Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Feb 8.
Published in final edited form as: Circ Cardiovasc Genet. 2008 Dec 9;1(2):126–132. doi: 10.1161/CIRCGENETICS.108.796342

Variants of Folate Metabolism Genes and the Risk of Conotruncal Cardiac Defects

Elizabeth Goldmuntz 1, Stacy Woyciechowski 1, Daniel Renstrom 1, Philip J Lupo 2, Laura E Mitchell 2
PMCID: PMC3035562  NIHMSID: NIHMS267285  PMID: 20031554

Abstract

Background

Although congenital heart defects (CHD) are the most common, serious group of birth defects, relatively little is known about the causes of these conditions and there are no established prevention strategies. There is evidence suggesting that the risk of CHD in general, and conotruncal and ventricular septal defects in particular, may be related to maternal folate status as well as genetic variants in folate-related genes. However, efforts to establish the relationships between these factors and CHD risk have been hampered by a number of factors including small study sample sizes and phenotypic heterogeneity.

Methods and Results

The present study examined the relationships between variation in nine folate-related genes and a subset of CHD phenotypes (i.e. conotruncal defects, perimembranous and malalignment type ventricular septal defects, and isolated aortic arch anomalies) in a cohort of over 700 case-parent triads. Further, both maternal and embryonic genetic effects were considered. Analyses of the study data confirmed a previously reported association between embryonic genotype for MTHFR A1298C and disease risk (unadjusted p=0.002).

Conclusions

These results represent the most comprehensive and powerful analysis of the relationship between CHD and folate-related genes reported to date, and provide additional evidence that, similar to neural tube defects, this subset of CHD is folate-related.

Keywords: pediatrics, heart defects, congenital, genetics

Introduction

It is estimated that, worldwide, 7.9 million children are born with a serious birth defect of genetic or partially genetic origin each year 1. The most commonly occurring of these conditions are malformations of the heart. Although congenital heart defects (CHD) are the most common type of birth defect, and are associated with significant morbidity and mortality, relatively little is known about the causes of these conditions, and there are no established strategies for reducing their public health impact 2.

As a group, CHD include a broad range of malformations that are anatomically, epidemiologically, developmentally and clinically heterogeneous 3. Although the extent to which different forms of CHD may share a common etiology is poorly understood, subgroups of CHD, which appear to be more similar to each other than to other forms of CHD, have been identified 4. One such subgroup includes malformations of the cardiac outflow tracts and great arteries, which are commonly referred to as conotruncal defects (CTD). This subgroup of CHD (i.e. CTD), involves cardiac structures that are, in part, derived from common cell lineages (i.e. cardiac neural crest cells and the secondary heart field) 5. In addition, family studies suggest that the defects within this subgroup share common genetic underpinnings. Specifically, the affected relatives of individuals with a CTD are more likely to have a CTD than other forms of CHD 6–8, suggesting that the various types of CTD are more closely related to each other than to other forms of CHD. Evidence also suggests that CTD may, in some cases, be etiologically related to perimembranous and malalignment type ventricular septal defects (VSD), and isolated aortic arch anomalies (AAA). In particular, these lesions co-occur in the same individual (e.g. CTD and AAA) and in the same kindred with multiple affected members 6–8. Animal models of single gene defects frequently display a similar spectrum of cardiovascular anomalies 9–13, as do human genetic syndromes. For example, the cardiovascular phenotype of the 22q11 deletion syndrome includes a subset of CTD as well as VSD and AAA 14–18. Therefore, despite their phenotypic differences, CTD, VSD and AAA likely share some etiologic, and specifically genetic, risk factors.

There are several known environmental (e.g. thalidomide, maternal phenylkeonuria) and genetic (e.g. 22q11 deletion, Alagille syndrome) causes of CHD in humans 2, 19. However, the established causes of CHD are individually quite rare, and in the vast majority of affected individuals a specific causative agent cannot be identified. It has been suggested that, similar to neural tube defects, the risk of CHD in general, and of conotruncal and ventricular septal defects in particular, may be influenced by maternal folate status [reviewed in 2]. There is also some evidence that the risk of CHD may be influenced by variation within genes that are involved in folate-transport and metabolism 20–23. However, neither the association with maternal folate status, nor with folate-related genes has been firmly established for CHD in general, or for specific subsets of CHD 2, 24. Hence, further investigation of the association between CHD and folate is clearly warranted.

The present study was undertaken to establish the relationship between a relatively homogeneous subset of all CHD (i.e. CTD, perimembranous and malalignment type VSD and AAA, collectively referred to conotruncal and related defects or CTRD) that has, in some but not all studies, been associated with maternal folate status, and several well-characterized variants within genes that are involved in folate-metabolism.

Materials and Methods

Statement of Responsibility

The authors had full access to and take full responsibility for the integrity of the data. All authors have read and agree to the manuscript as written.

Study Subjects

From 1997–2007 study subjects were recruited from the Cardiac Center at The Children’s Hospital of Philadelphia in accordance with a protocol approved by the Institutional Review Board for the Protection of Human Subjects. Study subjects included those with a classic conotruncal defect: tetalogy of Fallot (TOF), D-transposition of the great arteries (D-TGA), double outlet right ventricle (DORV), truncus arteriosus (TA) or interrupted aortic arch (IAA), as well as those with a perimembranous or posterior malalignment type ventricular septal defect (VSD), or an isolated aortic arch anomaly (AAA). These malformations were selected to form a relatively homogenous subset of all CHDs that are likely to share common risk factors, based on several considerations, including: (1) the co-occurrence of AAA and CTD in the same individual 25, (2) co-segregation of VSD and CTD (including D-TGA) within families 6–8, (3) the occurrence of CTD, VSD and AAA in individuals with the 22q11 deletion syndrome 16–18, and (4) the inverse relationship between VSD, CTD and TGA risk and maternal, periconceptional use of multivitamin supplements and/or folic acid fortification that has been observed in some studies 26–29.

Both males and females, and individuals of any racial/ethnic group were eligible to participate. Blood samples were collected from study subjects prior to surgery and blood, buccal or saliva samples were collected from each available parent. Cases with a recognized genetic syndrome or chromosome anomaly, including those with a 22q11 deletion, were excluded from the current analyses. In addition, cases were tested for a 22q11 deletion by fluorescence in situ hybridization (FISH) using standard techniques when an appropriate sample was available. Medical records including, when necessary, original imaging studies were reviewed to confirm the cardiac diagnosis and identify additional medical issues. In addition, a brief medical interview including a three-generation pedigree was completed by a genetic counselor.

Genotyping Methods

Case and parental DNA was extracted from whole blood, buccal swabs or lymphoblastoid cell lines using standard methods (Puregene DNA isolation kit by Gentra System Inc., Minneapolis MN). Duplicate samples were included both within and across plates such that 5% of the samples were genotyped three times. The study cohort was genotyped for ten polymorphisms from nine genes including eight single nucleotide polymorphisms (SNPs) and two insertion/deletion alleles (Table 1). All of the genes selected for analysis are involved in folate-homocysteine metabolism, and had previously been suggested as potential risk factors for CHD, neural tube defects and/or other structural malformations. Specific variants were selected for genotyping based on previous studies demonstrating an association between the variant and risk of CHD or another structural birth defect and/or evidence that the variant influences protein function.

Table 1.

Genotyping assays for selected variants in ten folate-related genes

Gene Name Gene Abbreviation Polymorphism dbSNP- rs# AA*- position Assay Forward/Reverse Primer/Vic-reporter or AOD Reference Number*
Betaine-homocysteine methyltransferase BHMT G742A 3733890 R239Q ABD† CTCATGAAGGAGGGCTTGGA
CCAAGGGCTGGCTCATCAG
CTTTCAGTTGGGCAGC
Monocyte chemotactic protein-1 MCP1 A251G 1024611 UTR ABD TTCTTGACAGAGCAGAAGTGG
GCCTTTGCATATATCAGACAGTA
AGACAGCTGTCACTTTC
5,10-methylene tetrahydrofolate reductase MTHFR A1298C 1801131 E429A ABD GGAGGAGCTGCTGAAGATGTG
CCCGAGAGGTAAAGAACAAAGACTT
ACCAGTGAAGAAAGTGT
5,10-methylene tetrahydrofolate reductase MTHFR C677T 1801133 A222V AOD‡ C____1202883_20*
Methionine synthase MTR A2756G 1805087 D919G AOD C____12005959_10*
Methionine synthase reductase MTRR A66G 1801394 I22M AOD C____3068176_10*
Serine Hydroxymethyltransferase SHMT C1420T 1979277 F474L ABD CTCCGGGAGGAGGTTGAGA
GCCCGCTCCTTTAGAAGTCA
CTTCGCCTCTCTCTTC
Transcobalamin II TCN2 C777G 1801198 P259R AOD C____325467_10*
Cystathionine β-synthase CBS 844Ins68 GB§ GCAGTTGTTAACGGCGGTAT
GATGAAGTCGTAGCCGATCC
Dihydrofolate reductase DHFR Intron 1-19bp- deletion GB F1: CCACGCTCGGGGTACCTGCC
F2: ACGGTCGGGGTGGCCGACTC
R: AAAAGGGGAATCCAGTCGG
*

AA, amino acid;

†

ABD, assay by design;

‡

AOD, assay on demand;

§

GB, Gel-based assay

SNP genotyping was conducted in the High-Throughput Genotyping Core Laboratory at the Molecular Diagnosis and Genotyping Facility at the University of Pennsylvania, using the ABI 7900 HT Sequence Detection System (Applied Biosystems, Inc., Foster City, CA). Taqman 5′ nuclease PCR primers and probes for the variant of interest were ordered (Assays-on-Demand) or custom designed (Assay-By-Design) by Applied Biosystems (Foster City, CA). To validate each assay, the primer and probe sets were tested on a panel of DNA samples composed of CEPH family members (Family 1331, XC01331) obtained from Coriell Human Variation Collection (Coriell Institute, Camden, NJ). PCR amplifications were subsequently performed in a 384-well plate format with appropriate controls and processed according to the manufacturer’s instructions (Applied Biosystems, Inc., Foster City, CA). Allelic discrimination results were graphed on a scatter plot and data transferred electronically for analysis.

The CBS 844ins68 insertion/deletion polymorphism was genotyped using a PCR based assay. Primers spanning the 68bp insertion/deletion polymorphism resulted in a 280 bp or 210 bp product after PCR amplification. Genomic DNA (50 ng) was PCR amplified in a final volume of 25 ul with 1X PCR buffer II (Roche Diagnostics, Mannheim, Germany), 2mM MgCl2, 200uM dNTPs, 200pmol of each primer, and 1U TaqGold polymerase (Roche Diagnostics, Mannheim, Germany) using the following conditions: denaturation at 95°C for 5min, followed by 35 cycles of 94°C for 30s, 60°C for 30s, and 72°C for 30s, and final extension at 72°C for 5min. Amplified product was run on a 2% agarose gel for 45 minutes at 120v and visualized using ethidium bromide stain. The genotype of each sample was independently called by two laboratory members.

The DHFR 19 bp deletion polymorphism in Intron 1 was genotyped using a modification of a previously reported strategy 30. Two forward primers, one of which mapped into the deleted segment and the other outside, were used with a single reverse primer to identify product with and without the 19bp deletion. Twenty nanograms of gDNA were amplified in a total volume of 20 ul containing 1 X PCR Buffer I with 15 mM MgCl2, 0.5 U AmpliTaq Gold (both from Applied Biosystems), 0.25 mM dNTPs (Invitrogen), 0.5 uM each of primers F1, F2, and R1 (Table 1), and 0.1 M betaine (U.S.B) with the following conditions: denaturation for 4 min at 94°C, 35 cycles at 95°C for 1 min, 58.6°C for 1 min, 72°C for 1 min, and a final extension of 7 min at 72°C. The PCR products were analyzed on a 3% GenePure HiRes agarose gel (ISC Bioexpress, Kaysville, UT), and genotype calls were made by two independent laboratory members.

Statistical Methods

The characteristics of the case individuals and their parents were summarized using counts and proportions. In addition, for each analyzed variant, the proportion of samples for which a genotype could not be assigned, the proportion of samples that yielded discrepant results on repeated genotypes, and the proportion of triads that had genotype combinations that were incompatible with Mendelian inheritance were determined. For each sample, the number of genotyping failures (i.e. genotypes that could not be assigned or were discrepant across repeated genotypes) was determined. These analyses were performed using SAS version 9.1 (SAS Institute, Inc, Cary, NC).

Log-linear analyses were used to assess the association between CTRD and both the case and maternal genotypes for each variant 31. For simplicity, the most common genotype for each variant was designated as the referent category. The risk of CTRD in cases, and the risk of having a child with a CTRD in mothers of cases with the heterozygous or rare homozygous genotypes, relative to cases and mothers with the common homozygous genotype, was estimated along with associated 95% confidence intervals. The significance of the case and maternal genetic effects was determined using the likelihood ratio test to compare the log-linear model that included terms for both the case and maternal genotypes, with reduced models that included terms for only the case or only the maternal genotype. In general, an unrestricted model, which allowed the relative risks associated with the heterozygous and rare homozygous genotypes to vary independently was fitted to the data. However, when the number of cases or mothers with the rare homozygous genotype was small (N≤10), a dominant model of inheritance was fitted to the data. These analyses were run using LEM 32, a program for log-linear analysis with missing data that allows data from triads that have not been completely genotyped to be included in the analysis for any given variant. The association between CTRD and haplotypes formed by the two MTHFR variants were evaluated using an extension of the log-linear model that provides estimates of single-and double-dose haplotype effects 33. The haplotype analyses were conducted using HAPLIN version 2.1.1 running under R Version 2.5.1 for Windows. In all log-linear analyses, likelihood ratio tests with uncorrected p-values of ≤0.05 were considered to be of interest. However, given that multiple tests were performed (i.e. N=20, tests of case and maternal genetic effects for 10 variants), the approach of Benjamini and Hochberg (1995) 34 was used to control the false discovery rate at 0.05.

The log-linear analyses were conducted using data from all triads, and in a subset of the data that excluded triads in which the mother reported that she was diabetic or used insulin, was epileptic or reported the use of seizure medication, or took the drug Paxil during her pregnancy. Only triads in which both parents were non-Hispanic Caucasian were included in this subgroup to minimize the potential for biased assessment of the maternal genotype effects that can result when parents are from different racial/ethnic groups 35. To determine whether the results obtained using data from all triads were influenced by heterogeneity within the case group, two additional subgroups were also analyzed. One of these subgroups included data only from triads in which the case had a classic conotruncal defect (i.e. TOF, D-TGA, DORV, TA or IAA), and the other included data only from triads in which the case had normally related great arteries (i.e. TOF, VSD, AAA, TA, or IAA).

Results

The study sample included 727 triads in which the case individual had a CTRD (Table 2) and was not diagnosed with either a recognized genetic syndrome or chromosome abnormality. Among these case individuals, 689 (95%) had been tested, and were negative for, a 22q11 deletion (the remaining 5% of cases did not have an appropriate sample for FISH analysis). Hence, these cases are unlikely to include individuals with aneuplodies, large structural chromosome abnormalities or deletion of the 22q11 chromosomal region.

Table 2.

Characteristics of CTRD cases and their parents

Characteristic Total (%)(N=727)
Offspring sex
 Male 430 (59.2)
 Female 297 (40.8)
Race/Ethnicity (parental mating pairs)
 White 525 (72.2)
 Black 74 (10.2)
 Hispanic 22 (3.0)
 Asian 20 (2.8)
 Mixed 86 (11.8)
Primary Diagnosis
 Tetralogy of Fallot (TOF) 279 (38.4)
 D-transposition of the great artery (D- TGA) 152 (20.9)
 Ventricular septal defect (VSD)* 146 (20.1)
 Double outlet right ventricle (DORV) 72 (9.9)
 Aortic arch anomaly (AAA) 38 (5.2)
 Truncus arteriosus (TA) 21 (2.9)
 Interrupted aortic arch (IAA) 19 (2.6)
*

Coarctation of the aorta was present in 16 of the case individuals with a VSD

The most common diagnoses among the cases were tetralogy of Fallot (38.4%), d-transposition of the great arteries (20.9%) and ventricular septal defect (20.1%). There was a predominance of males among the cases (59.2%), and in the majority both parents were reported to be non-Hispanic Caucasian (72.2%). Maternal diabetes (pre-pregnancy or gestational) or the use of insulin (N=55), epilepsy or the use of a seizure medication (N=3), or use of Paxil (N=1) was reported in 8.1% of the triads.

Ten well-characterized genetic variants in nine genes involved in folate metabolism were chosen for analysis (Table 1). Genotyping was performed on 1,990 DNA samples derived from members of the study triads. Genotype call rates ranged from 96% to 98% for each variant; the proportion of samples that provided discrepant results on repeat genotypes ranged from 0% to 0.8%; and the proportion of triads with genotype combinations that were incompatible with Mendelian inheritance ranged from 0.7% to 2.5% (N=5–19 families) per variant. On the basis of these results, all of the genotypes were considered to be of sufficiently high quality to include in the subsequent statistical analyses. However, all genotype data from families that included at least one genotype combination that was incompatible with Mendelian inheritance were omitted from all analyses (N=225 samples from 75 triads with a Mendelian inconsistency for one or more variant). In addition, all genotype data from individual samples that failed or provided discrepant results on repeat genotyping for four or more of the genotyped variants were omitted from all analyses (N=55 samples). The number of useable genotypes for each of the variants ranged from 1,685 to 1,715. The observed genotype distributions in case individuals and their mothers and fathers are presented in Supplementary Table 1.

Log-linear analyses of individual variants and haplotypes formed by the two MTHFR variants were performed using data from all triads and in three subsets of triads selected to minimize heterogeneity and/or bias. However, as the results obtained from these subset analyses were similar to those obtained using the full dataset, only the results obtained from the analyses of the full dataset are presented. The distribution of the analyzed triads, by genotypes of the mother, father and case, for each variant are provided in Supplementary Table 2.

Estimates of relative risk of CTRD and 95% confidence intervals for case and maternal genotypes, and the likelihood ratio test statistic and associated p-value for the model comparisons for each variant are summarized in Table 3. Uncorrected p-values ≤0.05 were achieved for the LRTs evaluating the association between CTRD and maternal MTR A2756G genotype (p=0.04), and case genotype for two variants: CBS 844ins68 (p=0.05) and MTHFR A1298C (p=0.002). However, using the false discovery rate approach to account for multiple testing, only the association between CTRD and case genotype for the MTHFR A1298C variant remained significant (maternal MTR A2756, p=0.04 > 0.005; case CBS 844ins68, p=0.05 > 0.008; case MTHFR A1298C, p=0.0021 < 0.0025). Among cases, individuals with MTHFR A1298C AC and CC genotypes were at decreased risk relative to cases with the AA genotype (RRAC vs. AA = 0.67, 95% CI 0.53–0.84; RRCC vs. AA = 0.74, 95% CI 0.50–1.12). Analysis of the haplotypes formed by the two MTHFR variants confirmed an effect of the case A1298C genotype only, and provided no evidence of an affect of the maternal MTHFR C677T/A1298C haplotype on CTRD risk (data not presented).

Table 3.

Summary of log-linear modeling results for CTRD triads

BHMT G742A CBS* 844ins68 DHFR 19 bp-del MCP1 A2518G MTHFR A1298C MTHFR C677T MTR A2756G MTRR A66G SHMT C1420T TCN2 C777G
Triads/dyads/monads 431/201/20 439/182/30 427/195/29 436/191/24 430/191/30 438/188/25 431/200/21 418/205/28 431/196/24 430/187/34
Proband effect
 R1 (95% CI†) 1.07 (0.86–1.33) 1.40 (1.00–1.95) 0.98 (0.77–1.24) 1.07 (0.86–1.34) 0.67 (0.53–0.84) 1.12 (0.89–1.41) 0.99 (0.78–1.26) 0.86 (0.66–1.12) 1.08 (0.86–1.36) 0.88 (0.70–1.11)
 R2 (95% CI) 0.89 (0.58–1.35) R1=R2 0.86 (0.61–1.21) 0.81 (0.52–1.28) 0.74 (0.50–1.12) 1.19 (0.82–1.73) 0.95 (0.55–1.63) 0.95 (0.67–1.33) 1.26 (0.84–1.88) 0.87 (0.62–1.22)
 LRT‡ (unadjusted p value) 1.22 (0.5) 3.98 (0.05) 0.96 (0.62) 2.02 (0.36) 12.36 (0.002) 1.18 (0.55) 0.04 (0.98) 1.68 (0.43) 1.30 (0.52) 1.20 (0.55)
Maternal effect
 S1 (95% CI) 0.97 (0.76–1.24) 1.06 (0.76–1.47) 0.93 (0.70–1.24) 1.04 (0.81–1.33) 0.87 (0.67–1.12) 1.07 (0.82–1.38) 1.40 (1.07–1.83) 1.11 (0.81–1.51) 0.95 (0.74–1.22) 1.10 (0.84–1.44)
 S2 (95% CI) 0.88 (0.55–1.40) S1=S2 0.72 (0.51–1.01) 0.85 (0.53–1.34) 0.68 (0.44–1.06) 1.39 (0.95–2.04) 1.26 (0.69–2.29) 0.99 (0.71–1.38) 0.78 (0.50–1.21) 1.29 (0.91–1.83)
 LRTc (unadjusted p value) 0.33 (0.85) 0.11 (0.74) 3.84 (0.15) 0.70 (0.70) 3.53 (0.17) 2.94 (0.23) 6.28 (0.04) 0.75 (0.69) 1.25 (0.53) 2.04 (0.36)

NOTE: All parameter estimates are comparisons of variant alleles to homozygous wild type (e.g., R1 and S1 for MTHFR A1298C is AC vs. AA, and R2 and S2 is CC vs. AA).

*

II and IN were combined for this analysis (using a dominant model) due to small numbers (≤ 10), and the likelihood ratio test was based on 1 degree of freedom.

†

Confidence interval

‡

Likelihood ratio test with 2 degrees of freedom

Discussion

Our analyses of these data provide little evidence of an association between CTRD and either the embryonic or maternal genotype for BHMT R23Q, DHFR intron 1–19 bp del, MCP1 A2518G, MTRR A66G, SHMT C1420 or TCN2 C777G. Of these variants, only MTRR A66G and TCN2 C776G have been previously studied as risk factors for CHD. Consistent with the results of our analyses, previously published studies of these variants provide no compelling evidence that either the MTRR A66G 36, 37, or the TCN2 C776G 37 variant has a significant, independent effect on the risk of CTRD.

Our analyses provide weak evidence (i.e. unadjusted p<0.05) that the MTR A2756G variant may influence the risk of CTRD via the maternal genotype. Interestingly, maternal genotypes that include the MTR 2756G allele have been associated with increased offspring risk of spina bifida 38 and cleft lip with or without cleft palate 39. However, in two small case-control studies (N<200 cases) no evidence of an association between CHD and MTR A2756G 40, 41 was found.

Analyses of the CBS 844ins68 variant in our data also provide weak (i.e. unadjusted p<0.05) evidence that the insertion allele influences CTRD risk via the genotype of the embryo. This finding is consistent with the results of at least one 41, but not all 40, 42 of the previously published studies on the relationship between this variant and CHD risk.

Perhaps of most interest are our results pertaining to the two MTHFR variants, which have been the focus of numerous studies aimed at identifying genetic risk factors for a range of birth defects 24. While there have been more than a dozen studies of the relationship between the MTHFR C677T variant and CHD risk, neither the maternal nor the embryonic C677T genotype has been consistently implicated as a risk factor 43. Moreover, a recent meta-analysis of the association between CHD and the maternal and embryonic C677T genotypes provided summary odds ratios that, although greater than 1.0, were not statistically significant 43. Our results, which are based on a sample size (N=651 triads) that is nearly as large as that of the pooled data used in the meta-analysis (N=882 cases and 664 mothers of cases) also indicate that the risk of CHD is not significantly associated with either the maternal or the embryonic MTHFR C677T genotypes. It is, however, of note that in our data the maternal MTHFR 677TT genotype was associated with a moderate increase in the risk of CTRD among offspring (RRTT vs CC = 1.39, 95% CI 0.95–2.04) that is similar in magnitude to that reported in the meta-analysis (ORTT vs CC = 1.2, 95% CI 0.83–1.74) 43.

The association between the MTHFR A1298C variant and CHD has been evaluated in only five studies, which have not previously been summarized. Briefly, two small case-control studies (N=103 44 and N=58 40) found no evidence of an association between the A1298C variant and CHD; a family-based study (N=207 triads 45) found no evidence of an association between the maternal or embryonic A1298C genotype and risk of left-sided obstructive lesions; and in a cohort study 46, infants with CHD (N=25) were reported to be more likely to have the AC or CC genotypes, as compared to unaffected infants (N=14,474), but these associations were not statistically significant. In the fifth and largest of these studies (N=375 triads), maternal MTHFR A1298C genotype was reported to be unrelated to, and the case genotype significantly related to the risk of CHD (i.e. septal, CTD or right or left sided obstructive disease) 23. Specifically, using the transmission disequilibrium test, parents heterozygous for the MTHFR A1298C variant were found to transmit the C allele to their affected offspring significantly less frequently then they transmitted the A allele (79/205=0.38; p=0.0013) 23. The results of our analyses independently identified the same association between embryonic MTHFR A1298C genotype and risk of some forms of CHD. Moreover, the results from our study and the study of Hobbs et al. 23 are quantitatively similar in that the proportion of C alleles transmitted to affected offspring in complete trios was similar (38% 23; 41% present study, data not presented).

This report summarizes the largest and most comprehensive study of the relationship between folate-related genes and CTRD to date. The results of our analyses provide independent confirmation of the previously reported association between embryonic genotype for the MTHFR A1298C variant and the risk of CHD including, but perhaps not limited to, CTRD. Collectively, the results from this and other studies provide persuasive evidence that the risk of CHD is influenced by genetic variation within the folate-pathway and provide the foundation for more comprehensive studies, which consider a broader array of folate-pathway genes, a more comprehensive set of variants (e.g. tagSNPs), and the potential complexity of the relationships between genes (e.g. gene-gene and gene-environment interactions) and CTRD.

Supplementary Material

Supp1

Acknowledgments

The investigators would like to thank Prasuna Paluru and Sharon Edman for their technical assistance. The investigators would also like to thank the multitude of families who consented to participate in this study.

Funding sources: This research was supported by grants from the NIH/NHLBI (P50 HL74731 and R01 HL076773 to EG and LEM). This project was also supported by Grant Number M01-RR-000240 and UL1-RR-024134 from the National Center for Research Resources. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Center for Research Resources or the National Institutes of Health.

Footnotes

Clinical Trial Registration Number: Not applicable

Disclosures: There are no conflicts of interest to disclose for any of the authors.

References

  • 1.Christianson A, Howson CP, Modell B. March of Dimes Global Report on Birth Defects. 2006 http://www.marchofdimes.com/MOD-Report-PF.pdf.
  • 2.Jenkins KJ, Correa A, Feinstein JA, Botto L, Britt AE, Daniels SR, Elixson M, Warnes CA, Webb CL. Noninherited risk factors and congenital cardiovascular defects: current knowledge: a scientific statement from the American Heart Association Council on Cardiovascular Disease in the Young: endorsed by the American Academy of Pediatrics. Circulation. 2007;115:2995–3014. doi: 10.1161/CIRCULATIONAHA.106.183216. [DOI] [PubMed] [Google Scholar]
  • 3.Botto LD, Lin AE, Riehle-Colarusso T, Malik S, Correa A. Seeking causes: Classifying and evaluating congenital heart defects in etiologic studies. Birth Defects Res A Clin Mol Teratol. 2007;79:714–727. doi: 10.1002/bdra.20403. [DOI] [PubMed] [Google Scholar]
  • 4.Perry LW, Neill CA, Ferencz C, Rubin JD, Loffredo CA. Infants with congenital heart disease: the cases. In: Ferencz C, Rubin JD, Loffredo CA, Magee CA, editors. Epidemiology of Congenital Heart Disease: The Baltimore-Washingtion Infant Study 1981–1989. Vol. 4. Mount Kisco: Futura Publishing Company, Inc; 1993. pp. 33–62. [Google Scholar]
  • 5.Hutson MR, Kirby ML. Model systems for the study of heart development and disease. Cardiac neural crest and conotruncal malformations. Semin Cell Dev Biol. 2007;18:101–110. doi: 10.1016/j.semcdb.2006.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Fraser FC, Hunter AD. Etiologic relations among categories of congenital heart malformations. Am J Cardiol. 1975;36:793–796. doi: 10.1016/0002-9149(75)90461-0. [DOI] [PubMed] [Google Scholar]
  • 7.Corone P, Bonaiti C, Feingold J, Fromont S, Berthet-Bondet D. Familial congenital heart disease: how are the various types related? Am J Cardiol. 1983;51:942–945. doi: 10.1016/s0002-9149(83)80170-2. [DOI] [PubMed] [Google Scholar]
  • 8.Ferencz C, Boughman JA, Neill CA, Brenner JI, Perry LW. Congenital cardiovascular malformations: questions on inheritance. Baltimore-Washington Infant Study Group. J Am Coll Cardiol. 1989;14:756–763. doi: 10.1016/0735-1097(89)90122-8. [DOI] [PubMed] [Google Scholar]
  • 9.Kirby ML, Gale TF, Stewart DE. Neural crest cells contribute to normal aorticopulmonary septation. Science. 1983;220:1059–1061. doi: 10.1126/science.6844926. [DOI] [PubMed] [Google Scholar]
  • 10.Kirby ML. Cellular and molecular contributions of the cardiac neural crest to cardiovascular development. Trends Cardiovasc Med. 1993;3:18–23. doi: 10.1016/1050-1738(93)90023-Y. [DOI] [PubMed] [Google Scholar]
  • 11.Conway SJ, Henderson DJ, Kirby ML, Anderson RH, Copp AJ. Development of a lethal congenital heart defect in the splotch (Pax3) mutant mouse. Cardiovasc Res. 1997;36:163–173. doi: 10.1016/s0008-6363(97)00172-7. [DOI] [PubMed] [Google Scholar]
  • 12.Abu-Issa R, Smyth G, Smoak I, Yamamura K, Meyers EN. Fgf8 is required for pharyngeal arch and cardiovascular development in the mouse. Development. 2002;129:4613–4625. doi: 10.1242/dev.129.19.4613. [DOI] [PubMed] [Google Scholar]
  • 13.Frank DU, Fotheringham LK, Brewer JA, Muglia LJ, Tristani-Firouzi M, Capecchi MR, Moon AM. An Fgf8 mouse mutant phenocopies human 22q11 deletion syndrome. Development. 2002;129:4591–4603. doi: 10.1242/dev.129.19.4591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ryan AK, Goodship JA, Wilson DI, Philip N, Levy A, Seidel H, Schuffenhauer S, Oechsler H, Belohradsky B, Prieur M, Aurias A, Raymond FL, Clayton-Smith J, Hatchwell E, McKeown C, Beemer FA, Dallapiccola B, Novelli G, Hurst JA, Ignatius J, Green AJ, Winter RM, Brueton L, Brondum-Nielsen K, Scambler PJ, et al. Spectrum of clinical features associated with interstitial chromosome 22q11 deletions: a European collaborative study. J Med Genet. 1997;34:798–804. doi: 10.1136/jmg.34.10.798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.McDonald-McGinn DM, LaRossa D, Goldmuntz E, Sullivan K, Eicher P, Gerdes M, Moss E, Wang P, Solot C, Schultz P, Lynch D, Bingham P, Keenan G, Weinzimer S, Ming JE, Driscoll D, Clark BJ, 3rd, Markowitz R, Cohen A, Moshang T, Pasquariello P, Randall P, Emanuel BS, Zackai EH. The 22q11.2 deletion: screening, diagnostic workup, and outcome of results; report on 181 patients. Genet Test. 1997;1:99–108. doi: 10.1089/gte.1997.1.99. [DOI] [PubMed] [Google Scholar]
  • 16.Goldmuntz E, Clark BJ, Mitchell LE, Jawad AF, Cuneo BF, Reed L, McDonald-McGinn D, Chien P, Feuer J, Zackai EH, Emanuel BS, Driscoll DA. Frequency of 22q11 deletions in patients with conotruncal defects [see comments] J Am Coll Cardiol. 1998;32:492–498. doi: 10.1016/s0735-1097(98)00259-9. [DOI] [PubMed] [Google Scholar]
  • 17.McElhinney DB, Clark BJ, 3rd, Weinberg PM, Kenton ML, McDonald-McGinn D, Driscoll DA, Zackai EH, Goldmuntz E. Association of chromosome 22q11 deletion with isolated anomalies of aortic arch laterality and branching. J Am Coll Cardiol. 2001;37:2114–2119. doi: 10.1016/s0735-1097(01)01286-4. [DOI] [PubMed] [Google Scholar]
  • 18.McElhinney DB, Driscoll DA, Levin ER, Jawad AF, Emanuel BS, Goldmuntz E. Chromosome 22q11 deletion in patients with ventricular septal defect: frequency and associated cardiovascular anomalies. Pediatrics. 2003;112:e472. doi: 10.1542/peds.112.6.e472. [DOI] [PubMed] [Google Scholar]
  • 19.Pierpont ME, Basson CT, Benson DW, Jr, Gelb BD, Giglia TM, Goldmuntz E, McGee G, Sable CA, Srivastava D, Webb CL. Genetic basis for congenital heart defects: current knowledge: a scientific statement from the American Heart Association Congenital Cardiac Defects Committee, Council on Cardiovascular Disease in the Young: endorsed by the American Academy of Pediatrics. Circulation. 2007;115:3015–3038. doi: 10.1161/CIRCULATIONAHA.106.183056. [DOI] [PubMed] [Google Scholar]
  • 20.Shaw GM, Zhu H, Lammer EJ, Yang W, Finnell RH. Genetic variation of infant reduced folate carrier (A80G) and risk of orofacial and conotruncal heart defects. Am J Epidemiol. 2003;158:747–752. doi: 10.1093/aje/kwg189. [DOI] [PubMed] [Google Scholar]
  • 21.Pei L, Zhu H, Zhu J, Ren A, Finnell RH, Li Z. Genetic variation of infant reduced folate carrier (A80G) and risk of orofacial defects and congenital heart defects in China. Ann Epidemiol. 2006;16:352–356. doi: 10.1016/j.annepidem.2005.02.014. [DOI] [PubMed] [Google Scholar]
  • 22.Shaw GM, Iovannisci DM, Yang W, Finnell RH, Carmichael SL, Cheng S, Lammer EJ. Risks of human conotruncal heart defects associated with 32 single nucleotide polymorphisms of selected cardiovascular disease-related genes. Am J Med Genet A. 2005;138:21–26. doi: 10.1002/ajmg.a.30924. [DOI] [PubMed] [Google Scholar]
  • 23.Hobbs CA, James SJ, Parsian A, Krakowiak PA, Jernigan S, Greenhaw JJ, Lu Y, Cleves MA. Congenital heart defects and genetic variants in the methylenetetrahydroflate reductase gene. J Med Genet. 2006;43:162–166. doi: 10.1136/jmg.2005.032656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Vollset SE, Botto L. Neural tube defects, other congenital malformations and single nucleotide polymorphisms in the 5,10 methylenetetrahydrofolate reductase (MTHFR) gene. In: Ueland PM, editor. MTHFR Polymorphisms and Disease. Landes Bioscience; 2005. [Google Scholar]
  • 25.Siwik ES, Erenberg F, Zahka KG. Tetralogy of Fallot. In: Allen HD, Driscoll DJ, Shaddy RE, Feltes TF, editors. Moss and Adams' Heart Disease in Infants, Children, ad Adolescents. Vol. 2. Philadelphia: Lippincott Williams and Wilkins; 2008. pp. 888–910. [Google Scholar]
  • 26.Botto LD, Khoury MJ, Mulinare J, Erickson JD. Periconceptional multivitamin use and the occurrence of conotruncal heart defects: results from a population-based, case-control study. Pediatrics. 1996;98:911–917. [PubMed] [Google Scholar]
  • 27.Czeizel AE. Reduction of urinary tract and cardiovascular defects by periconceptional multivitamin supplementation. Am J Med Genet. 1996;62:179–183. doi: 10.1002/(SICI)1096-8628(19960315)62:2<179::AID-AJMG12>3.0.CO;2-L. [DOI] [PubMed] [Google Scholar]
  • 28.Botto LD, Mulinare J, Erickson JD. Occurrence of congenital heart defects in relation to maternal mulitivitamin use. Am J Epidemiol. 2000;151:878–884. doi: 10.1093/oxfordjournals.aje.a010291. [DOI] [PubMed] [Google Scholar]
  • 29.Canfield MA, Collins JS, Botto LD, Williams LJ, Mai CT, Kirby RS, Pearson K, Devine O, Mulinare J. Changes in the birth prevalence of selected birth defects after grain fortification with folic acid in the United States: findings from a multi-state population-based study. Birth Defects Res A Clin Mol Teratol. 2005;73:679–689. doi: 10.1002/bdra.20210. [DOI] [PubMed] [Google Scholar]
  • 30.Gellekink H, Blom HJ, van der Linden IJ, den Heijer M. Molecular genetic analysis of the human dihydrofolate reductase gene: relation with plasma total homocysteine, serum and red blood cell folate levels. Eur J Hum Genet. 2007;15:103–109. doi: 10.1038/sj.ejhg.5201713. [DOI] [PubMed] [Google Scholar]
  • 31.Weinberg CR, Wilcox AJ, Lie RT. A log-linear approach to case-parent-triad data: assessing effects of disease genes that act either directly or through maternal effects and that may be subject to parental imprinting. Am J Hum Genet. 1998;62:969–978. doi: 10.1086/301802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Vermunt JK. LEM: a general program for the analysis of categorical data. Tilberg University; 1997. [Google Scholar]
  • 33.Gjessing HK, Lie RT. Case-parent triads: estimating single- and double-dose effects of fetal and maternal disease gene haplotypes. Ann Hum Genet. 2006;70:382–396. doi: 10.1111/j.1529-8817.2005.00218.x. [DOI] [PubMed] [Google Scholar]
  • 34.Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society Series B (Methodological) 1995;57:289–300. [Google Scholar]
  • 35.Mitchell LE, Weinberg CR. Evaluation of offspring and maternal genetic effects on disease risk using a family-based approach: the “pent” design. Am J Epidemiol. 2005;162:676–685. doi: 10.1093/aje/kwi249. [DOI] [PubMed] [Google Scholar]
  • 36.van Beynum IM, Kouwenberg M, Kapusta L, den Heijer M, van der Linden IJ, Daniels O, Blom HJ. MTRR 66A>G polymorphism in relation to congenital heart defects. Clin Chem Lab Med. 2006;44:1317–1323. doi: 10.1515/CCLM.2006.254. [DOI] [PubMed] [Google Scholar]
  • 37.Verkleij-Hagoort AC, van Driel LM, Lindemans J, Isaacs A, Steegers EA, Helbing WA, Uitterlinden AG, Steegers-Theunissen RP. Genetic and lifestyle factors related to the periconception vitamin B12 status and congenital heart defects: a Dutch case-control study. Mol Genet Metab. 2008;94:112–119. doi: 10.1016/j.ymgme.2007.12.002. [DOI] [PubMed] [Google Scholar]
  • 38.Doolin MT, Barbaux S, McDonnell M, Hoess K, Whitehead AS, Mitchell LE. Maternal genetic effects, exerted by genes involved in homocysteine remethylation, influence the risk of spina bifida. Am J Hum Genet. 2002;71:1222–1226. doi: 10.1086/344209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mostowska A, Hozyasz KK, Jagodzinski PP. Maternal MTR genotype contributes to the risk of non-syndromic cleft lip and palate in the Polish population. Clin Genet. 2006;69:512–517. doi: 10.1111/j.1399-0004.2006.00618.x. [DOI] [PubMed] [Google Scholar]
  • 40.Galdieri LC, Arrieta SR, Silva CM, Pedra CA, D’Almeida V. Homocysteine concentrations and molecular analysis in patients with congenital heart defects. Arch Med Res. 2007;38:212–218. doi: 10.1016/j.arcmed.2006.09.012. [DOI] [PubMed] [Google Scholar]
  • 41.Li Y, Cheng J, Zhu WL, Dao JJ, Yan LY, Li MY, Li SQ. Study of serum Hcy and polymorphisms of Hcy metabolic enzymes in 192 families affected by congenital heart disease. Beijing Da Xue Xue Bao. 2005;37:75–80. [PubMed] [Google Scholar]
  • 42.Song XM, Zheng XY, Zhu WL, Huang L, Li Y. Relationship between polymorphism of cystathionine beta synthase gene and congenital heart disease in Chinese nuclear families. Biomed Environ Sci. 2006;19:452–456. [PubMed] [Google Scholar]
  • 43.van Beynum IM, den Heijer M, Blom HJ, Kapusta L. The MTHFR 677C->T polymorphism and the risk of congenital heart defects: a literature review and meta-analysis. Qjm. 2007;100:743–753. doi: 10.1093/qjmed/hcm094. [DOI] [PubMed] [Google Scholar]
  • 44.Storti S, Vittorini S, Lascone MR, Sacchelli M, Collavoli A, Ripoli A, Cocchi G, Biagini A, Clerico A. Association between 5,10-methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and conotruncal heart defects. Clin Chem Lab Med. 2003;41:276–280. doi: 10.1515/CCLM.2003.043. [DOI] [PubMed] [Google Scholar]
  • 45.McBride KL, Fernbach S, Menesses A, Molinari L, Quay E, Pignatelli R, Towbin JA, Belmont JW. A family-based association study of congenital left-sided heart malformations and 5,10 methylenetetrahydrofolate reductase. Birth Defects Res A Clin Mol Teratol. 2004;70:825–830. doi: 10.1002/bdra.20049. [DOI] [PubMed] [Google Scholar]
  • 46.Nurk E, Tell GS, Refsum H, Ueland PM, Vollset SE. Associations between maternal methylenetetrahydrofolate reductase polymorphisms and adverse outcomes of pregnancy: the Hordaland Homocysteine Study. Am J Med. 2004;117:26–31. doi: 10.1016/j.amjmed.2004.01.019. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp1

RESOURCES