Skip to main content
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2011 Feb 14.
Published in final edited form as: Biochemistry. 2010 Sep 28;49(38):8300–8306. doi: 10.1021/bi100957h

The BCL-2 5′ Untranslated Region Contains an RNA G-Quadruplex-Forming Motif That Modulates Protein Expression†

Ramla Shahid ‡, Anthony Bugaut ‡,*, Shankar Balasubramanian ‡,§,∥,*
PMCID: PMC3038430  EMSID: UKMS34037  PMID: 20726580

Abstract

The BCL-2 gene encodes a 25 kDa membrane protein that plays critical roles in the control of apoptosis. The regulation of BCL-2 gene expression is highly complex and occurs both transcriptionally and posttranscriptionally. In particular, the 5′ upstream region of BCL-2 contains a number of elements that control its expression. We have identified a highly conserved 25-nucleotide G-rich sequence (BCL2Q), with potential to fold into a RNA G-quadruplex structure, located 42 nucleotides upstream of the translation start site of human BCL-2. In this study, we used a series of biophysical experiments to show that the BCL2Q sequence folds into a stable RNA G-quadruplex in vitro, and we conducted functional luciferase reporter-based assays, in a cell-free lysate and in three types of human cell lines, to demonstrate that the BCL2Q sequence modulates protein expression in the context of the 493-nucleotide native 5′ untranslated region of BCL-2.


The BCL-2 gene (B-cell lymphoma gene 2) is a member of the BCL-2 family of proteins composed of pro- and anti-apoptotic factors that serve as essential points in programmed cell death (1). It encodes a 25 kDa membrane protein that functions to prevent apoptosis (2). The BCL-2 gene was first identified by its involvement in t(14;18) chromosomal translocation, which is associated with human follicular lymphomas (3-5). As a result of the translocation, one allele of the anti-apoptotic BCL-2 gene from chromosome 18 is juxtaposed to the immunoglobulin heavy-chain locus on chromosome 14. This translocation leads to up-regulated expression of Bcl-2 protein, and high levels of BCL-2 mRNA1 are detected in cells with the t(14;18) chromosomal translocation (5, 6). Increased cell survival due to elevated levels of expression of BCL-2 has been correlated to the development of B-cell lymphomas and confers resistance to a variety of anticancer therapies (7, 8). In addition, deregulated expression of BCL-2 is not restricted to lymphomas. High levels of Bcl-2 protein and/or aberrant patterns of Bcl-2 protein production have been observed in a variety of solid tumors (9-13), whereas insufficient expression in neuronal cells has been associated with neurodegenerative diseases, including Alzheimer’s and Parkinson’s diseases (14, 15).

With such an important role in regulating apoptosis, the expression of BCL-2 is highly regulated at multiple levels, both transcriptionally and posttranscriptionally. In particular, the 5′ upstream region of the BCL-2 gene contains a number of elements that control its expression (Figure 1). Two main promoters, P1 and P2, regulate the transcription of BCL-2; both promoters contain multiple transcription initiation sites that give rise to transcripts containing 5′ untranslated regions (UTRs) differing in size by ~1.4 kb (16). The regulation of these two promoters is highly complex and depends on both tissue type and developmental stage (17, 18). In many cell types, the vast majority of BCL-2 transcripts are derived from the P1 promoter, whereas the P2 promoter, which is negatively regulated by the p53 protein, shows no or minimal activity (16, 19). However, usage of the P2 promoter is activated in t(14;18) lymphoma cells (16, 19, 20). A novel promoter region (M) with a p53-dependent activity, located between P1 and P2, was recently identified that counteracts the suppressive activity of P2 on P1 (21). In addition, the 5′ UTR of transcripts initiated from the upstream promoter contains a 221-nucleotide alternatively spliced intron. The splicing frequency of this intron varies among cell lines, although both spliced and unspliced forms are often simultaneously expressed (16). Several studies have revealed a lack of correlation between the levels of BCL-2 mRNA and Bcl-2 protein in various cell lines, indicating that translational and posttranslational control mechanisms also play a significant role in regulating Bcl-2 protein levels (22-24).

Figure 1.

Figure 1

(A) Schematic representation of the 5′ upstream region of the BCL-2 gene. The white section represents an alternatively spliced intron. (B) Sequence of the BCL-2 5′ UTR used in this study. The BCL2Q RNA G-quadruplex-forming sequence is boxed.

Many posttranscriptional regulatory pathways involve sequence and/or structural elements within the UTRs of mRNAs (25). The BCL-2 5′ UTR is highly conserved among several species, suggesting a regulatory role for this region (26-28). Indeed, elements that regulate translation have already been identified within the BCL-2 5′ UTR (29, 30). We and others have recently demonstrated that RNA G-quadruplex-forming sequences within the 5′ UTRs of mammalian genes can modulate translation efficiency both in cell-free experiments and in mammalian cell tissue culture (31-38). G-Quadruplexes are non-canonical four-stranded nucleic acid structures that arise from the stacking of hydrogen-bonded G-tetrads (39). Our computational searches for putative RNA G-quadruplex-forming sequences in 5′ UTRs in the human transcriptome have revealed the presence of a highly G-rich sequence (BCL2Q, 5′-GGGGGCCGUGGGGUGGGAGCUGGGG-3′), with potential to fold into an RNA G-quadruplex structure, located 42 nucleotides upstream of the translation start site of the human BCL-2 (32, 40). This motif is highly conserved, in both its sequence and its position relative to the translation start site, across various species (Table 1), suggesting a potentially important biological function for this sequence. Herein, we describe biophysical experiments that demonstrate that the BCL2Q sequence folds into a stable RNA G-quadruplex in vitro and functional luciferase reporter assays, in a cell-free lysate and in human cells, that show that the BCL2Q sequence modulates protein expression in the context of the native 493-nucleotide 5′ UTR of BCL-2.

Table 1.

Conservation of the RNA G-Quadruplex-Forming Sequence in the 5′ UTR of BCL-2

species sequencea positionb
human GGGGGCCGUGGGGUGGGAGCUGGGG −42
chimpanzee GGGGGCCGUGGGGUGGGAGCUGGGG −42
macaque GGGGGCCGUGGGGUGGGAGCUGGGG −42
gorilla GGGGGCCGUGGGGUGGGAGCUGGGG −42
orangutan GGGGGCCGUGGGGUGGGAGCUGGGG −42
mouse GGGGGCCGUGGGGCGGGAGUCGGGG −43
rat -GGGGCCGUGGGGCGGGAGCCGGG- −43
dog GGGGGCCGCGGGGCGGGAGCAGGGG −43
horse GGGGGCUGUGGGGCGGGAGCAGGGG −45
dolphin GGGGGCCGUGGGGCGGGAAGCGGGG −44
a

Sequences were retrieved from Ensembl (release 57). Nucleotides in bold are runs of guanines capable of forming G-quadruplexes.

b

Distance (in nucleotides) between the last G of the putative quadruplex and the translation start site

MATERIALS AND METHODS

CD and UV Spectroscopy

Thermal UV melting and CD measurements were performed as previously described (32, 35), using an HPLC-purified synthetic RNA oligonucleotide of the BCL2Q sequence (IBA Gmbh). The UV thermal difference spectrum was obtained as previously described (41).

Construction of Plasmids

The 493-nucleotide BCL-2 5′ UTR was PCR-amplified from human genomic DNA (Promega) using Pfu DNA polymerase. The UTR is present in two exons, 207 nucleotides in exon 1 and 286 nucleotides in exon 2, separated by an alternatively spliced intervening intron of 221 nucleotides. To remove the intron, we amplified the two exons separately and ligated them. Exon 1 was amplified using a forward primer tailed with an HindIII (underlined) restriction site and a minimal T7 promoter (italic) (P1, 5′-CGAAGCTTTAATACGACTCACTATAGGGCTGTGAA-3′, where a boldface G indicates positions that were mutated from T in the natural sequence to provide an efficient template for in vitro transcription) and a reverse primer tailed with a 20-nucleotide sequence from exon 2 that includes a natural Acc1 site (underlined) (P2, 5′-CAGTCTACTTCCTCTGTGATGTTGTATTTTTAAG-3′). Exon 2 was amplified using forward primer P3 (5′-AAGGCGCCATCACAGAGGAAGTAGACTGATAT-3′) and NcoI (underlined) tailed-reverse primer P4 (5′-TTCCATGGCCTTCCCAGAGGAAAAGC-3′). The amplified products were gel purified and separately subcloned in the pCR4Blunt-TOPO vector using a Zero Blunt PCR Cloning Kit (Invitrogen). After digestion and gel purification, the two exons were ligated using T4 DNA ligase (New England Biolabs), and the resulting product was PCR amplified using primers P1 and P4 and subcloned in pCR4Blunt-TOPO (pUTR). The Firefly luciferase gene was amplified from the pGL3 basic vector (Promega) using a forward primer tailed with NcoI (underlined) (P5, 5′-AACCATGGAAGACGCCAAAAACATAAAG-3′) and an Acc651 (underlined) tailed-reverse primer (P6, 5′-TTGGTACCTTACACGGCGATCTTTCCG-3′). In a three-piece ligation, the digested and gel-purified products from pUTR and the luciferase gene ligated at the NcoI site inserted into a HindIII- and Acc651-digested linear pUC18 vector (Promega). Positive clones were confirmed by DNA sequencing.

The plasmid encoding the control transcript del-UTR was obtained by deleting the 25-nucleotide G-quadruplex-forming sequence using the Quickchange site-directed mutagenesis kit (Stratagene). The deletion was conducted in two steps. The first 11 nucleotides of the G-quadruplex-forming sequence were deleted using forward primer P9 (5′-CTTCTTTCTCTGGTGGGAGCTGGGGCGAGAG-3′) and reverse primer P10 (5′-CCTCGCCCCAGCTCCCACCACAGAAAGAAG-3′). The next 14 nucleotides were removed using forward primer P11 (5′-CTCCTCTTCTTTCTCTCGAGAGGTGCCGTTGGCC-3′) and reverse primer P12 (5′-GGCCAACGGCACCTCTCGAGAGAAAGAAGAGGAG-3′). The plasmids were sequenced to confirm the presence of the intended changes.

For cell-based experiements, the constructs were transferred into CMV promoter-driven mammalian expression vectors. An XbaI restriction site (underlined) was introduced using site-directed mutagenesis at the 3′ end of the Firefly luciferase coding sequence in the plasmids described above, using forward primer P13 (5′-GGGCGGAAAGATCGCCGTGTAATACCGAGCTCTAGAATTCGTAATCATGG-3′) and reverse primer P14 (5′-CCATGATTACGAATTCTAGAGCTCGGTATTACACGGCGATCTTTCCGCCC-3′). The constructs were then cloned into the pRL-CMV vector (Promega) using HindIII and XbaI sites. The quadruplex-mutated plasmid (pCMV mut-UTR) was constructed by site-directed mutagenesis with forward primer P15 (5′-CTCTGGGGGCCGTTTTTTGGGAGCTGGGGCGAGAGG-3′) and reverse primer P16 (5′-CCTCTCGCCCCAGCTCCCAAAAAACGGCCCCCAGAG-3′).

In Vitro Transcription, in Vitro Translation, and Luciferase Assays

The plasmids were linearized at the 3′ end of the Firefly luciferase coding region using Acc651. The 5′ capped transcripts were synthesized in vitro using the mMessage mMachine T7 kit (Ambion) as previously described (32, 35). RNA concentrations were determined by UV spectroscopy using aNano Drop spectrophotometer. In vitro translation and luciferase assays were performed as previously described (35).

Cell Culture

Cells were grown to a confluency of 60–70% in flat bottom 24-well plates at 37 °C in a humidified atmosphere containing 5% CO2. The medium for MCF10A cells was Dulbecco’s Modified Eagle’s Medium: Nutrient Mixture F-12 (DMEM/F12, Invitrogen), 5% horse serum, 2 mg of epidermal growth factor/100 mL, 50 μg of hydrocortisone/100 mL, 1 μg of cholera toxin/100 mL, and 10 μg of insulin/100 mL. HGC27 cells were grown in Eagle’s Minimum Essential Medium (EMEM, Sigma), 2 mM l-glutamine, and 10% fetal bovine serum. MCF-7 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma) supplemented with 10% fetal bovine serum.

Dual Luciferase and Quantitative RT-PCR Assays

Cells were cotransfected with 500 ng of Firefly reporter construct plasmid DNA and 50 ng of normalizing plasmid DNA pRL-TK (Promega) using TransIT-LT1 transfection reagent (Mirus) following the manufacturer’s protocol. Twenty-four hours after transfection, Renilla and Firefly luciferase activities were measured using the Dual-Luciferase Reporter Assay system (Promega), following the manufacturer’s protocol, on an Orion II microplate luminometer (Berthold). Total RNA was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s protocol. The RNA concentration was determined by UV spectroscopy, and 500 ng of total RNA was used in a 20 μL cDNA synthesis reaction using oligo(dT) primer (Invitrogen) and SuperScript III reverse trancriptase (Invitrogen) according to the manufacturer’s protocol. For quantification of mRNA levels, 1 μL of the cDNA was used in a 10 μL reaction mixture with LightCycler 480 SYBR GreenI Master (Roche) on a Roche LightCycler 480 instrument using the forward 5′-TGAGTACTTCGAAATGTCCGTTC-3′ and reverse 5′-GTATTCCAGCCCATATCGTTTCAT-3′ primers for Firefly and the forward 5′-CAGCATTTTCTGCATGTTTTTCTGAATC-3′ and reverse 5′-CTATAAGAACCATTACCAGATTTGC-3′ primers for Renilla. All the reactions were conducted in duplicate. The relative gene expression was calculated using an adequate mathematical model (42) [ratio = (Etarget)ΔCPtarget(control–sample)/(Ereference)ΔCPref(control–sample)] with Firefly as the target gene transcript in comparison to Renilla as the reference gene transcript. The mean values and their associated experimental errors were calculated from at least three independent experiments.

RESULTS

The BCL2Q Sequence Folds into a Thermodynamically Stable RNA G-Quadruplex

To determine whether the BCL2Q sequence folds into a G-quadruplex, we performed a series of biophysical experiments on a synthetic RNA oligonucleotide using UV and CD spectroscopic analysis. Qualitative structural information about the folded state of an oligonucleotide can be readily obtained by recording a thermal difference spectrum (41). The thermal difference spectrum obtained for BCL2Q exhibits a shape that is similar to that reported for G-quadruplex structures (Figure 2A), with two positive peaks at ~243 and ~273 nm and a negative peak at ~295 nm (41). Accordingly, the thermal melting profile of BCL2Q recorded at 295 nm in a sodium cacodylate buffer (pH 7.0) containing 50 mM KCl shows a characteristic hypochromic sigmoidal transition (Figure 2A, inset) (43), with a Tm values of 81 °C. Curves for melting and annealing were superimposable, and studies over a 50-fold oligonucleotide concentration range (from 1 to 50 μM) showed no change (data not shown), which is consistent with intramolecular quadruplex formation. At a higher KCl concentration (100 mM), the structure could not be unfolded, even at 95 °C, indicating a very stable G-quadruplex under near-physiological salt conditions. The BCL2Q RNA G-quadruplex was fairly stable (Tm = 55 °C) even in the absence of any added stabilizing cations. An important charcteristic of G-quadruplex structures, as compared to those involving Watson–Crick base pairs, is their monovalent cation dependence for stabilization (44). In the presence of various monovalent cations, the stability of BCL2Q, as judged by Tm, showed the expected trend for G-quadruplex structure: K+ > Na+ > Li+ (Table 2). CD spectrocopy can be used as a standard technique to analyze G-quadruplex conformation (45). At pH 7.0 and 50 mM KCl, the CD spectrum of BCl2Q exhibited a positive peak at 265 nm and a negative peak at 240 nm (Figure 2B), which is the typical CD signature of a parallel G-quadruplex structure (45).

Figure 2.

Figure 2

Biophysical analysis of the BCL2Q RNA G-quadruplex. (A) Thermal difference spectrum of the BCL2Q RNA G-quadruplex. The inset shows the thermal melting and annealing UV profiles. (B) CD spectrum of BCL2Q. Experiments were performed in 10 mM sodium cacodylate (pH 7.0) and 50 mM KCl.

Table 2.

Tm Values (degrees Celsius) of the BCL2Q RNA G-Quadruplex in the Presence of Various Monovalent Cationsa

concentration (mM) K+ Na+ Li+
1 59 54 56
10 71 58 53
20 75 59 53
50 81 61 53
a

Tm values are an average of three independent experiments and have an associated error of ±1 °C.

The BCL2Q Motif Modulates the BCL-2 5′ UTR Translation Efficiency in Vitro

To specifically determine the influence of the BCL2Q motif on translation within its native context, we cloned the 493-nucleotide BCL-2 5′ UTR (Figure 1B) from human genomic DNA and inserted it immediately downstream of the minimal T7 promoter and upstream of the Firefly luciferase coding sequence in a plasmid expression vector. The BCL-2 5′ UTR that was examined in this study corresponds to transcript ENST00000333681 in the Ensembl database from which the alternatively spliced 221-nucleotide intron (Figure 1A) was excluded. It contains the 25-nucleotide BCL2Q motif located 426 nucleotides downstream from the 5′ end and 42 nucleotides upstream from the translation start site. In addition to the plasmid encoding the transcript that includes the wild-type BCL-2 5′ UTR (wt-UTR), we also generated a control plasmid in which the 25-nucleotide BCL2Q quadruplex-forming sequence has been deleted from the BCL-2 5′ UTR (transcript del-UTR). Corresponding transcripts were produced with a 5′ cap by in vitro transcription using T7 polymerase and subjected to in vitro translation using nuclease-treated rabbit reticulocyte lysate, which is an established eukaryotic cell-free system for studying translation (46). Translation efficiencies were measured by the standard luminescence assay for luciferase catalytic activity (47). The translation efficiency of an mRNA in reticulocyte lysates is sensitive to the amount of mRNA that is added to the reaction mixture (46, 48). This is particularly true for those mRNAs that exhibit stable secondary structures in their 5′ UTR. We thus performed in vitro translation experiments using mRNA concentrations ranging from 10 to 320 ng/μL. As shown in Figure 3, for RNA concentrations of ≤20 ng/μL, we did not observe any differences in translation efficiency between the del-UTR and wt-UTR transcripts, indicating that the BCL2Q motif is not affecting in vitro translation. However, at higher mRNA concentrations, deletion of the RNA G-quadruplex motif resulted in an increase in mRNA translation efficiency. At an mRNA concentration of 320 ng/μL, the del-UTR transcript was translated 3.5-fold more efficiently that the wt-UTR transcript, showing that the BCL2Q RNA G-quadruplex motif has potential to inhibit translation.

Figure 3.

Figure 3

Relative in vitro translation efficiency of the wild-type BCL2 5′ UTR (wt-UTR) and the quadruplex-deleted 5′ UTR (del-UTR) at increasing mRNA concentrations, as judged by quantitation of Firefly luciferase activity. Error bars represent the sem of three independent experiments.

The BCL2Q Motif Modulates the Translation Efficiency of the BCL-2 5′ UTR in Human Cells

To further investigate the aptitude of the BCL2Q motif to affect translation, we next performed dual luciferase assays in cultured human cells. The wild-type and quadruplex-deleted BCL-2 5′ UTR Firefly luciferase reporter constructs, used for the in vitro study, were transferred downstream from a CMV promoter into a mammalian expression vector (Figure 4A). For these studies, we also prepared a quadruplex-mutated BCL-2 5′ UTR construct (pCMV mut-UTR) by substituting one G4 tract of the BCL2Q RNA with U4 to disrupt RNA G-quadruplex formation, while maintaining the natural length of the 5′ UTR (Figure 4A). Each of the three vector constructs (pCMV wt-UTR, pCMV del-UTR, and pCMV mut-UTR) was cotransfected into MCF10A human breast epithelial cells together with a pRL-TK normalizing vector, which encodes the Renilla luciferase. Following a 24 h growth period, cells were harvested for dual luciferase assays and for quantitative RT-PCR on total RNA to measure transcript levels. Levels of Firefly luciferase activity and Firefly luciferase mRNA were normalized to the corresponding values obtained for Renilla luciferase and compared. As shown in Figure 4B, both deletion and mutation of the BCL2Q G-quadruplex-forming sequence resulted in an increase in the level of protein synthesis, by 2.3- and 1.9-fold, respectively. In contrast, the mRNA levels, as determined by quantitative RT-PCR analysis using an adequate mathematical model (42), were not significantly affected (Figure 4B). Qualitatively comparable results were also obtained in two other cell lines: human breast adenocarcinoma cell line MCF7 and human gastric carcinoma cell line HGC27 (Table 3). The translational suppressive effect of the BCL2Q motif was however much less pronounced in HGC27 cells. Collectively, these data demonstrate that the BCL2Q RNA G-quadruplex motif in the BCL2 5′ UTR has an inhibitory effect on translation in human cells.

Figure 4.

Figure 4

(A) Schematic representation of the DNA luciferase reporter constructs used in the study: pCMV wt-UTR, full-length (493 nucleotides) wild-type BCL-2 5′ UTR; pCMV del-UTR, from which the 25-nucleotide G-quadruplex-forming sequence has been deleted; and pCMV mut-UTR, full-length BCL-2 5′ UTR with a G4-to-T4 mutation (underlined) to disrupt G-quadruplex formation. (B) Relative protein levels, as judged by quantitation of luciferase activity, and mRNA levels, as judged by quantitative RT-PCR, from expression of the three constructs in MCF10A cultured cells. Results were normalized relative to the data obtained for the pCMV wt-UTR construct. Error bars represent the standard error of the mean of at least three independent experiments. Asterisks indicate p < 0.001; nss, not statistically significant (Student’s t test).

Table 3.

Relative Firefly Luciferase Protein and mRNA Expression of the Dual Luciferase (DL) Constructs in Different Cell Lines

construct MCF7
HGC27
protein mRNA protein mRNA
DL wt-UTR 100 100 100 100
DL del-UTR 230 ± 13a 83 ± 13b 139 ± 6a 99 ± 17b
DL mut-UTR 188 ± 14a 121 ± 12b 134 ± 6a 113 ± 17b
a

p < 0.01.

b

Not statistically significant (Student’s t test).

DISCUSSION

Regulation of eukaryotic translation by G-rich sequences capable of folding into noncanonical four-stranded RNA G-quadruplex structures has recently emergerd as a new paradigm. In 2007, we reported the identification of a naturally occurring RNA G-quadruplex in the 5′ UTR of the human NRAS proto-oncogene and demonstrated its role in inhibiting translation in vitro (32). Subsequently, other RNA G-quadruplexes, found in the 5′ UTR of the human ZIC-1 (34) and MP3-MMP (36) mRNAs, were shown to inhibit translation of reporter constructs in HeLa cells, and a G-quadruplex in the 5′ UTR of a ERS1 mRNA variant was shown to repress translation in rabbit reticulocyte lysate (38). Halder et al. have also established general translation repression by artificially designed cis-acting 5′ UTR G-quadruplexes in several cell lines (37). While this work was under review, two reports have been published that used reporter-based constructs to describe posttranscriptional control of gene expression by RNA G-quadruplex-forming motifs in the 5′ UTRs of TRF2, in 293T cells (49), and six other genes, in HEK 293 cells (50). In a detailed computational analysis of the human transcriptome, we have identified ~2300 sequences with the potential to form RNA G-quadruplexes in the 5′ UTRs of genes (40). One such sequence (BCL2Q, 5′-GGGGGCCGUGGGGUGGGAGCUGGGG-3′) was found in the 5′ UTR of the BCL-2 gene, which plays critical functions in controlling programmed cell death (1). The BCL2Q sequence is highly conserved in length, sequence, and position in the BCL-2 5′ UTR, across various species, including human, mouse, dog, horse, and dolphin (Table 1). In this work, we have investigated the ability of this sequence to form a stable structure and evaluated its effect on the translation efficiency of a BCL-2 5′ UTR.

The UV thermal difference spectrum, CD spectrum, and UV thermal melting experiments, performed in the presence of various monovalent cations, were all consistent with intramolecular RNA G-quadruplex formation by the BCL2Q sequence. In fact, the BCL2Q sequence folds into a thermodynamically very stable G-quadruplex, with a Tm of > 80 °C in the presence of 50 mM KCl. At a near-physiological potassium concentration (100 mM), the BCL2Q RNA G-quadruplex could not be melted, even at 95 °C. Such extreme thermodynamic stability has also been observed for other naturally occurring 5′ UTR RNA G-quadruplexes (32, 34, 36, 38) and is thought to result from the 2′-OH groups acting as a scaffold for a network of water molecules that lock the structure (51). The results from our biophysical study of the BCL2Q RNA G-quadruplex are also corroborated by a very recent report from Sugimoto and co-workers investigating the conformation and thermodymamics of a RNA G-quadruplex under crowding conditions using a mutant sequence (5′-AGGGCCGUGGGGUGGGAGCUGGG-3′) derived from BCL2Q (51).

Next, we cloned the native full-length 493-nucleotide 5′ UTR of BCL-2 upstream of the Firefly luciferase reporter gene, and immediately downstream of the minimal T7 promoter, to preserve the position of the G-quadruplex motif in the RNA 5′ UTR. It is noteworthy that this study represents one of the few examples [with the NRAS (32) MT3-MMP (36), and the very recent studies (49, 50)] to investigate the influence of an RNA G-quadruplex on translation when it is located in its native context within the full-length wild-type 5′ UTR, a factor that we previously showed to be a determinant for translation repression by another naturally occurring RNA G-quadruplex-forming sequence in the NRAS 5′ UTR (35). We also prepared a control construct by deleting the 25-nucleotide BCL2Q quadruplex-forming sequence from the UTR. We then titrated the corresponding 5′ capped mRNAs, generated by in vitro transcription, in nuclease-treated rabbit reticulocyte lysate. When a low concentration of mRNA (≤20 ng/μL) was used, the luciferase expression of the RNA G-quadruplex-containing transcript (wt-UTR) was similar, within experimental error, to that of the control transcript (del-UTR). However, when the mRNA concentration was increased, a translational inhibitory effect of the RNA G-quadruplex structure was observed. The level of inhibition increased in a mRNA concentration-dependent manner from 40 to 320 ng/μL. It has been demonstrated that increasing the mRNA concentration in lysates, for mRNAs containing stable 5′ UTR secondary structures, enhances the demand for RNA helicase activity (e.g., from eIF4A and eIF4G) required for efficient scanning of the ribosomal translation initiation complex from the 5′ cap to the AUG translation start codon (48). Accordingly, under competitive conditions, at higher concentrations of input mRNA, the secondary structures can no longer be efficiently removed by the limited amount of RNA helicase activity, resulting in translation inhibition (48). Our data show that at mRNA concentrations of >20 ng/μL, the wt-UTR transcript is increasingly less efficiently translated than the del-UTR transcript, indicating that the BCL2Q RNA G-quadruplex is inhibiting translation.

Having demonstrated that the BCL2Q motif has potential to inhibit translation in vitro, we then investigated whether it was still the case in cells. We performed dual luciferase assays in three types of human cell lines (MCF10A, MCF7, and HGC27) using CMV promoter-driven expression vectors that contain either wild-type (pCMV wt-UTR), quadruplex-deleted (pCMV del-UTR), or quadruplex-mutated (pCMV mut-UTR) BCL-2 5′ UTRs upstream of the Firefly luciferase coding sequence, and a normalizing vector that encodes the Renilla luciferase. Our data show that both deletion and mutation of the BCL2Q motif resulted in a significant increase in the level of Firefly luciferase expression, as compared to the wild-type BCL-2 5′ UTR, in all three cell lines. Using quantitative RT-PCR, we did not detect any significant difference in mRNA levels among the three constructs. We thus conclude that the increase in the level of Firefly expression occurs at the translational level rather than the transcriptional level, indicating that the BCL2Q RNA G-quadruplex-forming motif, in its native context, is inhibiting translation. A maximum inhibitory effect of 2.3-fold was obtained in MCF10A cells, whereas a 1.4-fold inhibition was observed in HGC27 cells. The reasons for this quantitative discrepancy between cell lines are not clear. Similar observations have been made using other RNA G-quadruplex-forming sequences and different eukaryotic cell lines (37). Cell-dependent variations in the level of translation repression may possibly be due to differences in the availability and/or efficiency of some components of the translation machinery (e.g., initiation factors or helicases) between cell lines.

Taken together, this work presents the first evidence of the existence and function of an RNA G-quadruplex motif in the 5′ UTR of BCL-2 that inhibits translation. Overexpression of the anti-apoptotic Bcl-2 protein has been associated with neoplasia and chemotherapy resistance in various human cancers. Therefore, considerable effort is being directed toward small molecules that target Bcl-2 protein (52). Some of these molecules have demonstrate promising results in clinical trials, particularly in combination with other chemotherapy agents. Furthermore, one antisense oligonucleotide that targets the coding region of BCL-2 mRNA and downregulates protein expression is currently in clinical trials (52, 53). We have recently reported an in vitro proof of concept that an RNA G-quadruplex in the 5′ UTR can serve as a molecular target for G-quadruplex selective small molecule inhibition of translation (54). We will be exploring the potential of the BCL2Q RNA G-quadruplex as a target in future studies. Interestingly, a DNA G-quadruplex-forming sequence has also been identified upstream of the P1 promoter region of BCL-2 (55-57). This could offer the possibility of inhibiting BCL-2 expression at the transcriptional and translational levels via two independent G-quadruplex targets.

Footnotes

†

We thank the BBSRC for project funding and Cancer Research UK for program funding. We thank the Cambridge Commonwealth Trust and the COMSATS Institute of Information Technology for studentship funding (R.S.).

1
Abbreviations:
UTR
untranslated region
uORF
upstream open reading frame
IRES
internal ribosome entry site
UV
ultraviolet
CD
circular dichroism
Tm
melting temperature
mRNA
messenger RNA

REFERENCES

  • 1.Borner C. The Bcl-2 protein family: Sensors and checkpoints for life-or-death decisions. Mol. Immunol. 2003;39:615–647. doi: 10.1016/s0161-5890(02)00252-3. [DOI] [PubMed] [Google Scholar]
  • 2.Vaux DL, Cory S, Adams JM. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature. 1988;335:440–442. doi: 10.1038/335440a0. [DOI] [PubMed] [Google Scholar]
  • 3.Tsujimoto Y, Cossman J, Jaffe E, Croce CM. Involvement of the bcl-2 gene in human follicular lymphoma. Science. 1985;228:1440–1443. doi: 10.1126/science.3874430. [DOI] [PubMed] [Google Scholar]
  • 4.Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce CM. The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science. 1985;229:1390–1393. doi: 10.1126/science.3929382. [DOI] [PubMed] [Google Scholar]
  • 5.Cleary ML, Smith SD, Sklar J. Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 1986;47:19–28. doi: 10.1016/0092-8674(86)90362-4. [DOI] [PubMed] [Google Scholar]
  • 6.Graninger WB, Seto M, Boutain B, Goldman P, Korsmeyer SJ. Expression of Bcl-2 and Bcl-2-Ig fusion transcripts in normal and neoplastic cells. J. Clin. Invest. 1987;80:1512–1515. doi: 10.1172/JCI113235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Desoize B. Anticancer drug resistance and inhibition of apoptosis. Anticancer Res. 1994;14:2291–2294. [PubMed] [Google Scholar]
  • 8.Schmitt CA, Lowe SW. Bcl-2 mediates chemoresistance in matched pairs of primary E(mu)-myc lymphomas in vivo. Blood Cells Mol. Dis. 2001;27:206–216. doi: 10.1006/bcmd.2000.0372. [DOI] [PubMed] [Google Scholar]
  • 9.Reed JC, Meister L, Tanaka S, Cuddy M, Yum S, Geyer C, Pleasure D. Differential expression of bcl2 protooncogene in neuroblastoma and other human tumor cell lines of neural origin. Cancer Res. 1991;51:6529–6538. [PubMed] [Google Scholar]
  • 10.McDonnell TJ, Troncoso P, Brisbay SM, Logothetis C, Chung LW, Hsieh JT, Tu SM, Campbell ML. Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res. 1992;52:6940–6944. [PubMed] [Google Scholar]
  • 11.Pezzella F, Turley H, Kuzu I, Tungekar MF, Dunnill MS, Pierce CB, Harris A, Gatter KC, Mason DY. bcl-2 protein in non-small-cell lung carcinoma. N. Engl. J. Med. 1993;329:690–694. doi: 10.1056/NEJM199309023291003. [DOI] [PubMed] [Google Scholar]
  • 12.Bronner MP, Culin C, Reed JC, Furth EE. The bcl-2 proto-oncogene and the gastrointestinal epithelial tumor progression model. Am. J. Pathol. 1995;146:20–26. [PMC free article] [PubMed] [Google Scholar]
  • 13.Reed JC, Miyashita T, Krajewski S, Takayama S, Aime-Sempe C, Kitada S, Sato T, Wang HG, Harigai M, Hanada M, Krajewska M, Kochel K, Millan J, Kobayashi H. Bcl-2 family proteins and the regulation of programmed cell death in leukemia and lymphoma. Cancer Treat. Res. 1996;84:31–72. doi: 10.1007/978-1-4613-1261-1_3. [DOI] [PubMed] [Google Scholar]
  • 14.Satou T, Cummings BJ, Cotman CW. Immunoreactivity for Bcl-2 protein within neurons in the Alzheimer’s disease brain increases with disease severity. Brain Res. 1995;697:35–43. doi: 10.1016/0006-8993(95)00748-f. [DOI] [PubMed] [Google Scholar]
  • 15.Bar-Am O, Weinreb O, Amit T, Youdim MB. Regulation of Bcl-2 family proteins, neurotrophic factors, and APP processing in the neurorescue activity of propargylamine. FASEB J. 2005;19:1899–1901. doi: 10.1096/fj.05-3794fje. [DOI] [PubMed] [Google Scholar]
  • 16.Seto M, Jaeger U, Hockett RD, Graninger W, Bennett S, Goldman P, Korsmeyer SJ. Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J. 1988;7:123–131. doi: 10.1002/j.1460-2075.1988.tb02791.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Young RL, Korsmeyer SJ. A negative regulatory element in the bcl-2 5′-untranslated region inhibits expression from an upstream promoter. Mol. Cell. Biol. 1993;13:3686–3697. doi: 10.1128/mcb.13.6.3686-3697.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Smith MD, Ensor EA, Coffin RS, Boxer LM, Latchman DS. Bcl-2 transcription from the proximal P2 promoter is activated in neuronal cells by the Brn-3a POU family transcription factor. J. Biol. Chem. 1998;273:16715–16722. doi: 10.1074/jbc.273.27.16715. [DOI] [PubMed] [Google Scholar]
  • 19.Wu Y, Mehew JW, Heckman CA, Arcinas M, Boxer LM. Negative regulation of bcl-2 expression by p53 in hematopoietic cells. Oncogene. 2001;20:240–251. doi: 10.1038/sj.onc.1204067. [DOI] [PubMed] [Google Scholar]
  • 20.Duan H, Heckman CA, Boxer LM. The immunoglobulin heavy-chain gene 3′ enhancers deregulate bcl-2 promoter usage in t(14;18) lymphoma cells. Oncogene. 2007;26:2635–2641. doi: 10.1038/sj.onc.1210061. [DOI] [PubMed] [Google Scholar]
  • 21.Bredow S, Juri DE, Cardon K, Tesfaigzi Y. Identification of a novel Bcl-2 promoter region that counteracts in a p53-dependent manner the inhibitory P2 region. Gene. 2007;404:110–116. doi: 10.1016/j.gene.2007.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kondo E, Nakamura S, Onoue H, Matsuo Y, Yoshino T, Aoki H, Hayashi K, Takahashi K, Minowada J, Nomura S, et al. Detection of bcl-2 protein and bcl-2 messenger RNA in normal and neoplastic lymphoid tissues by immunohistochemistry and in situ hybridization. Blood. 1992;80:2044–2051. [PubMed] [Google Scholar]
  • 23.Chleq-Deschamps CM, LeBrun DP, Huie P, Besnier DP, Warnke RA, Sibley RK, Cleary ML. Topographical dissociation of BCL-2 messenger RNA and protein expression in human lymphoid tissues. Blood. 1993;81:293–298. [PubMed] [Google Scholar]
  • 24.Ravazoula P, Tsamandas AC, Kardamakis D, Gogos C, Karatza C, Thomopoulos K, Tepetes K, Kourelis T, Petsas T, Bonikos DS, Karavias D. The potential role of bcl-2 mRNA and protein expression in hepatocellular carcinomas. Anti-cancer Res. 2002;22:1799–1805. [PubMed] [Google Scholar]
  • 25.Pesole G, Mignone F, Gissi C, Grillo G, Licciulli F, Liuni S. Structural and functional features of eukaryotic mRNA untranslated regions. Gene. 2001;276:73–81. doi: 10.1016/s0378-1119(01)00674-6. [DOI] [PubMed] [Google Scholar]
  • 26.Negrini M, Silini E, Kozak C, Tsujimoto Y, Croce CM. Molecular analysis of mbcl-2: Structure and expression of the murine gene homologous to the human gene involved in follicular lymphoma. Cell. 1987;49:455–463. doi: 10.1016/0092-8674(87)90448-x. [DOI] [PubMed] [Google Scholar]
  • 27.Eguchi Y, Ewert DL, Tsujimoto Y. Isolation and characterization of the chicken bcl-2 gene: Expression in a variety of tissues including lymphoid and neuronal organs in adult and embryo. Nucleic Acids Res. 1992;20:4187–4192. doi: 10.1093/nar/20.16.4187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Sato T, Irie S, Krajewski S, Reed JC. Cloning and sequencing of a cDNA encoding the rat Bcl-2 protein. Gene. 1994;140:291–292. doi: 10.1016/0378-1119(94)90561-4. [DOI] [PubMed] [Google Scholar]
  • 29.Harigai M, Miyashita T, Hanada M, Reed JC. A cisacting element in the BCL-2 gene controls expression through translational mechanisms. Oncogene. 1996;12:1369–1374. [PubMed] [Google Scholar]
  • 30.Sherrill KW, Byrd MP, Van Eden ME, Lloyd RE. BCL-2 translation is mediated via internal ribosome entry during cell stress. J. Biol. Chem. 2004;279:29066–29074. doi: 10.1074/jbc.M402727200. [DOI] [PubMed] [Google Scholar]
  • 31.Bonnal S, Schaeffer C, Creancier L, Clamens S, Moine H, Prats AC, Vagner S. A single internal ribosome entry site containing a G quartet RNA structure drives fibroblast growth factor 2 gene expression at four alternative translation initiation codons. J. Biol. Chem. 2003;278:39330–39336. doi: 10.1074/jbc.M305580200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kumari S, Bugaut A, Huppert JL, Balasubramanian S. An RNA G-quadruplex in the 5′ UTR of the NRAS proto-oncogene modulates translation. Nat. Chem. Biol. 2007;3:218–221. doi: 10.1038/nchembio864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Khateb S, Weisman-Shomer P, Hershco-Shani I, Ludwig AL, Fry M. The tetraplex (CGG)n destabilizing proteins hnRNP A2 and CBF-A enhance the in vivo translation of fragile X premutation mRNA. Nucleic Acids Res. 2007;35:5775–5788. doi: 10.1093/nar/gkm636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Arora A, Dutkiewicz M, Scaria V, Hariharan M, Maiti S, Kurreck J. Inhibition of translation in living eukaryotic cells by an RNA G-quadruplex motif. RNA. 2008;14:1290–1296. doi: 10.1261/rna.1001708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kumari S, Bugaut A, Balasubramanian S. Position and stability are determining factors for translation repression by an RNA G-quadruplex-forming sequence within the 5′ UTR of the NRAS proto-oncogene. Biochemistry. 2008;47:12664–12669. doi: 10.1021/bi8010797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Morris MJ, Basu S. An unusually stable G-quadruplex within the 5′-UTR of the MT3 matrix metalloproteinase mRNA represses translation in eukaryotic cells. Biochemistry. 2009;48:5313–5319. doi: 10.1021/bi900498z. [DOI] [PubMed] [Google Scholar]
  • 37.Halder K, Wieland M, Hartig JS. Predictable suppression of gene expression by 5′-UTR-based RNA quadruplexes. Nucleic Acids Res. 2009;37:6811–6817. doi: 10.1093/nar/gkp696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Balkwill GD, Derecka K, Garner TP, Hodgman C, Flint AP, Searle MS. Repression of translation of human estrogen receptor R by G-quadruplex formation. Biochemistry. 2009;48:11487–11495. doi: 10.1021/bi901420k. [DOI] [PubMed] [Google Scholar]
  • 39.Neidle S, Balasubramanian S. Quadruplex Nucleic Acids. RSC Biomolecular Sciences; Cambridge, U.K.: 2006. [Google Scholar]
  • 40.Huppert JL, Bugaut A, Kumari S, Balasubramanian S. G-Quadruplexes: The beginning and end of UTRs. Nucleic Acids Res. 2008;36:6260–6268. doi: 10.1093/nar/gkn511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Mergny JL, Li J, Lacroix L, Amrane S, Chaires JB. Thermal difference spectra: A specific signature for nucleic acid structures. Nucleic Acids Res. 2005;33:e138. doi: 10.1093/nar/gni134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Mergny JL, Phan AT, Lacroix L. Following G-quartet formation by UV-spectroscopy. FEBS Lett. 1998;435:74–78. doi: 10.1016/s0014-5793(98)01043-6. [DOI] [PubMed] [Google Scholar]
  • 44.Hardin CC, Watson T, Corregan M, Bailey C. Cation-dependent transition between the quadruplex and Watson-Crick hairpin forms of d(CGCG3GCG) Biochemistry. 1992;31:833–841. doi: 10.1021/bi00118a028. [DOI] [PubMed] [Google Scholar]
  • 45.Paramasivan S, Rujan I, Bolton PH. Circular dichroism of quadruplex DNAs: Applications to structure, cation effects and ligand binding. Methods. 2007;43:324–331. doi: 10.1016/j.ymeth.2007.02.009. [DOI] [PubMed] [Google Scholar]
  • 46.Merrick WC, Barth-Baus D. Use of reticulocyte lysates for mechanistic studies of eukaryotic translation initiation. Methods Enzymol. 2007;429:1–21. doi: 10.1016/S0076-6879(07)29001-9. [DOI] [PubMed] [Google Scholar]
  • 47.DiLella AG, Hope DA, Chen H, Trumbauer M, Schwartz RJ, Smith RG. Utility of firefly luciferase as a reporter gene for promoter activity in transgenic mice. Nucleic Acids Res. 1988;16:4159. doi: 10.1093/nar/16.9.4159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Gallie DR. Use of in vitro translation extract depleted in specific initiation factors for the investigation of translational regulation. Methods Enzymol. 2007;429:35–51. doi: 10.1016/S0076-6879(07)29003-2. [DOI] [PubMed] [Google Scholar]
  • 49.Gomez D, Guedin A, Mergny JL, Salles B, Riou JF, Teulade-Fichou MP, Calsou P. A G-quadruplex structure within the 5′-UTR of TRF2 mRNA represses translation in human cells. Nucleic Acids Res. 2010 doi: 10.1093/nar/gkq563. Advance Access published on June 22, 2010 doi:10.1093/nar/gkq563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Beaudoin JD, Perreault JP. 5′-UTR G-quadruplex structures acting as translational repressors. Nucleic Acids Res. 2010 doi: 10.1093/nar/gkq557. doi:10.1093/nar/gkq557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Zhang DH, Fujimoto T, Saxena S, Yu HQ, Miyoshi D, Sugimoto N. Monomorphic RNA G-quadruplex and polymorphic DNA G-quadruplex structures responding to cellular environmental factors. Biochemistry. 2010;49:4554–4563. doi: 10.1021/bi1002822. [DOI] [PubMed] [Google Scholar]
  • 52.Kang MH, Reynolds CP. Bcl-2 inhibitors: Targeting mitochondrial apoptotic pathways in cancer therapy. Clin. Cancer Res. 2009;15:1126–1132. doi: 10.1158/1078-0432.CCR-08-0144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Dias N, Stein CA. Potential roles of antisense oligonucleotides in cancer therapy. The example of Bcl-2 antisense oligonucleotides. Eur. J. Pharm. Biopharm. 2002;54:263–269. doi: 10.1016/s0939-6411(02)00060-7. [DOI] [PubMed] [Google Scholar]
  • 54.Bugaut A, Rodriguez R, Kumari S, Hsu ST, Balasubramanian S. Small molecule-mediated inhibition of translation by targeting a native RNA G-quadruplex. Org. Biomol. Chem. 2010;8:2771–2776. doi: 10.1039/c002418j. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Dai J, Chen D, Jones RA, Hurley LH, Yang D. NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region. Nucleic Acids Res. 2006;34:5133–5144. doi: 10.1093/nar/gkl610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Dexheimer TS, Sun D, Hurley LH. Deconvoluting the structural and drug-recognition complexity of the G-quadruplex-forming region upstream of the bcl-2 P1 promoter. J. Am. Chem. Soc. 2006;128:5404–5415. doi: 10.1021/ja0563861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Dai J, Dexheimer TS, Chen D, Carver M, Ambrus A, Jones RA, Yang D. An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution. J. Am. Chem. Soc. 2006;128:1096–1098. doi: 10.1021/ja055636a. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES