Abstract
Purpose
Papillary thyroid carcinoma (PTC), the most common thyroid malignancy, usually possesses BRAF mutation or rearranged in translation (RET)/PTC rearrangements. PTC usually possesses BRAF mutation or RET/PTC rearrangements. The mutation status of patients with recurrent PTC has never been characterized in a large population.
Experimental Design
Mutation status was determined in a cohort of 54 patients with recurrent PTC and analyzed for clinicopathologic relationships. BRAF and ras mutations were determined by PCR and sequencing of genomic DNA. RET/PTC rearrangements were analyzed by reverse transcription-PCR.
Results
BRAF mutation in exon 15 (V600E) was found in 42/54 (77.8%) recurrent PTC patients. The RET/PTC rearrangements were detected in 9 of 54 (16.7%) patients. In addition, 5 of 54 (9.3%) recurrent PTC patients had both a BRAF mutation and a RET/PTC rearrangement. The prevalence of tumors with dual mutations found in the recurrent population far exceeds the frequency historically reported for patients with primary PTC. Patients with dual mutations were significantly older (80% older than 45 years) than patients with a BRAF mutation alone (38% older than 45 years).
Conclusions
Recurrent PTC is significantly associated with a predominant BRAF mutation. RET/PTC rearrangements, although commonly associated with primary PTCs in younger patients, are uncommonly found in recurrent PTC patients. In addition, the incidence of dual mutations was higher in patients with recurrent PTC than in those primary PTC, as reported by others.
Papillary thyroid carcinoma (PTC) is the most common type of thyroid malignancy accounting for 70% to 80% of thyroid cancer cases (1). In most cases, PTC has a very good prognosis, particularly in patients younger than ages 45 years at the time of diagnosis. However, roughly 5.7% of patients at 5 years and 9.4% of patients at 10 years with primary PTC will experience a recurrence of tumor (2). Recurrence typically occurs in the neck region, either in lymph nodes or in the thyroid bed, and less commonly in distance sites such as lung or bone. Patients who were older than 45 years at the time of initial diagnosis have a much worse prognosis when the cancer recurs. The 15-year mortality rate for this group is ~30% for patients with local recurrence in the neck, and roughly 50% for patients with recurrence at distance sites (1, 3, 4).
Several types of genetic alterations have been found in primary PTC, including mutations in BRAF or ras, and rearrangements of the RET or NTRK1 tyrosine kinase receptor. The incidence of BRAF mutations ranges from 29% to 83% depending on the cohort studied (5). The most common type of BRAF mutation found in primary PTC is a T to A substitution at nucleotide 1799 in exon 15, which results in conversion of a valine to glutamic acid at codon 600 (V600E) of the BRAF protein (6, 7). BRAF mutation has been associated with poor prognosis in PTC patients (8–10). The incidence of RET/PTC rearrangements in PTC ranges from 2.5% to 67.0% depending on the cohort studied (11, 12). Most patients with RET/PTC rearrangements in their primary PTCs were younger than 45 years (13–17). A total of 11 different RET/PTC rearrangements have been reported; the most widely studied are RET/PTC1 (RET kinase fused with the H4 gene; ref. 18), RET/PTC2 (RET kinase fused with the regulatory subunit RIα of cyclic AMP-dependent protein kinase A; ref. 19), and RET/PTC3 (RET kinase fused with the RFG gene; ref. 20). Mutations in ras and NTRK1 rearrangements have been reported but are very rare in primary PTC (21–26).
The mutation profile of patients with recurrent PTC is largely uncharacterized. In this study, we analyzed the mutation status of 54 patients with recurrent PTC and analyzed the data by patient age, race, gender, and tumor stages. We found that recurrent PTC is significantly associated with a predominant BRAF mutation. RET/PTC rearrangements, although commonly associated with primary PTCs in patients younger than 45 years, are uncommonly found in recurrent PTC patients. In addition, we found that 9.3% of these recurrent tumors had acquired both a BRAF mutation and a RET/PTC rearrangement. Patients with dual mutations were older and had more advanced tumors than patients with a BRAF mutation alone. These data suggest that recurrent disease may be associated with more than one mutation and that recurrent PTC is likely a genetic selection event.
Materials and Methods
Thyroid samples
Archival formalin-fixed and paraffin-embedded papillary thyroid cancer specimens (all recurrences were from lymph node metastases) were examined in 68 consecutive patients who underwent surgery for recurrent PTC between September 1, 2003, and August 31, 2004, and were retrieved retrospectively from the Department of Pathology at The University of Texas M. D. Anderson Cancer Center. After examining the H&E staining, those patients (total 54 patients) containing >70% tumor cells in total cellularity were selected for this study. In addition, the primary tumors (formalin-fixed and paraffin-embedded thyroid specimens) from five patients were also used in this study in an effort to compare to their delayed metastatic lymph nodes. Tumor samples were obtained in accordance with protocols approved by the institutional review board. Tumors were classified according to the histopathologic typing of the WHO (27, 28).
DNA extraction
A 10-µm section was taken from each paraffin block and subjected to deparaffinization twice in xylene for 15 min at 55°C. After two 15-min periods of rehydration in 100% ethanol, the tissue pellets were dried and digested with proteinase K (0.5 mg/mL; Ambion) at 55°C for 3 d. Fresh proteinase K was added to the samples everyday. After extraction with phenol/chloroform, genomic DNA was precipitated and 100 ng of DNA was used in PCR.
RNA extraction
Total RNA was extracted from two 10-µm sections of paraffin-embedded tumor tissue using an Optimum FFPE RNA isolation kit (Ambion) according to the manufacturer’s protocols. Two micrograms or less of total RNA were reverse transcribed (RT) by Superscript II (Invitrogen Corp.) in a 25-µL total reaction volume containing RT buffer, random hexamers (Invitrogen), deoxynucleotide triphosphate, and RNase inhibitor (Roche Applied Science).
Detection of BRAF and ras mutations
Exons 11 and 15 of BRAF and codons 12/13 and 61 of N-ras, K-ras, or H-ras were analyzed by PCR and then sequenced at the DNA Sequencing Core Facility at M. D. Anderson Cancer Center. The primers for these BRAF exons and ras genes (synthesized by Sigma-Aldrich) were published previously and are summarized in Table 1 (13, 29, 30). Genomic DNA (100 ng) was used as a template in a 50-µL PCR mixture containing 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide triphosphates, and 1 U of advantage HF-2 (Clontech). Cycling conditions were as follows: initial denaturation (95°C for 2 min) and then 35 cycles (denaturation at 94°C for 30 s, annealing at 52–62°C for 30 s, and synthesis at 68°C for 30 s), followed by a final extension of 3 min at 68°C. All PCR products were visualized by electrophoresis on a 2% agarose gel and purified by using a QIAEX II gel extraction kit (QIAGEN). The positive control for BRAF mutation was a PTC cell line (NPA87), which was kindly provided by Dr. Jerome Hershman (Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles, CA).
Table 1.
Forward primer (5′→3′) | Reverse primer (5′→3′) | Size (bp) | Anneal T°C | |
---|---|---|---|---|
BRAF exon11 | TCCCTCTCAGGCATAAGGTAA | CGAACAGTGAATATTTCCTTTGAT | 313 | 58 |
BRAF exon15 | TCATAATGCTTGCTCTGATAGGA | GGCCAAAAATTTAATCAGTGGA | 224 | 58 |
Primer A+ D | ATTGTCATCTCGCCGTTC | CTTTCAGCATCTTCACGG | 306 | 55 |
Primer B+D | GAGGGAGCTTTGGAGAAC | CTTTCAGCATCTTCACGG | 266 | 55 |
Primer C+D | AAGCAAACCTGCCAGTGG | CTTTCAGCATCTTCACGG | 240 | 55 |
Nested A | ACAAACTGAAGTGCAAGGCA | GCCTTGACCACTACTTTTCCAAA | 151 | 55 |
Nested B | CTTTGATTTATGGAACACCG | ACTTTTCCAAATTCGCCTTC | 175 | 53 |
Nested C | CCTGCCAGTGGTTATCAAGC | GGCCACCGTGGTGTACCCTG | 219 | 58 |
Actin | CCTCCCTGGAGAAGAGCTACGAG | GACAGCACTGTGTTGGCGTACAG | 199 | 62 |
H-ras codon 12/13 | ATGACGGAATATAAGCTGGT | CCTTATAGTGGGGTCGTATT | 110 | 52 |
H-ras codon 61 | AGGTGGTCATTGATGGGGAG | AGGAAGCCCTCCCCGGTGCG | 109 | 62 |
K-ras codon 12/13 | GGCCTGCTGAAAATGACTGAA | GGTCCTGCACCAGTAATATGC | 166 | 62 |
K-ras codon 61 | CAGGATTCCTACAGGAAGCAAGTAG | CACAAAGAAAGCCCTCCCCA | 135 | 62 |
N-rascodon 12/13 | ATGACTGAGTACAAACTGGT | CTCTATGGTGGGATCATATT | 111 | 52 |
N-ras codon 61 | TCTTACAGAAAACAAGTGGT | GTAGAGGTTAATATCCGCAA | 174 | 62 |
Detection of RET/PTC rearrangements
Two sets of PCR primers (primers A–D and nested primers; Table 1) were synthesized by Integrated DNA Technologies, Inc., to detect the RET/PTC1 (primers A and D, and nested A), RET/PTC2 (primers B and D, and nested B), and RET/PTC3 (primers C and D, and nested C) rearrangements (13, 31). For PCR, 1 µL of RT mixture was amplified with 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide triphosphates, and 1.25 U of AmpliTaq Gold DNA polymerase (Applied Biosystems). Cycling conditions were as follows: initial denaturation (95°C for 9 min) and then 35 cycles (denaturation at 95°C for 30 s, annealing at 53–58°C for 30 s, and synthesis at 72°C for 30 sec), followed by a final extension of 7 min at 72°C. All PCR products were visualized by electrophoresis on a 2% agarose gel, and gel images were documented by Gel Doc XR (Bio-Rad). The positive control for RET/PTC1 was TPC-1, a PTC cell line obtained from Dr. Jerome Hershman. (Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles, CA). Plasmids containing the RET/PTC2 or RET/PTC3 cDNA were kindly provided by Dr. Sissy Jhiang (The Ohio State University, Columbus, OH) and were used as positive controls for RET/PTC2 and RET/PTC3, respectively. The negative control for the RET/PTC1 rearrangement was NPA87.
Statistical analysis
Standard χ2 test and Student’s t test were used. A P value of 0.05 or less was considered significant.
Results
Mutation status
To study the mutation status of recurrent PTC, we prepared genomic DNA and total RNA from the tumors of 54 patients who underwent surgery for recurrent disease at M. D. Anderson Cancer Center in the 1-year period beginning in September 2003.
Nested RT-PCR was used to detect the RET/PTC1, RET/PTC2, and RET/PTC3 rearrangements, which were identified in 9 of 54 samples (16.7%; Fig. 1A and B). The rearrangements included 1 sample with the RET/PTC1 rearrangement (Fig. 1A), 4 with the RET/PTC2 rearrangement (Fig. 1B), and 4 with the RET/PTC3 rearrangement (Fig. 1B).
To detect BRAF mutations, both exons 11 and 15 of BRAF were sequenced. A total of 42 of 54 samples (77.8%) showed a heterogeneous T to A substitution at nucleotide 1799 of BRAF and only the patients with dual mutation were shown (Fig. 1C). BRAF mutation was confirmed by sequencing both strands of DNA. No mutation in exon 11 of BRAF was detected in any of the samples.
Of all the samples containing RET/PTC rearrangements or a BRAF mutation, 5 samples (9.3%) contained both a BRAF mutation and a RET/PTC rearrangement (Fig. 1). To get an understanding of the molecular changes happening in these tumors with dual mutations, the mutation status in primary tumor specimen was also examined. We found BRAF mutation in all 5 primary tumors and no RET/PTC rearrangements were detected by nested RT-PCR (data not shown).
Mutations could not be detected in 8 of 54 samples. These samples were further tested for H-ras, N-ras, and K-ras (codons 12/13 and 61) mutations using genomic DNA and NTRK1 mutation using total RNA (data not shown). The only mutation found was a K-ras mutation at codon 61 (1 sample), resulting in conversion of a glutamine to lysine. Five of the 7 samples had a well-known silent single nucleotide polymorphism at nucleotide 81 (codon 27) of H-ras, changing T to C, but no other mutations were detected.
Correlation between mutation status and clinicopathologic variables
Base on their mutation status, this cohort of 54 patients with recurrent PTC was separated into 5 groups: BRAF mutation only, RET/PTC rearrangements only, BRAF mutation and RET/PTC rearrangement dual mutations, K-ras mutation only, or no detectable mutation (none). Patient’s gender and race of each group are listed in Table 2, and age makeup of each group is shown in Fig. 2. The stages of the primary PTC for these patients are listed in Table 3. All patients have received radio iodine treatment. Histologic features and stages of each patient’s recurrent carcinoma, along with the number of positive lymph nodes harvested and confirmed by a pathologist, and time span between primary tumor and recurrent tumor are listed in Table 4. The majority of patients in this cohort were Caucasian (Table 2), had no evidence of distance metastasis (M0; 98%; Table 4), and had metastasized to lymph nodes (N1; 63%; Table 3).
Table 2.
Mutations | BRAF | RET/PTC | BRAF & RET/PTC | K-ras | None |
---|---|---|---|---|---|
Patients | |||||
Total numbers | 37 | 4 | 5 | 1 | 7 |
Gender | |||||
Female | 26 | 1 | 2 | 1 | 5 |
Male | 11 | 3 | 3 | 0 | 2 |
Race | |||||
Caucasian | 26 | 4 | 4 | 0 | 5 |
Hispanic | 6 | 0 | 1 | 1 | 1 |
Asian | 4 | 0 | 0 | 0 | 0 |
Black | 0 | 0 | 0 | 0 | 1 |
Unknown | 1 | 0 | 0 | 0 | 0 |
Table 3.
Stage grouping | BRAF* | RET/PTC* | BRAF & RET/PTC* | K-ras | None* |
---|---|---|---|---|---|
Age <45 y | |||||
Stage I | 23 (62.2) | 2 (50.0) | 1 (20.0) | 0 | 4 (57.1) |
Stage II | 0 | 0 | 0 | 0 | 0 |
Stage III | 0 | 0 | 0 | 0 | 0 |
Stage IV | 0 | 0 | 0 | 0 | 0 |
Unknown | 1 | 0 | 0 | 0 | 0 |
Age ≥45 y | |||||
Stage I | 1 (2.7) | 0 | 0 | 0 | 0 |
Stage II | 2 (54) | 0 | 1 (20.0) | 0 | 2 (286) |
Stage III | 8 (21.6) | 1 (25.0) | 2 (40.0) | 1 | 1 (14.3) |
Stage IV | 0 | 0 | 1 (20.0) | 0 | 0 |
Unknown | 2 | 1 | 0 | 0 | 0 |
T stage | |||||
T1 | 1 (2.7) | 1 (25.0) | 1 (20.0) | 0 | 0 |
T2 | 14 (37.8) | 2 (50.0) | 0 | 0 | 2 |
T3 | 4 (10.8) | 0 | 0 | 0 | 2 |
T4 | 10 (27.0) | 0 | 4 (80.0) | 0 | 2 |
Unknown | 8 | 1 | 0 | 1 | 1 |
N stage | |||||
N0 | 9 (24.3) | 0 | 1 (20.0) | 0 | 3 |
N1 | 22 (59.5) | 3 (75.0) | 4 (80.0) | 1 | 4 |
Unknown | 6 | 1 | 0 | 0 | 0 |
Numbers in parentheses represent percentage in that type of mutation.
Table 4.
Mutations | BRAF | RET/PTC | BRAF & RET/PTC |
K-ras | None |
---|---|---|---|---|---|
Number of nodes positive | |||||
0–1 | 3 | 1 | 0 | 0 | 0 |
2–9 | 21 | 1 | 4 | 1 | 7 |
10–19 | 13 | 1 | 0 | 0 | 0 |
>20 | 0 | 1 | 1 | 0 | 0 |
Histologic subtype | |||||
Papillary | 37 | 4 | 4 | 1 | 6 |
Follicular | 0 | 0 | 1 | 0 | 0 |
Tall cell | 0 | 0 | 0 | 0 | 1 |
M stage | |||||
M0 | 37 | 4 | 4 | 1 | 7 |
M1 | 0 | 0 | 1 | 0 | 0 |
Time to recurrent/persistent | |||||
Years | 0.75–15 | 0.5–8 | 0.33–5 | 4 | 0.25–7 |
In the BRAF mutation only group (total 37 patients or 68.5% of all recurrent PTC patients), the majority of the patients were women (70.3%; Table 2) and younger than 45 years (62.2%; P < 0.001; Table 2; Fig. 2). In these patients with BRAF mutation only, most of their tumors were in T2 and T4 stages (37.8% in T2 and 27% in T4 Table 3). The time span between primary and recurrent PTC was between 0.75 and 15 years (Table 4).
Most patients with the RET/PTC rearrangements only (total 4 patients or 7.4% of all recurrent PTC patients) were men (75%; Table 2). In this group, all the tumors were T1 and T2 stages and no tumors were T3 or T4 stages (Table 3). The time span between primary and recurrent PTC was between 0.5 to 8 years (Table 4).
In the group of the patients with both a BRAF mutation and a RET/PTC rearrangement (total 5 patients or 9.3% of all recurrent PTC patients), patients were older (80% older than 45 years; Fig. 2). These patients had more advanced tumors (80% in T4) than those patients with BRAF mutation only (27% in T4; Table 3).
Discussion
The mutation status of patients with recurrent PTC has never been characterized in a large population. In this study, we focused on a specific group of thyroid carcinomas, recurrent PTC, and analyzed mutation status from a cohort of 54 consecutive patients from whom specimens were collected at M. D. Anderson Cancer Center between September 1, 2003, and August 31, 2004.
Most mutational studies on PTC have been done on primary disease. Only a few reports have mentioned recurrent PTC (32–34). Nakayama et al. (32) reported 14 cases of recurrent PTC, of which 85.7% had a BRAF mutation. The ages of these 14 patients were not mentioned in their study (32). In our cohort, BRAF mutation (V600E) was detected in 77.8% of tumor samples. We can conclude, therefore, that this is the major mutation in recurrent PTC. In fact, BRAF has become a diagnosis and, by some, a prognostic marker for primary PTC. BRAF mutation has been associated with poor outcomes in differentiated and/or undifferentiated cancers derived from primary PTC (5, 7, 9, 35–37). BRAF mutation has also been linked with advanced tumor stages (T3/T4 versus T1/T2) in primary PTC (8, 9, 38). However, in recurrent PTC, tumors with BRAF mutation only were evenly distributed between T3/T4 and T1/T2 stages (37.8% versus 40.5%, respectively).
The incidence of RET/PTC rearrangements in primary PTC is lower than that of BRAF mutation depending on the cohort studied (11, 12). Recent reviews on primary PTC have indicated that the frequency of RET/PTC rearrangements in PTC is at 20% (39, 40). We have also observed a low incidence (16.7%) of RET/PTC rearrangements in our recurrent PTC cohort. All three types of RET/PTC rearrangements (RET/PTC1, RET/PTC2, and RET/PTC3) were detected in recurrent PTC as well as in primary PTC as reported by others (11, 12). Several methods have been described for the detection of RET/PTC rearrangements, including nested RT-PCR, hybridizing RT-PCR products with an internal probe, Southern blotting, real-time RT-PCR, and fluorescence in situ hybridization (11–13, 41). The most sensitive method of all is the hybridization after RT-PCR with an internal probe, which can detect 1.5 to 5 cells with RET/PTC rearrangements, but the rearrangement cannot be confirmed by any other methods (41). With nested RT-PCR being the most popular method of choice, all the other methods confirm the results obtained by nested RT-PCR. We choose the nested RT-PCR method to detect all of the RET/PTC rearrangements in our study based on the fact that it is a simple and reliable method. However, we cannot exclude that RET/PTC rearrangements other than RET/PTC1, RET/PTC2, and RET/PTC3 exist in recurrent PTC population.
There are conflicting reports regarding the relationship of patient age and tumor stage in cases of primary PTC with BRAF mutation (8, 9, 32, 36, 38, 42). BRAF mutation in most primary PTC has been associated with greater patient age (32, 36). This is not the case in our cohort of recurrent PTC; most patients with BRAF mutation only (62.2%) were younger than 45 years. For patients younger than 45 years, RET/PTC rearrangements have been the most common type of the mutation in primary PTC (13–17). In our cohort of the recurrent PTC patients, RET/PTC rearrangements are uncommonly found (16.7% of total patients). These data suggested that recurrent PTC is likely a genetic selection event. Further studies with more patient samples are needed to confirm our findings and determine whether additional molecular events produce an increasing rate of recurrent PTC.
In most reported cases of PTC, BRAF mutation and RET/PTC rearrangements are considered as separated events in PTC without overlap (37, 43, 44). Recently, Zhu et al. (41) reported that both BRAF mutation and RET/PTC rearrangements were detected in the same primary PTC from 3 patients, in which RET/PTC rearrangements took place in <10% of tumor cells examined. Using immunohistochemistry, Xu et al. (45) detected increased expression of RET in a BRAF-mutated tumor. Of 54 recurrent PTC tested in this study, 5 (9.3%) had both mutations. Although the number of the patients with the dual mutations was lower than the numbers of patients with BRAF mutation only, it was observed in a much higher percentage than in all the primary PTC cases reported thus far. In addition, patients with the dual mutations are older and have more advanced tumors, with 80% having originally presented with T4 primary tumors. The methods we used to detect these mutations cannot distinguish whether the mutations were in the same cells or in different cells. After examining the primary tumors from the patients with dual mutations, we found that only one type of mutation (BRAF mutation) was present in the primary tumors. These data suggest that these patients acquired one mutation first for their primary PTC and then developed a second mutation during the course of their disease. In addition to BRAF mutation and RET/PTC rearrangement, ras mutations are rare in primary PTC. Ras mutations are found in only 10% to 30% of primary PTC (39, 40, 42, 46). We only found one recurrent PTC specimen containing a K-ras mutation.
Seven samples in our cohort had no detectable mutation in any genes analyzed. Whether these represent “false negative” or true negative is not known at this time. Several factors may contribute to the lower detection sensitivity (47). First, only 3 of 11 RET/PTC rearrangements were tested, although the other 8 RET/PTC rearrangements are rare. The inconsistent quality of RNA from paraffin-embedded tissues and unavailability of snap-frozen tissues from these patients were the main impediments to detection of RET/PTC rearrangements and NTRK1 rearrangements because detection of both rearrangements requires total RNA (48). Lastly, there are always potential limitations on the sensitivity of the detection method used.
In conclusion, our study provides basic information about the mutation status of recurrent PTC. The incidence and prevalence of PTC continues to increase, and a greater knowledge of the molecular development and regulation of these neoplasms is required if we are to advance our understanding and develop more therapies for these tumors.
Translational Relevance.
This study analyzed the mutation status of 54 patients with recurrent papillary thyroid carcinoma (PTC). This type of analysis has never been characterized in a large population for recurrent PTC. This study illustrates not only that BRAF mutation was detected in 77.8% of recurrent PTC but also that 9.3% of tumors contained dual mutations (a BRAF mutation and a RET/PTC rearrangement). Despite all the mutations published in the literature, rarely are dual mutations found in primary PTC. It has been accepted by others that only one mutation is needed to develop primary PTC. In addition, 62% of recurrent PTC patients younger than 45 years had BRAF mutation, whereas RET/PTC rearrangements are unquestionably the most common mutations in young patients with primary PTC. Our finding of simultaneous mutations suggested that the mechanism for developing more aggressive recurrent PTC may be different from that the more favorable well-differentiated primary PTC.
Acknowledgments
We thank Dr. Jerome Hershman (Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles, CA) for providing PTC cell lines; Dr. Sissy Jhiang (The Ohio State University, Columbus, OH) for providing positive controls for RET/PTC2 and RET/PTC3; Dr. Libero Santarpia for analyzing patient data; Dr. Dianna Roberts for statistic analysis; Kathryn Hale for reviewing and text editing; Dr. Asha Multani, Dr. Rui Wang, Joie Haviland, Yan Cai, and Cynthia Anderson for technical support.
Grant support: NIH Independent Award R01 DE-13954, NIH Specialized Program of Research Excellence grant in Head and Neck Cancer 1P50-CA-97007, and National Cancer Institute Cancer Center Support Grant CA16672.
Footnotes
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
References
- 1.Ain KB. Papillary thyroid carcinoma. Etiology, assessment, and therapy. Endocrinol Metab Clin North Am. 1995;24:711–760. [PubMed] [Google Scholar]
- 2.Bilimoria KY, Bentrem DJ, Ko CY, et al. Extent of surgery affects survival for papillary thyroid cancer. Ann Surg. 2007;246:375–381. doi: 10.1097/SLA.0b013e31814697d9. discussion 81–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ortiz S, Rodriguez JM, Parrilla P, et al. Recurrent papillary thyroid cancer: analysis of prognostic factors including the histological variant. Eur J Surg. 2001;167:406–412. doi: 10.1080/110241501750243734. [DOI] [PubMed] [Google Scholar]
- 4.Robbins J, Merino MJ, Boice JD, Jr., et al. Thyroid cancer: a lethal endocrine neoplasm. Ann Intern Med. 1991;115:133–147. doi: 10.7326/0003-4819-115-2-133. [DOI] [PubMed] [Google Scholar]
- 5.Xing M. BRAF mutation in thyroid cancer. Endocr Relat Cancer. 2005;12:245–262. doi: 10.1677/erc.1.0978. [DOI] [PubMed] [Google Scholar]
- 6.Wellbrock C, Karasarides M, Marais R. The RAF proteins take centre stage. Nat Rev Mol Cell Biol. 2004;5:875–885. doi: 10.1038/nrm1498. [DOI] [PubMed] [Google Scholar]
- 7.Wojciechowska K, Lewinski A. BRAF mutations in papillary thyroid carcinoma. Endocr Regul. 2006;40:129–138. [PubMed] [Google Scholar]
- 8.Lupi C, Giannini R, Ugolini C, et al. Association of BRAF V600E mutation with poor clinicopathological outcomes in 500 consecutive cases of papillary thyroid carcinoma. J Clin Endocrinol Metab. 2007;92:4085–4090. doi: 10.1210/jc.2007-1179. [DOI] [PubMed] [Google Scholar]
- 9.Xing M, Westra WH, Tufano RP, et al. BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. J Clin Endocrinol Metab. 2005;90:6373–6379. doi: 10.1210/jc.2005-0987. [DOI] [PubMed] [Google Scholar]
- 10.Puxeddu E, Moretti S. Clinical prognosis in BRAF-mutated PTC. Arq Bras Endocrinol Metabol. 2007;51:736–747. doi: 10.1590/s0004-27302007000500011. [DOI] [PubMed] [Google Scholar]
- 11.Jhiang SM. The RET proto-oncogene in human cancers. Oncogene. 2000;19:5590–5597. doi: 10.1038/sj.onc.1203857. [DOI] [PubMed] [Google Scholar]
- 12.Jhiang SM, Mazzaferri EL. The ret/PTC oncogene in papillary thyroid carcinoma. J Lab Clin Med. 1994;123:331–337. [PubMed] [Google Scholar]
- 13.Tallini G, Santoro M, Helie M, et al. RET/PTC oncogene activation defines a subset of papillary thyroid carcinomas lacking evidence of progression to poorly differentiated or undifferentiated tumor phenotypes. Clin Cancer Res. 1998;4:287–294. [PubMed] [Google Scholar]
- 14.Nakazawa T, Kondo T, Kobayashi Y, et al. RET gene rearrangements (RET/PTC1 and RET/PTC3) in papillary thyroid carcinomas from an iodine-rich country (Japan) Cancer. 2005;104:943–951. doi: 10.1002/cncr.21270. [DOI] [PubMed] [Google Scholar]
- 15.Fenton CL, Lukes Y, Nicholson D, Dinauer CA, Francis GL, Tuttle RM. The ret/PTC mutations are common in sporadic papillary thyroid carcinoma of children and young adults. J Clin Endocrinol Metab. 2000;85:1170–1175. doi: 10.1210/jcem.85.3.6472. [DOI] [PubMed] [Google Scholar]
- 16.Elisei R, Romei C, Vorontsova T, et al. RET/PTC rearrangements in thyroid nodules: studies in irradiated and not irradiated, malignant and benign thyroid lesions in children and adults. J Clin Endocrinol Metab. 2001;86:3211–3216. doi: 10.1210/jcem.86.7.7678. [DOI] [PubMed] [Google Scholar]
- 17.Nikiforov YE, Rowland JM, Bove KE, et al. Distinct pattern of ret oncogene rearrangements in morphological variants of radiation-induced and sporadic thyroid papillary carcinomas in children. Cancer Res. 1997;57:1690–1694. [PubMed] [Google Scholar]
- 18.Grieco M, Santoro M, Berlingieri MT, et al. PTC is a novel rearranged form of the ret proto-oncogene and is frequently detected in vivo in human thyroid papillary carcinomas. Cell. 1990;60:557–563. doi: 10.1016/0092-8674(90)90659-3. [DOI] [PubMed] [Google Scholar]
- 19.Bongarzone I, Monzini N, Borrello MG, et al. Molecular characterization of a thyroid tumor-specific transforming sequence formed by the fusion of ret tyrosine kinase and the regulatory subunit RIα of cyclic AMP-dependent protein kinase A. Mol Cell Biol. 1993;13:358–366. doi: 10.1128/mcb.13.1.358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Santoro M, Dathan NA, Berlingieri MT, et al. Molecular characterization of RET/PTC3; a novel rearranged version of the RET proto-oncogene in a human thyroid papillary carcinoma. Oncogene. 1994;9:509–516. [PubMed] [Google Scholar]
- 21.Beimfohr C, Klugbauer S, Demidchik EP, et al. NTRK1 re-arrangement in papillary thyroid carcinomas of children after the Chernobyl reactor accident. Int J Cancer. 1999;80:842–847. doi: 10.1002/(sici)1097-0215(19990315)80:6<842::aid-ijc7>3.0.co;2-z. [DOI] [PubMed] [Google Scholar]
- 22.Brzezianska E, Karbownik M, Migdalska-Sek M, Pastuszak-Lewandoska D, Wloch J, Lewinski A. Molecular analysis of the RET and NTRK1 gene rearrangements in papillary thyroid carcinoma in the Polish population. Mutat Res. 2006;599:26–35. doi: 10.1016/j.mrfmmm.2005.12.013. [DOI] [PubMed] [Google Scholar]
- 23.Frattini M, Ferrario C, Bressan P, et al. Alternative mutations of BRAF, RET and NTRK1 are associated with similar but distinct gene expression patterns in papillary thyroid cancer. Oncogene. 2004;23:7436–7440. doi: 10.1038/sj.onc.1207980. [DOI] [PubMed] [Google Scholar]
- 24.Giordano TJ, Kuick R, Thomas DG, et al. Molecular classification of papillary thyroid carcinoma: distinct BRAF, RAS, and RET/PTC mutation-specific gene expression profiles discovered by DNA microarray analysis. Oncogene. 2005;24:6646–6656. doi: 10.1038/sj.onc.1208822. [DOI] [PubMed] [Google Scholar]
- 25.Sugg SL, Ezzat S, Zheng L, Freeman JL, Rosen IB, Asa SL. Oncogene profile of papillary thyroid carcinoma. Surgery. 1999;125:46–52. [PubMed] [Google Scholar]
- 26.Naito H, Pairojkul C, Kitahori Y, et al. Different ras gene mutational frequencies in thyroid papillary carcinomas in Japan and Thailand. Cancer Lett. 1998;131:171–175. doi: 10.1016/s0304-3835(98)00149-9. [DOI] [PubMed] [Google Scholar]
- 27.Hedinger C, Williams ED, Sobin LH, Hedinger C, Williams ED, Sobin LH. The WHO histological classification of thyroid tumors: a commentary on the second edition. Cancer. 1989;63:908–911. doi: 10.1002/1097-0142(19890301)63:5<908::aid-cncr2820630520>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
- 28.Rosai J, Carcangiu ML, Delellis RA. Tumors of the Thyroid Gland. Atlas of tumor pathology, third series; fasc 5. Washington (DC): Armed Forces Institute of Pathology; 1992. pp. 65–122. [Google Scholar]
- 29.Davies H, Bignell GR, Cox C, et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417:949–954. doi: 10.1038/nature00766. [DOI] [PubMed] [Google Scholar]
- 30.Di Cristofaro J, Marcy M, Vasko V, et al. Molecular genetic study comparing follicular variant versus classic papillary thyroid carcinomas: association of N-ras mutation in codon 61 with follicular variant. Hum Pathol. 2006;37:824–830. doi: 10.1016/j.humpath.2006.01.030. [DOI] [PubMed] [Google Scholar]
- 31.Chua EL, Wu WM, Tran KT, et al. Prevalence and distribution of ret/ptc 1, 2, and 3 in papillary thyroid carcinoma in New Caledonia and Australia. J Clin Endocrinol Metab. 2000;85:2733–2739. doi: 10.1210/jcem.85.8.6722. [DOI] [PubMed] [Google Scholar]
- 32.Nakayama H, Yoshida A, Nakamura Y, et al. Clinical significance of BRAF (V600E) mutation and Ki-67 labeling index in papillary thyroid carcinomas. Anticancer Res. 2007;27:3645–3649. [PubMed] [Google Scholar]
- 33.Grigsby PW, Baglan K, Siegel BA. Surveillance of patients to detect recurrent thyroid carcinoma. Cancer. 1999;85:945–951. doi: 10.1002/(sici)1097-0142(19990215)85:4<945::aid-cncr24>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
- 34.Biscolla RP, Cerutti JM, Maciel RM. Detection of recurrent thyroid cancer by sensitive nested reverse transcription-polymerase chain reaction of thyroglobulin and sodium/iodide symporter messenger ribonucleic acid transcripts in peripheral blood. J Clin Endocrinol Metab. 2000;85:3623–3627. doi: 10.1210/jcem.85.10.6876. [DOI] [PubMed] [Google Scholar]
- 35.Brzezianska E, Pastuszak-Lewandoska D, Wojciechowska K, et al. Investigation of V600E BRAF mutation in papillary thyroid carcinoma in the Polish population. Neuro Endocrinol Lett. 2007;28:351–359. [PubMed] [Google Scholar]
- 36.Kebebew E, Weng J, Bauer J, et al. The prevalence and prognostic value of BRAF mutation in thyroid cancer. Ann Surg. 2007;246:466–470. doi: 10.1097/SLA.0b013e318148563d. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63:1454–1457. [PubMed] [Google Scholar]
- 38.Namba H, Nakashima M, Hayashi T, et al. Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J Clin Endocrinol Metab. 2003;88:4393–4397. doi: 10.1210/jc.2003-030305. [DOI] [PubMed] [Google Scholar]
- 39.Nikiforova MN, Nikiforov YE. Molecular genetics of thyroid cancer: implications for diagnosis, treatment and prognosis. Expert Rev Mol Diagn. 2008;8:83–95. doi: 10.1586/14737159.8.1.83. [DOI] [PubMed] [Google Scholar]
- 40.Nikiforov YE. Thyroid carcinoma: molecular pathways and therapeutic targets. Mod Pathol. 2008;21 Suppl 2:S37–S43. doi: 10.1038/modpathol.2008.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Zhu Z, Ciampi R, Nikiforova MN, Gandhi M, Nikiforov YE. Prevalence of RET/PTC rearrangements in thyroid papillary carcinomas: effects of the detection methods and genetic heterogeneity. J Clin Endocrinol Metab. 2006;91:3603–3610. doi: 10.1210/jc.2006-1006. [DOI] [PubMed] [Google Scholar]
- 42.Puxeddu E, Moretti S, Elisei R, et al. BRAF(V599E) mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. J Clin Endocrinol Metab. 2004;89:2414–2420. doi: 10.1210/jc.2003-031425. [DOI] [PubMed] [Google Scholar]
- 43.Ciampi R, Nikiforov YE. RET/PTC rearrangements and BRAF mutations in thyroid tumorigenesis. Endocrinol. 2007;148:936–941. doi: 10.1210/en.2006-0921. [DOI] [PubMed] [Google Scholar]
- 44.Soares P, Trovisco V, Rocha AS, et al. BRAF mutations and RET/PTC rearrangements are alternative events in the etiopathogenesis of PTC. Oncogene. 2003;22:4578–4580. doi: 10.1038/sj.onc.1206706. [DOI] [PubMed] [Google Scholar]
- 45.Xu X, Quiros RM, Gattuso P, Ain KB, Prinz RA. High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res. 2003;63:4561–4567. [PubMed] [Google Scholar]
- 46.Wright PA, Lemoine NR, Mayall ES, et al. Papillary and follicular thyroid carcinomas show a different pattern of ras oncogene mutation. Br J Cancer. 1989;60:576–577. doi: 10.1038/bjc.1989.316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Fagin JA. Challenging dogma in thyroid cancer molecular genetics-role of RET/PTC and BRAF in tumor initiation. J Clin Endocrinol Metab. 2004;89:4264–4266. doi: 10.1210/jc.2004-1426. [DOI] [PubMed] [Google Scholar]
- 48.Musholt TJ, Musholt PB, Khaladj N, Schulz D, Scheumann GF, Klempnauer J. Prognostic significance of RET and NTRK1 rearrangements in sporadic papillary thyroid carcinoma. Surgery. 2000;128:984–993. doi: 10.1067/msy.2000.110845. [DOI] [PubMed] [Google Scholar]