Skip to main content
NCBI home page
Genetics and Molecular Biology logoLink to Genetics and Molecular Biology
. 2010 Sep 1;33(3):578–582. doi: 10.1590/S1415-47572010000300032

Analysis of the association between spawning time QTL markers and the biannual spawning behavior in rainbow trout (Oncorhynchus mykiss)

Nelson Colihueque 1,✉, Rosy Cárdenas 1, Lorena Ramírez 1, Francisco Estay 2, Cristian Araneda 3
PMCID: PMC3036128  PMID: 21637435

Abstract

The rainbow trout is a salmonid fish that occasionally exhibits broodstocks with biannual spawning behavior, a phenomenon known as a double annual reproductive cycle (DARC). Spawning time quantitative trait loci (SPT-QTLs) affect the time of the year that female rainbow trout spawn and may influence expression of the DARC trait. In this study, microsatellite markers linked and unlinked to SPT-QTLs were genotyped to investigate the underlying genetics of this trait. SPT-QTLs influenced the DARC trait since in two case-control comparisons three linked markers (OmyFGT12TUF, One3ASC and One19ASC) had significant levels of allelic frequency differentiation and marker-character association. Furthermore, alleles of One3ASC and One19ASC had significantly higher frequencies in populations that carried the DARC trait.

Keywords: association analysis, biannual spawning, microsatellite markers, rainbow trout

Some rainbow trout (Oncorhynchus mykiss) broodstocks spawn twice a year, an unusual phenomenon known as the double annual reproductive cycle (DARC) or biannual spawning behavior (Hume, 1955; Aida et al., 1984; Gall and Crandell, 1992). The two spawnings occur at regular intervals of approximately six months: the first during a normal reproductive cycle and the second during an additional reproductive cycle. Only a fraction of the females that spawn during the normal cycle experience a second spawning (Aida et al., 1984). Broodstocks that carry the DARC trait have been the subject of various reproductive studies (Aida et al., 1984; Lou et al. 1984; Tazaki et al., 1993; Takano et al., 1995), although the underlying genetics of this trait remain largely unknown. Another reproductive trait possibly related to DARC in rainbow trout is known as spawning time (SPT) (Siitonen and Gall, 1989). This trait influences the time of year that females spawn and is controlled by numerous quantitative trait loci (QTLs) (Sakamoto et al., 1999; Fishback et al., 2000; O'Malley et al., 2003). Several markers closely linked to these chromosomal segments have been described. We propose that the underlying genetics of the DARC character in rainbow trout is similar to that of the SPT trait since both are related to the time of year when breeders spawn. To test this hypothesis, we undertook a marker-character association analysis for the DARC trait based on a panel of microsatellite markers closely linked to SPT-QTLs in rainbow trout.

Two broodstocks, Wytheville 02 (Wt-02, n = 52) and Wytheville 05 (Wt-05, n = 28) with a DARC trait frequency of 14%-35%, were used. The control stock, Steelhead (Sh, n = 35), had no DARC trait. These broodstocks were obtained from Piscicola Huililco Ltda., a commercial fish hatchery in southern Chile (39°28'04” S, 71°49'56” W). The DARC character was detected in this hatchery in 2001 in specimens that displayed this trait spontaneously. In these individuals, the DARC trait was characterized by a normal reproductive cycle (March-July; spring spawning) and an additional reproductive cycle (September-December; spring spawning). Blood samples were collected from a caudal vein and DNA was extracted by the phenol-chloroform method, as previously described (Taggart et al., 1992).

Five microsatellite markers linked to SPT-QTLs (OmyFGT12TUF, One3ASC, One19ASC, One112ADFG and Ssa103NVH) and four microsatellite markers not linked to these chromosomal regions (OmyFGT14TUF, OmyFGT15TUF, Omy27DU, Omy207UoG) were used (Table 1). The selected linked markers belonged to three different linkage groups in which a strong effect of QTLs on the SPT trait has been observed with significant association (p < 0.05) (Sakamoto et al., 1999; Fishback et al., 2000; O'Malley et al., 2003): One19ASC in linkage group OA-XXIV, One3ASC and Ssa103NVH in linkage group OA-XIX and One112ADFG in linkage group OA-VIII (Nichols et al., 2003) (Figure 1). The selected unlinked markers belonged to linkage groups that were different from those of the selected linked markers (OmyFGT14TUF in linkage group OA-X, Omy27DU in linkage group OA-II and Omy207UoG in linkage group OA-VIII) (Sakamoto et al., 1999, 2000; O'Malley et al., 2003) in which no association with SPT-QTL has been reported (Sakamoto et al., 1999; O'Malley et al., 2000). OmyFGT15TUF was considered to be unlinked since although it maps in the linkage group OA-III where a SPT-QTL exists (Sakamoto et al., 1999) there was no significant association with this QTL. The microsatellite markers were genotyped by electrophoresis in 6% polyacrylamide 7 M urea gels after amplification by PCR. The PCR mix consisted of 1 x Taq polymerase buffer, 0.13-0.28 μM of dNTPs, 1.3-2.5 mM MgCl2, 0.26-0.4 μM of each primer, 0.02 U of Taq polymerase/μL (Invitrogen) and 40 ng of template DNA/μL in a final volume of 15 μL. Amplicon size was determined by using a 25 bp DNA standard. The thermal profiles were standardized for each microsatellite based on the annealing temperature of the corresponding primer pair.

Table 1.

Description of the nine microsatellite markers analyzed.

Marker Repeat Primer sequence References (GenBank)* Linkage status to SPT-QTLs#
OmyFGT12TUF (CA)36 F: CAGTGTTGGAACACGTCCTG
R: TTGATTCTTGTGATGAAATCGC		 1 Linked
One3ASC (GA)18 F: TCTCCTTGGTCTCTCTGTCCCTT
R: CTATCAGCCAATCGCATCAGGAC		 2 (AH003601) Linked
One19ASC (CA)33 F: CTGGAAAGCACAGAGAGAGCCTT
R: TCCAACAGTCTAACAGTCTAACCA		 2 (U56719) Linked
One112ADFG (TCTA)28 F: GTGACCCAGACTCAGAGGAC
R: CACAACCCATCACATGAAAC		 3 (AF274528) Linked
Ssa103NVH (CA)4 AA (CA)14 F: GCTGTGATTTCTCTCTGC
R: AAAGGTGGGTCCAAGGAC		 4 (AF256746) Linked
OmyFGT14TUF (CA)10 F: TGAGACTCAACAGTGACCGC
R: AGAGGGTTACACATGCACCC		 1 Unlinked
OmyFGT15TUF (GT)8 F: ATAGTTTCCACTGCCGATGC
R: GGTACACACAGCTTGATTGCA		 1 Unlinked
Omy27DU F: TTTATGTCATGTCAGCCAGTG
R: TTTATGTCATGTCAGCCAGTG		 5 Unlinked
Omy207UoG (GT)31 F: ACCCTAGTCATTCAGTCAGG
R: GATCACTGTGATAGACATCG		 6 Unlinked
Open in a new tab

*1. T Sakamoto, PhD Thesis, Tokyo University of Fisheries, Tokyo, Japan (1996), 2. Scribner et al. (1996), 3. Olsen et al. (2000), 4. Norwegian Veterinary Hospital, 5. Hologene Inc., Halifax, Nova Scotia, Canada, 6. O'Connell et al. (1997). #According to Sakamoto et al. (1999), Fishback et al. (2000) and O'Malley et al. (2003).

Figure 1.

Figure 1

Open in a new tab

Map positions of the markers linked to spawning time QTLs used in this work (indicated in bold). The map distance (in centiMorgans) between adjacent markers is shown on the left. The locations of the spawning time QTLs (SPT-QTLs) are indicated by solid bars. Each linkage group was defined as proposed by Nichols et al. (2003). Linkage data were obtained from Sakamoto et al. (1999) and O'Malley et al. (2003).

The extent of genetic association was assessed by determining the degree of: a) interpopulation genetic differentiation based on differences in the allele frequency using the Fisher exact test, with a Markov Chain Monte Carlo approach that provided an estimate of the exact probability (Raymond and Rousset, 1995), b) interpopulation genetic divergence, using the Wright (1965) FST and Nei (1972) Ds genetic distance indexes, and c) marker-trait associations using the LD statistic (Choulakian and Mahdi, 2000; Araneda et al., 2009). Further analysis assessed and corrected the population stratification (Pritchard and Rosenberg, 1999; Devlin and Roeder, 1999). The latter analysis served to identify possible spurious associations generated by stratification of the samples and was based on the use of unlinked markers to calculate the lambda factor (λ mean); this factor was subsequently used to correct the statistical significance of the linked marker through the χ2 value in a contingency test. All genetic analyses were done using GDA version 1.1 (Lewis and Zaykin, 2001) and TFPGA version 1.3 (Miller, 1997) software packages. Map positions for markers linked to SPT-QTLs were drawn using MapChart software version 2.1 (Voorrips, 2002).

Table 2 summarizes the results of the foregoing analyses. Comparison of Wt-02 with Sh (comparison 1) and Wt-05 with Sh (comparison 2) stocks revealed four linked microsatellites (OmyFGT12TUF, One3ASC, One19ASC and One112ADFG) with significant allelic differentiation (p < 0.05) in the Fisher exact test. In addition, two unlinked markers (OmyFGT15 and Omy207UoG) also showed significant allelic differentiation. The linked markers showed higher genetic divergence than those without allelic heterogeneity (comparison 1: Ds = 0.039-0.555 vs. 0.022-0.144, FST = 0.015-0.111 vs. 0.012-0.026; comparison 2: Ds = 0.054-0.847 vs. 0.070-0.077, FST = 0,024-0.149 vs. 0.025-0.039). Association analysis (LD) was only significant (p < 0.0002) for microsatellites linked to SPT-QTLs, two each in the first (OmyFGT12TUF and One3ASC) and second (OmyFGT12 and One19ASC) comparisons. These markers had alleles with a significantly higher representation in one of the two populations in each comparison, particularly the 175 bp allele of OmyFGT12 (Wt-02 = 17.1% vs. Sh = 66.7%; Wt-05 = 20% vs. Sh = 66.7%), the 203 bp allele of One3ASC (Wt-02 = 43.8% vs. Sh = 2.1%) and the 127 bp allele of One19ASC (Wt-05 = 63% vs. Sh = 18%) (Figure 2). Evaluation of comparisons 1 and 2 using the four unlinked markers showed that both comparisons had a significant level of stratification (comparison 1: χ2 = 55.346, DF = 25, p < 0.05; comparison 2: χ2 = 66.912, DF = 20, p < 0.05). The stratification correction obtained by applying the lambda factor (λ mean, calculated according to Devlin and Roeder (1999)) showed that two linked markers in comparison 1 (One3ASC and One112ADFG) and one linked marker in comparison 2 (One19ASC) were significantly associated with the DARC trait (p < 0.05) (Table 3). In this correction, an unlinked marker with high allelic frequency differentiation (Omy207UoG) was excluded to avoid compromising the corrective capacity of the method (Shmulewitz et al., 2004).

Table 2.

Association analysis between spawning time QTL markers and the double annual reproductive cycle trait in rainbow trout.

Comparison/ marker Linkage status to SPT-QTLs Allelic differentiation Genetic divergence
Marker-trait association
p FST DS LD p
1. Wt-02 vs. Sh
OmyFGT12TUF Linked 0.0309* 0.108 0.214 20.959 0.0000**
One3ASC Linked 0.0000* 0.111 0.555 26.525 0.0000**
One19ASC Linked 0.0084 0.026 0.144 8.233 0.0041
One112ADFG Linked 0.0000* 0.015 0.039 7.883 0.0049
Ssa103NVH Linked 0.3225 0.012 0.022 1.229 0.2676
OmyFGT14TUF Unlinked 0.0927 0.005 0.005 5.079 0.0242
OmyFGT15TUF Unlinked 0.1294 0.008 0.018 6.021 0.0141
Omy27DU Unlinked 0.2189 0.013 0.042 2.191 0.1387
Omy207UoG Unlinked 0.0000* 0.041 0.693 3.876 0.0489
2. Wt-05 vs. Sh
OmyFGT12TUF Linked 0.0006* 0.059 0.564 15.496 0.0000**
One3ASC Linked 0.0008* 0.024 0.054 6.915 0.0085
One19ASC Linked 0.0000* 0.149 0.847 21.643 0.0000**
One112ADFG Linked 0.0140 0.025 0.070 9.056 0.0026
Ssa103NVH Linked 0.0650 0.039 0.077 4.323 0.0376
OmyFGT14TUF Unlinked 0.2407 0.015 0.017 1.901 0.1679
OmyFGT15TUF Unlinked 0.0010* 0.026 0.070 8.186 0.0042
Omy27DU Unlinked 0.1743 0.014 0.048 2.216 0.1366
Omy207UoG Unlinked 0.0000* 0.043 0.672 12.716 0.0003
Open in a new tab

* Significant differences in allelic distribution between broodstock groups after Bonferroni correction with a threshold value of p ≤ 0.05. ** Indicate association with spawning time QTL that is considered significant with a threshold value of p < 0.0002 which corresponds to a chi-squared value > 13.8 with one degree of freedom and equivalent to a LOD score > 3.0.

Figure 2.

Figure 2

Open in a new tab

Allelic frequency distributions in the markers One3ASC (a) and One19ASC (b) linked to spawning time QTLs in Wytheville 02 (Wt-02), Wytheville 05 (Wt-05) and Steelhead (Sh) stocks.

Table 3.

Correction for stratification in the association analysis between spawning time QTL markers and the double annual reproductive cycle trait in rainbow trout.

Comparison/ marker Linkage status to SPT-QTLs Contingency test
λ correction for the χ2 value
χ2 p
1. Wt-02 vs. Sh λ = 5.801
OmyFGT12TUF Linked 16.275 0.0386* 2.806
One3ASC Linked 41.536 0.0000* 7.160**
One19ASC Linked 14.483 0.0128* 2.497
One112ADFG Linked 27.926 0.0002* 4.814**
Ssa103NVH Linked 1.229 0.2676 0.212
2. Wt-05 vs. Sh λ = 8.545
OmyFGT12TUF Linked 29.877 0.0002* 3.497
One3ASC Linked 15.516 0.0083* 1.816
One19ASC Linked 52.362 0.0000* 6.128**
One112ADFG Linked 15.110 0.0194* 1.768
Ssa103NVH Linked 4.323 0.0376* 0.506
Open in a new tab

* Significant differences in allelic distribution between broodstock groups with a threshold value of p < 0.05. **Significant differences with a global threshold value of p < 0.05 (χ2 > 3.84).

These results support the hypothesis that SPT-QTLs influence the DARC trait in rainbow trout. The QTLs would be those mapped in linkage groups OA-VIII, OA-XIX and OA-XIV of this species, based on information available for the markers linked to these chromosomal regions (Sakamoto et al., 1999; O'Malley et al., 2003). Further studies involving additional markers, as well as case-control groups without selection bias or stratification, are required to assess the association between microsatellites linked to SPT-QTLs and the DARC trait.

Other strategies that could help to clarify the underlying genetics of the DARC trait include a search for candidate genes (Lam, PhD thesis, Universidad de Chile, Santiago de Chile, 2009) and the mapping of QTLs responsible for expression of the trait using backcrosses in experimental populations. Both of these strategies are currently being used in our laboratory and should provide data that will improve our understanding of the genetics of DARC in rainbow trout.

Acknowledgments

The authors thank Susan Angus for translating the manuscript. This study was financed by FONDECYT Project no. 1060623.

Footnotes

Associate Editor: Fábio de Melo Sene

References

  1. Aida K., Sakai K., Nomura M., Lou S.W., Hanyu I., Tanaka M., Tazaki S., Ohto H. Reproductive activity of a twice annually spawning strain of rainbow trout. Bull Jpn Soc Sci Fish. 1984;50:1165–1172. [Google Scholar]
  2. Araneda C., Lam N., Díaz N., Cortez S., Pérez C., Neira R., Iturra P. Identification, development, and characterization of three molecular markers associated to spawning date in Coho salmon (Oncorhynchus kisutch) Aquaculture. 2009;296:21–26. [Google Scholar]
  3. Choulakian V., Mahdi S. A new statistic for the analysis of association between trait and polymorphic marker loci. Math Biosci. 2000;164:139–145. doi: 10.1016/s0025-5564(00)00010-9. [DOI] [PubMed] [Google Scholar]
  4. Devlin B., Roeder K. Genomic control for association studies. Biometrics. 1999;55:997–1004. doi: 10.1111/j.0006-341x.1999.00997.x. [DOI] [PubMed] [Google Scholar]
  5. Fishback A.G., Danzmann R.G., Ferguson M.M. Microsatellite allelic heterogeneity among hatchery rainbow trout maturing in different seasons. J Fish Biol. 2000;57:1367–1380. [Google Scholar]
  6. Gall G.A., Crandell P.A. The rainbow trout. Aquaculture. 1992;100:1–10. [Google Scholar]
  7. Hume L.C. Rainbow trout spawn twice a year. Calif Fish Game. 1955;41:117. [Google Scholar]
  8. Lewis P.O., Zaykin D. Genetic Data Analysis, v. 1.0. University of Connecticut, Storrs: Department of Ecology and Evolutionary Biology; 2001. [Google Scholar]
  9. Lou S.W., Aida K., Hanyu I., Sakai K., Nomura M., Tanaka M., Tazaki S. Endocrine profiles in the females of a twice-annually spawning strain of rainbow trout. Aquaculture. 1984;43:13–22. doi: 10.1016/0016-6480(86)90006-7. [DOI] [PubMed] [Google Scholar]
  10. Miller M.P. Tools for Population Genetic Analysis, v. 1.3. Northern Arizona University, Flagstaff: Department of Biological Sciences; 1997. [Google Scholar]
  11. Nei M. Genetic distance between populations. Am Nat. 1972;106:283–292. [Google Scholar]
  12. Nichols K.M., Young W.P., Danzmann R.G., Robinson B.D., Rexroad C., Noakes M., Phillips R.B., Bentzen P., Spies I., Knudsen K., et al. A consolidated linkage map for rainbow trout (Oncorhynchus mykiss) Anim Genet. 2003;34:102–115. doi: 10.1046/j.1365-2052.2003.00957.x. [DOI] [PubMed] [Google Scholar]
  13. O'Connell M., Danzmann R.G., Cornuet J.-.M., Wright J.M., Ferguson M.M. Differentiation of rainbow trout (Oncorhynchus mykiss) populations in Lake Ontario and the evaluation of the stepwise mutation and infinite allele mutation models using microsatellite variability. Can J Fish Aquat Sci. 1997;54:1391–1399. [Google Scholar]
  14. O'Malley K.G., Sakamoto T., Danzmann R.G., Ferguson M.M. Quantitative trait loci for spawning date and body weight in rainbow trout: Testing for conserved effects across ancestrally duplicated chromosomes. J Hered. 2003;94:273–284. doi: 10.1093/jhered/esg067. [DOI] [PubMed] [Google Scholar]
  15. Olsen J.B., Wilson S.L., Kretschmer E.J., Jones K.C., Seeb J.E. Characterization of 14 tetranucleotide microsatellite loci derived from sockeye salmon. Mol Ecol. 2000;9:2155–2234. doi: 10.1046/j.1365-294x.2000.105317.x. [DOI] [PubMed] [Google Scholar]
  16. Pritchard J.K., Rosenberg N. Use of unlinked genetic markers to detect population stratification in association studies. Am J Hum Genet. 1999;65:220–228. doi: 10.1086/302449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Raymond M.L., Rousset F. An exact test for population differentiation. Evolution. 1995;49:1280–1283. doi: 10.1111/j.1558-5646.1995.tb04456.x. [DOI] [PubMed] [Google Scholar]
  18. Sakamoto T., Danzmann R.G., Okamoto N., Ferguson M.M., Ihssen P.E. Linkage analysis of quantitative trait loci associated with spawning time in rainbow trout (Oncorhynchus mykiss) Aquaculture. 1999;173:33–43. [Google Scholar]
  19. Sakamoto T., Danzmann R.G., Gharbi K., Howard P., Ozaki K., Khoo S.K., Woram R.A., Okamoto N., Ferguson M.M., Holm L-E et al. A microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) characterized by large sex-specific differences in recombination rate. Genetics. 2000;155:1331–1345. doi: 10.1093/genetics/155.3.1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Scribner K.T., Gust J.R., Fields R.L. Isolation and characterization of novel microsatellite loci: Cross-species amplification and population genetic applications. Can J Fish Aquat Sci. 1996;53:833–841. [Google Scholar]
  21. Shmulewitz D., Zhang J., Greenberg D.A. Case-control association studies in mixed populations: Correcting using genomic control. Hum Hered. 2004;58:145–153. doi: 10.1159/000083541. [DOI] [PubMed] [Google Scholar]
  22. Siitonen L., Gall G.A.E. Response to selection for early spawn date in rainbow trout, Salmo gairdneri. Aquaculture. 1989;78:153–161. [Google Scholar]
  23. Taggart J.B., Hynes R.A., Prodohl P.A., Fergusson A. A simplified protocol for routine total DNA isolation from salmonid fishes. J Fish Biol. 1992;40:963–965. [Google Scholar]
  24. Takano M., Nomura H., Ootomo Y., Tazaki S., Tanaka M. Reproductive characteristics in the F6 of twice-annually spawning strains of rainbow trout, Oncorhynchus mykiss. Bull Saitama Pref Fish Exp Stat. 1995;53:67–73. [Google Scholar]
  25. Tazaki S., Nomura H., Suzuki K. Reproduction characteristics of twice-annually spawning strain of rainbow trout, Oncorhynchus mykiss. Bull Saitama Pref Fish Exp Stat. 1993;51:63–71. [Google Scholar]
  26. Voorrips R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J Hered. 2002;93:77–78. doi: 10.1093/jhered/93.1.77. [DOI] [PubMed] [Google Scholar]
  27. Wright S. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution. 1965;19:395–420. [Google Scholar]

Internet Resources

  1. GDA software. [October 25, 2009]. Available from: http://lewis.eeb.uconn.edu/lewishome/software.html.
  2. MapChart software. [December 4, 2010]. Available from: http://www.biometris.wur.nl/uk/Software/MapChart/
  3. TFPGA software. [October 25, 2009]. Available from: http://herb.bio.nau.edu/~miller.

Articles from Genetics and Molecular Biology are provided here courtesy of Sociedade Brasileira de Genética

RESOURCES