Skip to main content
PMC home page
Genetics and Molecular Biology logoLink to Genetics and Molecular Biology
. 2009 Sep 1;32(3):568–571. doi: 10.1590/S1415-47572009005000056

Transferability and characterization of microsatellite markers in two Neotropical Ficus species

Alison Gonçalves Nazareno *, Rodrigo Augusto Santinelo Pereira 2, Juliana Massimino Feres 3, Moacyr Antônio Mestriner 3, Ana Lilia Alzate-Marin 3,✉
PMCID: PMC3036046  PMID: 21637521

Abstract

Microsatellite markers were transferred and characterized for two Neotropical fig tree species, Ficus citrifolia and Ficus eximia. Our study demonstrated that microsatellite markers developed from different subgenera of Ficus can be transferred to related species. In the present case, 12 of the 15 primer pairs tested (80%) were successfully transferred to both of the above species. Eleven loci were polymorphic when tested across 60 F. citrifolia and 60 F. eximia individuals. For F. citrifolia, there were 4 to 15 alleles per locus, whereas expected heterozygosities ranged from 0.31 to 0.91. In the case of F. eximia, this was 2 to 12 alleles per locus and expected heterozygosities from 0.42 to 0.87.

Keywords: ecological genetics, Ficus citrifolia, Ficus eximia, Moraceae, SSRs

Effective strategies for the conservation of genetic resources in tropical forests are of great importance, mainly due to the negative impacts arising from the reduction in biological diversity. This is especially true with regard to ecologically important species such as fig trees (Ficus species, family Moraceae), which are considered to be keystone- resources in tropical forests, through supplying frugivores with fruit during periods of food-scarcity (Shanahan et al., 2001). Furthermore, plants of the genus Ficus are considered as a classic example of plant-insect mutualism (Weiblen, 2002). With few exceptions, each of the 750 Ficus species maintains an obligatory symbiotic interaction with a specific pollinating wasp species (Hymenoptera: Agaonidae). However, little is known about the genetic diversity and population structure of Ficus species (Dick et al., 2008). Microsatellite markers (simple sequence repeats - SSR) are informative tools used to assess the genetic structure of populations as well as basic quantitative genetic parameters. Although microsatellite markers constitute informative systems for ecological genetics, they have only been isolated for seven of the 750 species of Ficus (Khadari et al., 2001; Giraldo et al., 2005; Zavodna et al., 2005; Vignes et al., 2006; Ahmed et al., 2007; Bandelj et al., 2007; Crozier et al., 2007). Nevertheless, the high transferability of these markers has allowed for cross amplification in 47 Ficus species (Khadari et al., 2001; Giraldo et al., 2005; Vignes et al., 2006). Moreover, indications of high transferability within a particular genus has also come to light from other areas of research (Poncet et al., 2004; Moon et al., 2008). Given the time consuming and relatively costly process of isolating microsatellites and the low frequency of SSRs in plants (Powell et al., 1996), it is a decided advantage to be able to utilize primer sequences identified in one species in other closely related ones. Here, we examine the transferability and the characterization of microsatellite markers previously developed from different subgenera of Ficus for two species occurring in Brazil, Ficus citrifolia P. Miller and Ficus eximia Schott.

The subgenus Urostigma section Americana, to which F. citrifolia and F. eximia belong, includes monoecious plants that may occur as trees of hemi-epiphyte growth form (Berg, 1989). Ficus citrifolia normally grows as a hemiepiphyte on other trees or buildings and frequently develops within disturbed areas. Ficus eximia usually germinates on fallen trunks and grows as a free-standing tree in humid patches in the forest. During January and February, 2008, we sampled 120 individuals from two natural populations (30 individuals per area per species), 350 km apart, located at the Parque Estadual Morro do Diabo (22° 27' - 22° 40' S, 52° 10' - 52° 22' W) and at the Estação Ecológica de Caetetus (22° 41' - 22° 46' S, 49° 10' - 49° 16' W), both in southeastern Brazil.

DNA for microsatellite analysis was extracted from frozen leaves by using the cetyltrimethyl ammonium bromide (CTAB) extraction method (Doyle and Doyle, 1990). Fifteen microsatellite loci, previously developed for Ficus (Pharmacosycea) insipida (Vignes et al., 2006), Ficus (Sycomorus) racemosa and Ficus (Urostigma) rubiginosa (Crozier et al., 2007), were tested for cross amplification in specimens of F. citrifolia and F. eximia. Using polymerase chain reaction (PCR), a screening of each primer pair through ten annealing temperatures (between 46-55 °C) was accomplished with 10 individuals of F. citrifolia and F. eximia. Microsatellite loci were amplified in a final volume of 10 μL containing 0.3 μM of each primer, 1 U Taq DNA polymerase, 0.25 mM of each dNTP, 1 x MgCl2-free reaction buffer [75 mM Tris-HCl pH 9.0, 50 mM KCl and 20 mM (NH4)2SO4], 1.5 mM MgCl2 and 2.5 ng of template DNA. The amplification was performed using a MasterCycler Eppendorf under the following conditions: 5 min of denaturation at 96 °C and 30 cycles of 30 s of initial denaturation at 94 °C, 1 min of annealing at Ta (Table 1) and 1 min of extension at 72 °C, to finish with 7 min of elongation at 72 °C. Amplified fragments were separated on 10% denaturing polyacrylamide gels in 8 M urea and 1 x TBE buffer, to then be stained with silver nitrate (Sanguinetti et al., 1994). The quantification of allele size was scored against a 10 bp DNA ladder standard (Invitrogen).

Table 1.

Transferability and characterization of Ficus insipida (prefix Fins)1, Ficus racemosa (prefix Frac)2 and Ficusrubiginosa (prefix Frub)2 microsatellite loci in 60 Ficus citrifolia and 60 Ficuseximia individuals from two populations in southeastern Brazil.

Locus accession n. Primer sequence 5'-3' Repeat motif Size range (bp) Characterization of microsatellite markers
Ficus citrifolia
 Ficus eximia
bpO Na Ta HO/hE Pe bpO Na Ta HO/hE Pe
FinsN1 F: AGGGCTGAGATAGGTTGATT (TA)2(CA)10(TA)7 150-160 151-160 4 50 0.93/0.68- 0.248 158-164 4 49 0.93/0.66- 0.231
AM039805 R: TAAGTTGGTGTGTGGCATC CATA(TG)2
FinsT7 F: GAATCTGGAGGTGGAATAAAC (TA)11(TG)16 193-210 172-182 5 46 0.17/0.31- 0.051 178 1 50 * -
AM039810 R: AAAGATCGCTCGTCAACC
FinsU9 F: CGTGTATTGATGTGTGTGTG (AG)16 148-156 - - - - - - - - - -
AM039811 R: TCACCTCCTCCTTCTTTTG
Frac86 F: TGTCACTGTTCTGTTTGTGC (TC)13(CA)10 153-167 166-196 15 46 0.90/0.91 0.662 162-178 8 50 0.25/0.83- 0.466
DQ659281 R: CAGCCAACCCTCAAGTATAAGA
Frac110 F: CCAGAACAGGTTGGACGTAAC (CA)13 166-172 - - - - - - - - - -
DQ659282 R: GGATTACCCGCGCTATGAAGT
Frac154 F: ACCCAAGAGCCCAAACTCGT (AC)13 147-151 140 1 48 * - 144-159 6 48 1.00/0.78- 0.380
DQ659284 R: TCAACCCTTGTGCTCCTTGC
Frub29 F: CCACTTTGGAATGTCACTTGGA (AG)24 188-226 186-228 8 48 0.73/0.78 0.399 195-255 12 50 0.72/0.87- 0.577
DQ659290 R: TGAACACGCCAACTGAGAATG
Frub38 F: ACACGTGCAGTGCTGCTGA (AG)8AAC(GA)13 195-255 190-220 6 50 0.67/0.77 0.359 192-222 7 49 0.36/0.78- 0.383
DQ659291 R: ACAGCTGCCCAATTCCTTGA
Frub61 F: GTACACTCTCTTAGCTGCC (TC)24 145-188 130-178 12 50 0.55/0.82- 0.468 120-165 11 50 0.64/0.87- 0.561
DQ659292 R: GTACACTCTCTTAGCTGCC
Frub93 F: TATTTCAATAACATCTCCTCAAC (GA)11 106-136 - - - - - - - - - -
DQ659293 R: TACGTTTGTTATGGACTTTGGC
Frub391 F: AGATGTCAAATAAGGTCAGCT (TG)19 149-173 136-158 9 49 0.46/0.83- 0.485 140-156 5 50 0.95/0.77- 0.352
Q659294 R: AGATGCAGTTCCATACAATTC
Frub415 F: GCACGTAGTCGGTGTTAAGC (AC)10 150-173 132-156 4 50 0.58/0.54 0.141 158-164 2 48 0.39/0.42 0.087
DQ659297 R: CTGTGCGGAATAAAAGCTAGC
Frub416 F: CAGCAATGATCTTGACCT (CA)14 (CA)8 228-246 212-232 6 49 1.00/0.79- 0.391 215-230 4 49 0.93/0.64- 0.216
DQ 659289 R:ACTCATCAATATCTCTAAACAAC
Frub422 F: GCGTGAAATTTATGCTATGA (AC)18 172-190 155-176 8 49 0.48/0.80- 0.426 156-170 8 49 0.70/0.79 0.407
DQ 659298 R: GTTTCGTTCAATTTGAGTGC
Frub436 F: GTACTGTGATTAGTATCTTTGA (AC)22 135-159 133-178 9 48 0.55/0.83- 0.478 148-188 9 48 0.53/0.82- 0.462
DQ 659299 R CTAGCAATAACTCACTGATATTG
Sum1/Average2/Cumulative probability of exclusion3 871/7.32 0.582/0.672 0.9963 771/6.42 0.622/0.692 0.9953
Open in a new tab

1, Vignes et al. 2006; 2, Crozier et al. 2007; size range (bp), original data for species for which primers were developed; bpO, observed size range; Na number of alleles; Ta, annealing temperature (°C); HO, observed heterozygosity; HE, expected heterozygosity; Pe, paternity exclusion probability; *, FinsT7 and Frac154 were monomorphic in just one of the species; -, statistically significant deviation from Hardy-Weinberg equilibrium (p < 0.05).

Genetic diversity parameters and probabilities of paternity exclusion were estimated using CERVUS version 3.0 (Kalinowski et al., 2007). The FSTAT software package version 1.2 (Goudet, 2001) was used to test all loci for linkage disequilibrium, with application of Bonferroni correction for multiple comparisons.

Our study demonstrated that microsatellite markers developed from different subgenera of Ficus can be transferred to related species. We successfully transferred 12 of the 15 primer pairs tested (80%) to both of the species, F. citrifolia and F. eximia (Table 1). Similar allele numbers and length of amplification products were apparent in most of the successful loci, when compared with the species from which they were developed (Table 1). Of the 12 loci transferred, 11 were polymorphic for both F. citrifolia and F. eximia. Loci FinsT7 and Frub154 were monomorphic in only one species. Eighty-seven F. citrifolia and 77 F. eximia allelic variants were identified (Table 1). Furthermore, the average for heterozygosity and the mean number of alleles per loci were, respectively, 0.67 and 7.3 in F. citrifolia and 0.69 and 6.4 in F. eximia. Heterozygosity values of F. citrifolia and F. eximia in this study were within those for Ficus species reported in previous studies (Bandelj et al., 2007; Crozier et al., 2007). The level of heterozygosity found in a population is highly dependent on the mating system and the evolutionary history of the species, besides a range of other factors. Although various microsatellite markers and sample sizes have been used in diversity studies on Ficus species, these same values made it possible for us to assume the present status of genetic variability due to the mating system and plant-insect mutualism. Pollen and diaspores in Ficus species are dispersed over long distances (Kinnaird et al., 1996; Nason et al., 1996), thereby implying that the flight distance of pollinators and dispersal range might predict high levels of genetic variation in these species (Hamrick and Loveless, 1989; Epperson and Alvarez-Buylla, 1997; Nazareno and Carvalho, 2008).

There were significant deviations from Hardy-Weinberg equilibrium (HWE) in seven F. citrifolia loci. As to F. eximia, nine loci were not in HWE (Table 1). Either the intrapopulation substructure produced by the sampling effect or the presence of null alleles may have caused these deviations, since analyses at the population level showed deviations from HWE for these same loci. Furthermore, as these results were obtained by using microsatellites developed in another species, the probability of a null allele occurring would be much higher than in the case of testing in the species from which they were isolated (Kim et al., 2004). In future studies, the influence of null alleles on the transferability of microsatellite markers and their applicability in other species should be investigated.

The chi-square test for the independent segregation hypothesis indicated that all loci for F. citrifolia were in linkage equilibrium. As to F. eximia, however, significant linkage disequilibrium was found for the loci Frub38 and Frub415. The combined values for probabilities of paternity exclusion in all the 11 polymorphic loci were 0.996 for F. citrifolia and 0.995 for F. eximia. Using the 11 polymorphic loci enabled us to distinguish all the 60 F. citrifolia and 60 F. eximia individuals in two populations from southeastern Brazil. Hence, transferred microsatellite markers should allow for detailed parentage studies in natural populations, even in situations where both maternity and paternity are unknown. Moreover, these microsatellite loci could be highly useful for providing data on population genetics.

The high transferability of microsatellite markers developed from different subgenera of Ficus for F. citrifolia and F. eximia confirm the general applicability of Ficus microsatellite primers to this very large genus. Currently, we are using these markers to investigate the impact of tropical deforestation on population structure and genetic diversity in forest fragments in the Atlantic Rain Forest sensu lato, where F. citrifolia and F. eximia are native.

Acknowledgments

We thank the Instituto Florestal for permitting this research (ref. # 43.487/2007) and for the use of the facilities in protected areas. This study was supported by grants from FAPESP (R.A.S.P #04/10299-4, A.L.A.M. #03/04199-4/2004) the Provost for Research of Sao Paulo University (A.L.A.M.) and FAEPA (M.A.M.). A.G.N. was supported by a fellowship from CAPES and J.M.F. from FAPESP (#2006/05152-0). The authors thank Marcela Corbo Guidugli for technical support on microsatellite analyses and the anonymous referees for their useful comments on a previous version of the manuscript.

Footnotes

Associate Editor: Márcio de Castro Silva Filho

References

  1. Ahmed S., Dawson D.A., Compton S.G., Gilmartin P.M. Characterization of microsatellite loci in the African fig Ficus sycomorus L. (Moraceae) Mol Ecol Notes. 2007;7:1175–1177. [Google Scholar]
  2. Bandelj D., Javornik B., Jakse J. Development of microsatellite markers in the common fig, Ficus carica L. Mol Ecol Notes. 2007;7:1311–1314. [Google Scholar]
  3. Berg C.C. Classification and distribution of Ficus. Experientia. 1989;45:605–611. [Google Scholar]
  4. Crozier Y.C., Jia X.C., Yao J.Y., Field A.R., Cook J.M. Microsatellite primers for Ficus racemosa and Ficus rubiginosa. Mol Ecol Notes. 2007;7:57–59. [Google Scholar]
  5. Dick C.W., Hardy O.J., Jones F.A., Petit R.J. Spatial scales of pollen and seed-mediated gene flow in tropical rain forest trees. Trop Plant Biol. 2008;1:20–33. [Google Scholar]
  6. Doyle J.J., Doyle J.L. Isolation of plant DNA from fresh tissue. Focus. 1990;12:13–15. [Google Scholar]
  7. Epperson B.K., Alvarez-Buylla E.R. Limited seed dispersal and genetic structure in life stages of Cecropia obtusifolia. Evolution. 1997;51:275–282. doi: 10.1111/j.1558-5646.1997.tb02409.x. [DOI] [PubMed] [Google Scholar]
  8. Giraldo E., Viruel M.A., López-Corrales M., Hormaza J.I. Characterization and cross-species transferability of microsatellites in the common fig (Ficus carica L. ) J Hortic Sci Biotechnol. 2005;80:217–224. [Google Scholar]
  9. Goudet J. FSTAT, v. 1.2: A computer program to calculate F-statistics. Heredity. 2001;86:485–486. [Google Scholar]
  10. Hamrick J.L., Loveless M.D. The genetic structure of tropical tree populations: Associations with reproductive biology. In: Bock J.L., Linhart Y.B., editors. The Evolutionary Ecology of Plants. Boulder: Westview Press; 1989. pp. 129–146. [Google Scholar]
  11. Kalinowski S.T., Taper M.L., Marshall T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007;16:1099–1106. doi: 10.1111/j.1365-294X.2007.03089.x. [DOI] [PubMed] [Google Scholar]
  12. Khadari B., Hochu I., Santoni S., Kjellberg F. Identification and characterization of microsatellite loci in the common fig (Ficus carica L. ) and representative species of the genus Ficus. Mol Ecol Notes. 2001;1:191–193. [Google Scholar]
  13. Kim K.-.S., Min M.-.S., An J.-.H., Lee H. Cross-species amplification of Bovidae microsatellites and low diversity of the endangered Korean Goral. J Hered. 2004;95:521–525. doi: 10.1093/jhered/esh082. [DOI] [PubMed] [Google Scholar]
  14. Kinnaird M.F., O'Brien T.G., Suryadi S. Population fluctuation in Sulawesi Red-Knobbed Hornbills: Tracking figs in space and time. The Auk. 1996;113:431–440. [Google Scholar]
  15. Moon H.S., Nicholson J.S., Lewis R.S. Use of transferable Nicotiana tabacum L. microsatellite markers for investigating genetic diversity in the genus Nicotiana. Genome. 2008;51:547–599. doi: 10.1139/G08-039. [DOI] [PubMed] [Google Scholar]
  16. Nason J.D., Herre E.A., Hamrick J.L. Paternity analysis of the breeding structure of strangler fig populations: Evidence for substantial long-distance wasp dispersal. J Biogeogr. 1996;23:501–512. [Google Scholar]
  17. Nazareno A.G., Carvalho D. What the reasons for no inbreeding and high genetic diversity of the neotropical fig tree? Conserv Genet. 2008 (DOI 10.1007/s10592-008-9776-x) [Google Scholar]
  18. Poncet V., Hamon P., Minier J., Carasco C., Hamon S., Noirot M. SSR cross-amplification and variation within coffe trees (Coffea spp. ) Genome. 2004;47:1071–1081. doi: 10.1139/g04-064. [DOI] [PubMed] [Google Scholar]
  19. Powell W., Machray G.C., Provan J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci. 1996;1:215–222. [Google Scholar]
  20. Sanguinetti C.J., Dias E.N., Simpson A.J.G. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechnology. 1994;17:914–921. [PubMed] [Google Scholar]
  21. Shanahan M., Compton S.G., So S., Corlett R. Fig-eating by vertebrate frugivores: A global review. Biol Rev. 2001;76:529–572. doi: 10.1017/s1464793101005760. [DOI] [PubMed] [Google Scholar]
  22. Vignes H., Hossaert-McKey M., Beaune D., Fevre D., Anstett M.C., Borges R.M., Kjellberg F., Chevallier M.H. Development and characterization of microsatellite markers for a monoecious Ficus species, Ficus insipida, and cross-species amplification among different sections of Ficus. Mol Ecol Notes. 2006;6:792–795. [Google Scholar]
  23. Weiblen G.D. How to be a fig wasp. Annu Rev Entomol. 2002;47:299–330. doi: 10.1146/annurev.ento.47.091201.145213. [DOI] [PubMed] [Google Scholar]
  24. Zavodna M., Arens P., Van Dijk P.J., Vosman B. Development and characterization of microsatellite markers for two dioecious Ficus species. Mol Ecol Notes. 2005;5:355–357. [Google Scholar]

Articles from Genetics and Molecular Biology are provided here courtesy of Sociedade Brasileira de Genética

RESOURCES