FTLD.³ Mutations in the genes encoding the microtubule-associated protein tau (MAPT)^4–6 and progranulin (GRN)^7,8 together explain 10%–25% of familial FTLD and 5%–10% of all FTLD cases.⁹ While patients with MAPT mutations invariably show FTLD with tau pathology, those with loss-of-function mutations in GRN are found to have FTLD with intracellular deposits of hyperphosphorylated, ubiquitinated, and C-terminally truncated fragments of TAR DNA-binding protein 43 (TDP-43) (FTLD-TDP).

The recent ability to subclassify FTLD based on the underlying molecular pathology initiated a large collaborative genome-wide association study (GWAS) to identify genetic risk factors for FTLD-TDP.¹⁰ Using a combination of autopsy-confirmed patients with FTLD-TDP and GRN mutation carriers, this study identified genome-wide association of FTLD-TDP with 3 single nucleotide polymorphisms (SNPs) in the uncharacterized transmembrane protein TMEM106B. It was suggested that TMEM106B variants confer risk for FTLD-TDP by increasing TMEM106B expression; however, the exact pathologic mechanisms leading to FTLD-TDP remain unknown.

In this study, we aimed to replicate the association of TMEM106B SNPs using our large series of patients with FTLD with and without GRN mutations. We also performed in vivo studies in plasma and peripheral blood to test the hypothesis that TMEM106B SNPs regulate GRN expression levels and influence FTLD risk by modulating GRN expression.

METHODS

Study populations.

A total of 640 patients with FTLD were included in the initial genetic association studies, including 482 patients with clinical FTLD of unknown pathologic subtype without GRN mutations (255 male, 227 female), 80 patients with FTLD with pathologically confirmed FTLD-TDP without GRN mutations (43 male, 37 female), and 78 probands (33 male, 45 female) of genealogically unrelated families carrying a total of 31 different GRN mutations. None of these patients were included in the previous FTLD-TDP GWAS.¹⁰ The mean age at diagnosis was 64.9 ± 9.4 years (range 26–90) for the clinical series and 68.4 ± 12.9 years (range 35–90) for the pathologically confirmed patients, while the mean age at onset in mutation carriers was 60.6 ± 8.5 years (range 43–82). For the clinical series, age at diagnosis was determined as the age at which the patient was first diagnosed with FTLD by a clinician, while the age at autopsy was defined as the age at diagnosis for pathologically confirmed patients. A total of 34 additional symptomatic GRN mutation carriers related to probands from GRN families already included in the analysis were also available for study. Patients were selected according to the following criteria: a clinical diagnosis of behavioral variant FTD, semantic dementia or progressive nonfluent aphasia or a pathologic diagnosis of FTLD-TDP, and a Caucasian ancestry and a DNA sample available for genetic studies. Patients with FTLD with mutations in MAPT were excluded from all analysis, while patients with FTLD with GRN mutations were included in the initial analysis followed by a stratified analysis in subseries of patients with clinical FTLD without GRN mutations, patients with FTLD-TDP without GRN mutations, and patients with GRN mutations. Patients with FTLD were ascertained from a total of 12 centers between 1995 and 2010: Mayo Clinic Jacksonville (n = 190), Mayo Clinic Rochester (n = 131), Mayo Clinic Scottsdale (n = 10), University of California, San Francisco (n = 132), University of California, Los Angeles (n = 3), Northwestern University Feinberg School of Medicine (n = 18), Drexel University College of Medicine (n = 30), University of British Columbia, Canada (n = 18), Harvard Brain Bank (n = 3), University of Western Ontario, Canada (n = 31), and IRCCS “Centro S. Giovanni di Dio-Fatebenefratelli,” Brescia, Italy (n = 44). An additional 30 patient samples were obtained from the Mayo Clinic Jacksonville Brain Bank.

Patients with FTLD were age- and sex-matched to a group of 822 neurologically normal controls (434 male, 388 female) for genetic association studies. The mean age at draw for controls was 67.0 ± 9.9 years (range 20–95). All controls were of Caucasian ancestry and ascertained at Mayo Clinic Jacksonville, FL (n = 645), Mayo Clinic Scottsdale, AZ (n = 54), or University of California, San Francisco (n = 123).

For GRN ELISA assays, plasma samples of 2 sets of healthy controls ascertained at Mayo Clinic Jacksonville and Mayo Clinic Rochester were included. The initial series consisted of 518 individuals (200 male, 318 female) with a mean age at draw of 73.1 ± 4.3 years (range 60–80). The follow-up series included 495 individuals (210 male, 284 female) with a mean age at draw of 77.9 ± 7.5 years (range 60–90).

For mRNA expression studies, a total of 150 healthy controls (63 male, 87 female, mean age at draw 65 ± 11 years, range 25–88) and 33 patients with FTLD (16 male, 17 female, mean age at draw 61 ± 10 years, range 29–76) were collected at the University of California, San Francisco.

All patients agreed to be in the study and biological samples were obtained after informed consent with ethical committee approval from the respective institutions.

Genetic analyses.

TMEM106B genotypes for rs1020004 and rs1990622 for the initial ELISA series were previously generated using Illumina HumanHap300 BeadChips.¹¹ In all other series TMEM106B SNPs were genotyped using Taqman SNP genotyping assays on the 7900HT Fast Real Time PCR system. Genotype calls were made using the SDS v2.2 software (Applied Biosystems, Foster City, CA). SNPs rs1020004, rs1990622, and rs3173615 were genotyped using inventoried Taqman assays (C___7604953_10, C__11171598_10, and C__27465458_10). For rs6966915, comparison of genotypes generated using Illumina BeadChips and the inventoried Taqman assay suggested the presence of a polymorphic variant adjacent to rs6966915 which interfered with the genotyping in the Taqman assay. Sequencing analysis in samples with discordant genotypes revealed a rare G>A polymorphism 11 bp downstream of rs6966915, likely overlapping with one of the Taqman primers. We therefore designed a custom Taqman assay for rs6966915 (PCR primers F:GTGTGTTTCTTAGGACATTGTTTTT and R:CCTCTCTAAGGTTTTTGTTTGTTTTGTTTTC) with reporter primers AGGCTACACGGTCCTT(VIC) and AGGCTACACAGTCCTT(FAM) and confirmed accurate genotyping using this new assay (figure e-1 on the Neurology® Web site at www.neurology.org). The custom rs6966915 Taqman assay was used to genotype all series. For sequencing analysis of TMEM106B, all coding and noncoding exons were PCR amplified using flanking intronic primers tailed with M13 sequences. PCR products were purified using AMPure (Agencourt Biosciences, Beverly, MA) then sequenced in both directions using M13 primers and the Big Dye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems). Sequencing reactions were purified using CleanSEQ (Agencourt Biosciences) and analyzed on an ABI3730 Genetic Analyser (Applied Biosystems). TMEM106B sequencing was performed in 2 GRN mutation carriers (one homozygous for the rare alleles of all 3 TMEM106B SNPs and one homozygous for the rare alleles of rs1990622 and rs6966915, but heterozygous for rs1020004) as well as 24 controls selected to represent all possible combinations of genotypes for the 3 TMEM106B SNPs.

Expression studies.

To determine GRN expression levels in human plasma samples of healthy controls, we used the Human Progranulin Quantikine ELISA Kit (R&D Systems) using undiluted plasma samples. Samples were analyzed as part of an initial series (n = 518) or follow-up series (n = 495). To increase accuracy, all samples were analyzed in duplicate, independent experiments and readings from duplicate samples with a CV >21.06% were excluded from further analysis. Six interplate control samples were used to adjust for plate-to-plate variation. Recombinant human GRN provided with the ELISA kit was used as a standard.

For mRNA expression analysis, peripheral blood samples were drawn in 2 PAXgene tubes, stored at room temperature for at least 2 hours, and then at 4°C. Total RNA was extracted using the PAXgene blood RNA kit (PreAnalytix GmbH, QIAGEN, Germany). RNA quantity was assessed with a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE), and quality with an Agilent Bioanalyzer Nanochips. Total RNA (200 ng) was amplified, labeled, and hybridized on Illumina HumanRef-8 v3 Expression BeadChips (Illumina Inc., San Diego, CA), querying the expression of approximately 24,000 RefSeq-curated transcripts, including TMEM106B (probe ILMN_2067607) and GRN, interrogated by 2 probes: ILMN_1811702 (mapping to the 3′UTR) and ILMN_1724250 (mapping to GRN exon 12).

Statistical analyses.

All tests of association were performed using PLINK unless otherwise noted.¹² Logistic regression analyses were employed to test for association among the 3 TMEM106B SNPs of interest (rs1020004, rs1990622, and rs6966915) and risk of disease in the patient-control series using allelic and genotypic (additive, dominant, and recessive) models, with sex and age at diagnosis (for patients) and age at blood draw (for controls) as covariates. Linear regression analysis of age at onset, with sex as covariate, was used to determine if the SNPs of interest had an effect on age at onset in GRN mutation carriers. Given that age at onset was only available for a subset of non-GRN mutation carriers, in this subgroup linear regression analysis of age at diagnosis, with sex as covariate, was used to determine if the SNPs of interest had an effect on age at onset. Linear regression analyses were also employed to test for association between GRN plasma levels and the 3 TMEM106B SNPs (rs1020004, rs1990622, and rs6966915) using an additive model with age at blood draw, series, and sex as covariates. For all analyses resulting in an uncorrected p value < 0.05, a correction for multiple testing was performed using a conservative Bonferroni correction to adjust p values for the 3 SNPs tested.

mRNA expression data analysis was performed using R (www.r-project.org) and Bioconductor (www.bioconductor.org) packages. Absolute expression values were log2 transformed and normalized using quantile normalization. The Pearson correlation coefficient (r) was computed using the R function “cor.test,” with default parameters.

RESULTS

In our complete cohort including patients with FTLD with and without GRN mutations, association analysis using 3 SNPs in TMEM106B (rs1020004, rs1990622, and rs6966915) showed nominal significance for rs6966915 and rs1990622 (table 1). Since the TMEM106B association identified in the original FTLD-TDP GWAS was more significant in GRN mutation carriers, we further performed association analysis in our subpopulation of 78 genealogically unrelated GRN mutation carriers. In this cohort, we identified a highly significant decrease in the frequency of the minor alleles of all TMEM106B SNPs in mutation carriers compared to controls (top SNP rs1990622 C-allele frequency of 26.9% vs 41.7%, corrected p = 0.0009); more specifically, there were fewer homozygous carriers of these minor alleles (top SNP rs1990622, CC-genotype frequency of 2.6% vs 19.1%, corrected p = 0.009 in a recessive model) (table 2). Of the 78 probands, only 2 were homozygous for the minor alleles of rs1990622 and rs6966915 (one of which was also homozygous for the minor allele of rs1020004) and none of 34 other symptomatic GRN mutation carriers (related to the probands) were homozygous carriers of the minor alleles of TMEM106B SNPs. Both of the probands who were homozygous for the rare alleles of rs1990622 and rs6966915 presented with disease at a late onset age. One patient (MY04172) was first evaluated at the age of 74 for progressive forgetfulness and confusion of about 5 years duration and died at age 85, while the other patient (FAM352 II:1) was diagnosed with dementia at age 77 and is currently alive at 79 years. The latter patient was also homozygous for rs1020004. Linear regression analyses using age at diagnosis in the 78 GRN mutations carriers supported these findings and showed that the minor alleles of the TMEM106B SNPs were nominally associated with a later onset of FTLD (rs1990622 and rs6966915: β = 12.53, SE = 5.74, p = 0.032, corrected p = 0.096; and rs1020004: β = 19.63, SE = 8.08, p = 0.018, corrected p = 0.054) in a recessive model. Finally, we genotyped TMEM106B SNPs in the probands of 22 genealogically unrelated families carrying a MAPT mutation. In this group, we identified 4/22 (18.1%) patients homozygous for the minor alleles of rs1990622 and rs6966915, a similar frequency to controls. This suggests that the protective effect of TMEM106B SNPs is specific to GRN mutation carriers. Also, no association with TMEM106B SNPs was detected in the subpopulation of patients with clinical FTLD (table e-1) or patients with FTLD-TDP (table e-2) alone. Linear regression analyses also failed to identify an effect on age at diagnosis for the 3 SNPs in the complete FTLD patient series without GRN mutations, although suggestive significance was observed for all 3 SNPs using a recessive model (rs1990622: p = 0.116; rs6966915: p = 0.117; and rs1020004: p = 0.060).

Table 1.

Association analysis of TMEM106B in complete FTLD case-control series

Abbreviations: CI = confidence interval; FTLD = frontotemporal lobar degeneration; OR = odds ratio; SNP = single nucleotide polymorphism.

Table 2.

Association analysis of TMEM106B SNPs in subgroup of GRN mutation carriers

Abbreviations: CI = confidence interval; FTLD = frontotemporal lobar degeneration; OR = odds ratio; SNP = single nucleotide polymorphism.

We next determined whether TMEM106B SNPs were associated with GRN expression levels in plasma samples from healthy controls. Using an initial cohort of 518 plasma samples a significant association with increased GRN protein levels was identified for all 3 TMEM106B SNPs tested. The most significant association was obtained with rs1990622 using an additive model (table 3). Analyses of a replication cohort of 495 independent plasma samples from controls also showed in an additive model suggestive association of the minor alleles of rs1990622 and rs6966915 with increased GRN protein levels (table 3). In the combined plasma cohort, rs1990622 showed the most significant association with GRN expression levels, which remained significant after Bonferroni correction for the 3 TMEM106B SNPs tested (table 3).

Table 3.

Association analysis of TMEM106B SNPs with plasma GRN levels using multivariate regression analysis

Abbreviations: SNP = single nucleotide polymorphism.

Since the original publication¹⁰ reported that TMEM106B SNPs correlated with TMEM106B mRNA expression and our current data suggest a correlation between TMEM106B SNPs and GRN protein levels, we further queried peripheral blood mRNA expression data available to us from a large collection of healthy controls and patients with FTLD. Using one probe for TMEM106B and 2 independent GRN probes, we identified a correlation between TMEM106B and GRN mRNA levels with higher levels of GRN mRNA in individuals with reduced levels of TMEM106B mRNA in both patients with FTLD (n = 150, r = −0.63, p = 7.7 × 10⁻⁵) and controls (n = 33, r = −0.49, p = 2.2 × 10⁻¹⁰, probe ILMN_1724250) (figure 1).

Figure 1. Peripheral blood TMEM106B and GRN mRNA expression levels in patients with FTLD and controls.

Scatterplot depicting peripheral blood GRN (as detected by Illumina probe ILMN_1724250) and TMEM106B mRNA expression levels in 33 patients with FTLD and 150 healthy controls. Data are expressed in log2-transformed normalized expression values. Regression lines are shown for patients (red) and controls (black). Similar results are obtained with probe ILMN_1811702.

Finally, to identify possible functional variants in the TMEM106B coding region which could affect GRN expression levels, we performed sequencing analysis of all coding and noncoding exons of TMEM106B in the 2 GRN mutation carriers homozygous for the minor alleles of rs1990622 and rs6966915 (MY04172 and FAM352 II:1) and in 24 controls. We identified 2 coding variants: one rare variant which was observed in a single control (c.401G>A; p.S134N) and one common variant (rs3173615, pT185S). Further genotyping revealed that rs3173615 was in complete linkage disequilibrium with rs1990622 and rs6966915 in our cohort of GRN mutation carriers.

DISCUSSION

The first GWAS study designed to identify susceptibility loci for FTLD was recently performed on a cohort of patients with FTLD with TDP-43 pathology and identified genetic variation in the uncharacterized transmembrane protein TMEM106B as a genetic risk factor for FTLD-TDP.¹⁰ In addition to patients with pathologically confirmed FTLD-TDP, that study included patients carrying GRN mutations, who are known to consistently have TDP-43 pathology at autopsy. To confirm the association of TMEM106B SNPs with FTLD, we performed association analyses in a large cohort including 482 clinical and 80 newly collected patients with FTLD-TDP without GRN mutations and 78 symptomatic GRN mutation carriers.

Only nominal significant association with TMEM106B was detected in our complete patient cohort. However, in the subgroup of 78 probands of genealogically unrelated families carrying 31 different GRN mutations, we identified a highly significant association of all 3 TMEM106B SNPs with FTLD, suggesting that genetic variation in TMEM106B may specifically modify the development of FTLD in the presence of a GRN mutation. Importantly, genome-wide significance at chromosome 7p21 in the original FTLD-TDP GWAS was only identified when GRN mutation carriers were included in the analysis. In our series, the 3 SNPs tested showed significantly reduced frequencies of GRN mutation carriers homozygous for the minor alleles of TMEM106B SNPs. In contrast to a genotype frequency of approximately 19% in controls, only 2 patients with GRN mutations (2.6% of the population) were homozygous for the minor alleles of rs1990622 and rs6966915. These 2 patients each developed FTLD at a late age (69 and 77 years) compared to the average onset of 60 years in our population of GRN mutation carriers and previously published estimates.¹³ These data suggest that GRN mutation carriers with 2 copies of the minor alleles of rs1990622 and rs6966915 have a significantly reduced disease penetrance or have the onset significantly delayed. In support of our findings, none of 32 additional GRN mutation carriers previously included in the FTLD-TDP GWAS and available for genotyping to us or 34 symptomatic GRN mutation carriers related to probands already included in the study (including one first-degree relative of MY04172) were homozygous carriers of the minor alleles of TMEM106B SNPs. Finally, we performed sequencing analysis of the complete TMEM106B coding region and identified a coding variant located in TMEM106B exon 6, predicted to result in p.T185S (rs3173615). Both patients homozygous for the minor alleles of rs1990622 and rs6966915 carried 2 copies of serine at position 185 and additional genotyping confirmed complete linkage disequilibrium of rs3173615 with rs1990622 and rs6966915 in our population of GRN mutation carriers.

In contrast to the subpopulation of GRN mutation carriers, no significant association with TMEM106B was observed in patients with clinical FTLD or patients with FTLD-TDP without GRN mutations. A lack of association of TMEM106B SNPs was also previously reported in a series of 192 clinical patients as part of the original FTLD GWAS.¹⁰ The lack of association in clinical FTLD series could be due to the significant heterogeneity predicted for this patient group, with at least 3 different FTLD molecular pathologies and possibly other neurodegenerative disorders underlying the clinical FTLD phenotype in these patients.^14–17 With only 80 patients with confirmed FTLD-TDP in the current study, we also had limited power to detect an OR comparable to the original study, which may explain why our results did not reach significance in the FTLD-TDP subpopulation.

GRN is a secreted growth factor with diverse roles in development, wound repair, inflammation, and tumor formation.^18,19 Moreover, recent studies suggested that GRN is a neurotrophic factor involved in maintaining neuronal function during aging.^20,21 Since a 50% loss of GRN expression is sufficient to cause FTLD-TDP in GRN mutation carriers^7,8 and partially reduced expression levels of GRN have been shown to increase the risk for FTLD-TDP,^22,23 we hypothesized that TMEM106B SNPs could influence FTLD-TDP risk by modulating GRN expression.

We previously reported that GRN mRNA and protein is detectable both in the central and peripheral compartments and can be used to identify symptomatic and asymptomatic GRN mutation carriers.^24–26 Using a GRN ELISA, we now show that the minor alleles of the TMEM106B SNPs (associated with a protective effect in GRN mutation carriers) are associated with a modest but significant increase in GRN expression levels in plasma of healthy controls in 2 independent series. Furthermore, in peripheral blood samples of patients with FTLD and controls, increased levels of TMEM106B mRNA were associated with reduced levels of GRN mRNA. Together with the previously published observation that TMEM106B variants confer FTLD-TDP risk by increasing TMEM106B expression, these data strongly support a hypothesis whereby the common risk alleles of TMEM106B SNPs increase expression of TMEM106B, leading to a decrease in GRN mRNA and protein levels, explaining the increased FTLD-TDP risk. Conversely, GRN mutation carriers homozygous for the minor alleles of TMEM106B SNPs may have GRN expression levels which are sufficiently elevated to reach a critical threshold, reducing the disease penetrance and protecting them from developing FTLD. Whether p.T185S identified in this study or another functional variant in TMEM106B outside the coding region is responsible for altering TMEM106B expression remains unknown and should be the focus of future functional studies.

Importantly, both in the current study and in the FTLD-TDP GWAS study, the association of TMEM106B SNPs with FTLD was statistically more significant in patients with FTLD with GRN mutations compared to those without mutations. This strongly argues that TMEM106B functionally interacts, either directly or indirectly, with GRN to affect FTLD pathogenesis. The study of TMEM106B and its relation to GRN holds promise for the development of protective therapies for FTLD in the future.

AUTHOR CONTRIBUTIONS

Statistical analysis was conducted by Dr. Julia Crook, Dr. Minerva M. Carrasquillo, and Dr. Giovanni Coppola.

STUDY FUNDING

Supported by the NIH [P50 AG16574 (Mayo ADRC R.C.P. PI; to R.R., B.F.B., N.R.G.-R., D.W.D., S.G.Y.), U01 AG06576 (Mayo Alzheimer's Disease Patient Registry: R.C.P. PI); R01 NS065782 (to R.R.), R01 AG18023 (to N.R.G.-R., S.G.Y.), RC1AG0356101 (to G.C.), R01AG026938 (to G.C., D.H.G.), AG19724 and AG023501 (to B.L.M., D.H.G.), AG1657303 (to B.L.M., W.W.S.), AG25711 (to D.W.D.), AG17216 (to D.W.D., Z.K.W.), AG03949 (to D.W.D.), AG13854 (to M.M., E.H.B.), DC008552 (to M.M.)] and the Consortium for Frontotemporal Dementia Research (to R.R., D.H.G., G.C., W.W.S., B.L.M.). The work of T.G.B. at the Banner Sun Health Research Institute is supported by the NIA [P30 AG19610 (Arizona Alzheimer's Disease Core Center)], the Arizona Department of Health Services (contract 211002, Arizona Alzheimer's Research Center), the Arizona Biomedical Research Commission (contracts 4001, 0011, 05–901 and 1001 to the Arizona Parkinson's Disease Consortium), and the Michael J. Fox Foundation for Parkinson's Research. Z.K.W. is partially supported by the NIH [RC2NS070276, NS40256, NS057567, NS070276], the Mayo Clinic Florida Research Committee CR program, and the gift from Carl Edward Bolch, Jr., and Susan Bass Bolch. K.J.H. and C.L.W. were supported by the NIH [5P30AG012300], the Winspear Family Center for Research on the Neuropathology of Alzheimer Disease, and the McCune Foundation. I.R.M. was supported by the Canadian Institutes of Health Research Operating (#74580) and the Pacific Alzheimer's Disease Research Foundation. R.G., L.B., and G.B. are supported by grants Fondazione CARIPLO 2009–2633, FIRB 2006 “Gen-Etica”; Progetto Regione Lombardia, Delibera N°VIII/008724. This project was also supported by the Robert and Clarice Smith Postdoctoral Fellowship (M.M.C.); Robert and Clarice Smith and Abigail Van Buren Alzheimer's Disease Research Program (R.C.P., D.W.D., N.R.G.-R.; S.G.Y.); and the Palumbo Professorship in Alzheimer's Disease Research (S.G.Y.).

DISCLOSURE

N. Finch reports no disclosures. Dr. Carrasquillo received research support from the Robert and Clarice Smith Postdoctoral Fellowship. M. Baker may accrue revenue on patents re: Methods and materials for detecting and treating dementia. N.J. Rutherford, M. DeJesus-Hernandez, R. Crook, and T. Hunter report no disclosures. Dr. Ghidoni serves as Managing Editor for Frontiers in Bioscience and as an Associate Editor for the Journal of Alzheimer's Disease and the International Journal of Clinical and Experimental Medicine and receives research support from Fondazione CARIPLO and Progetto Regione Lombardia. Dr. Benussi receives research support from Progetto Regione Lombardia. Dr. Crook receives research support from the NIH. Dr. Finger receives research support from the Lawson Health Research Institute, the University of Western Ontario Academic Development Fund, the Hazel Soper Foundation, and the Alzheimer's Society of London and Middlesex. Dr. Hantanpaa serves as a consultant for Biosite, Inc. and receives research support from the NIH. A.M. Karydas reports no disclosures. P. Sengdy receives salary support from CIHR. Dr. Coppola receives research support from the NIH, the Consortium for Frontotemporal Dementia Research, the Adelson Medical Research Foundation, the Tau Consortium, and the Easton Consortium. J. Gonzalez reports no disclosures. Dr. Seeley receives research support from the NIH, the James S. McDonnell Foundation, and the Consortium for Frontotemporal Dementia Research. Dr. Johnson reports no disclosures. Dr. Beach receives research support from Avid Radiopharmaceuticals, Inc., Bayer Schering Pharma, GE Healthcare, the NIH, the Arizona Department of Health Services, and the Arizona Biomedical Research Commission. Dr. Mesulam serves on the scientific advisory boards for the Cure Alzheimer Fund and the Association on Frontotemporal Dementia; serves on the editorial boards of Brain, Annals of Neurology, Human Brain Mapping, and Journal of Cognitive Neuroscience; receives royalties from the publication of Principles of Behavioral and Cognitive Neurology (Oxford University Press, 2000); and receives research support from the NIH. Dr. Forloni receives research support from the European Commission. Dr. Kertesz serves on a scientific advisory board for Pfizer Inc.; serves on the editorial boards of Cognitive and Behavioral Neurology and Aphasiology; receives royalties from the publication of The Western Aphasia Battery (Grune and Stratton, 1982); and has received support from the Lawson Research Institute, the American Neurological Society, and the Whitaker professorship. Dr. Knopman serves as Deputy Editor of Neurology®; has served on data safety monitoring boards for Sanofi-Aventis, GlaxoSmithKline, and Eli Lilly and Company; is an investigator in clinical trials sponsored by Elan Corporation, Baxter International Inc., and Forest Laboratories, Inc.; and receives research support from the NIH. Dr. Uitti serves as an Associate Editor of Neurology®; has received research support from Advanced Neuromodulations Systems and the NIH; and his institution receives annual royalties from Lundbeck Inc. from the licensing of the technology related to PARK8/LRRK2. Dr. White serves as a scientific advisor for the Michael J. Fox Foundation for Parkinson's Research and receives research support from the NIH, the Winspear Family Center for Research on the Neuropathology of Alzheimer's Disease, and the McCune Foundation. Dr. Caselli serves as Medical Editor for Clinical Neurology News and receives research support from the NIH/NIA and the Arizona Alzheimer's Research Consortium. Dr. Lippa serves on scientific advisory boards for the Association for Frontotemporal Dementias, the Lewy Body Dementia Association, and the Alzheimer's Association (Delaware Valley Chapter); serves as Editor-in-Chief of the American Journal of Alzheimer Disease and Other Disorders and the editorial boards of Neurology® and Journal of Neuropathology & Experimental Neurology; and has received research support from UCB, Novartis, Elan Corporation, Janssen, Danone, Potamkin Foundation, and the Newmann Foundation. Dr. Bigio serves on the editorial boards of the Journal of Neuropathology and Experimental Neurology, Acta Neuropathologica, and Brain Pathology. Dr. Wszolek serves as Co-Editor-in-Chief of Parkinsonism and Related Disorders, Regional Editor of the European Journal of Neurology, and on the editorial boards of Neurologia i Neurochirurgia Polska, Advances in Rehabilitation, the Medical Journal of the Rzeszow University, and Clinical and Experimental Medical Letters; holds and has contractual rights for receipt of future royalty payments from patents re: A novel polynucleotide involved in heritable Parkinson's disease; receives royalties from publishing Parkinsonism and Related Disorders (Elsevier, 2007, 2008, 2009) and the European Journal of Neurology (Wiley-Blackwell, 2007, 2008, 2009); and receives research support from Allergan, Inc., the NIH, the Pacific Alzheimer Research Foundation (Canada), the CIHR, the Mayo Clinic Florida Research Committee CR program, and the gift from Carl Edward Bolch, Jr., and Susan Bass Bolch. Dr. Binetti receives research support from FIRB 2006 “Gen-Etica” and Progetto Regione Lombardia. Dr. Mackenzie serves on the editorial boards of Journal of Neuropathology and Experimental Neurology, Neuroinflammation, Clinical Neuropathology, and Neurobiology of Aging; and receives research support from the CIHR, the Pacific Alzheimer Research Fund, and Michael Smith Foundation for Health Research. Dr. Miller serves on a scientific advisory board for the Alzheimer's Disease Clinical Study, serves as an Editor for Neurocase, and as an Associate Editor of ADAD; receives royalties from the publication of Behavioral Neurology of Dementia (Cambridge, 2009), Handbook of Neurology (Elsevier, 2009), and The Human Frontal Lobes (Guilford, 2008); serves as a consultant for Lundbeck Inc., Allon Therapeutics, Inc., and Novartis; and receives research support from Novartis, the NIH, and the State of California Alzheimer's Center. Dr. Boeve receives royalties from the publication of Behavioral Neurology of Dementia (Cambridge University Press, 2009) and receives research support from Cephalon, Inc., the NIH, and the Alzheimer's Association. Dr. Younkin has received funding for travel and speaker honoraria from Eisai Inc.; receives royalty payments from Mayo for licensing of Tg2576 mouse model of Alzheimer disease; and receives research support from the NIH and the Robert and Clarice Smith and Abigail Van Buren Alzheimer's Disease Research Program. Dr. Dickson serves on the editorial boards of the American Journal of Pathology, Journal of Neuropathology and Experimental Neurology, Brain Pathology, Neurobiology of Aging, Journal of Neurology, Neurosurgery, and Psychiatry, Annals of Neurology, and Neuropathology; and receives research support from the NIH. Dr. Petersen serves on scientific advisory boards for Elan Corporation, Wyeth, and GE Healthcare; receives royalties from publishing Mild Cognitive Impairment (Oxford University Press, 2003); and receives research support from the NIH. Dr. Graff-Radford serves on a scientific advisory board for and has received funding for travel from Codman; serves on the editorial boards of The Neurologist and Alzheimer Disease and Therapy; has a patent pending on the Ab40Ab42 ratio as a predictor of Alzheimer disease; received royalties for an article in UpToDate; and receives research support from Pfizer Inc., Janssen, Elan Corporation, Forest Laboratories, Inc., Medivation, Inc., and the NIH. Dr. Geschwind serves on scientific advisory boards for Autism Speaks, the Alzheimer Research Forum, and the March of Dimes Birth Defects Foundation; serves on the editorial boards of Neuron, Neurogenetics, the Neurobiology of Disease, Current Genomics, Biological Psychiatry, Autism Research, the Encyclopedia of Autism and Related Disorders, and Biomed Central; may accrue revenue on patents re: Peripheral gene expression biomarkers for autism and full biomarkers in Friedreich's ataxia; and receives research support from the NIH, The Simons Foundation, and the Consortium for Frontotemporal Dementia Research. Dr. Rademakers holds patents re: Methods and materials for detecting and treating dementia; and receives research support from the NIH, the Pacific Alzheimer Research Foundation (Canada), the Association for Frontotemporal Dementia, the Amyotrophic Lateral Sclerosis Association, and CurePSP.