Abstract
Re-emergence of schistosomiasis in regions of China where control programs have ceased requires development of molecular-genetic tools to track gene flow and assess genetic diversity of Schistosoma populations. We identified many microsatellite loci in the draft genome of Schistosoma japonicum using defined search criteria and selected a subset for further analysis. From an initial panel of 50 loci, 20 new microsatellites were selected for eventual optimization and application to a panel of worms from endemic areas. All but one of the selected microsatellites contain simple tri-nucleotide repeats. Moderate to high levels of polymorphism were detected. Numbers of alleles ranged from 6 to 14 and observed heterozygosity was always >0.6. The loci reported here will facilitate high resolution population-genetic studies on schistosomes in re-emergent foci.
Findings
The Asian bloodfluke, Schistosoma japonicum, causes serious human disease in several parts of eastern Asia, and in particular in China where more than 30 million people living in the tropical and subtropical zones are at risk [1]. On the heels of widespread progress in controlling S. japonicum over the past two decades [2], China is facing the challenges posed by re-emergence of schistosomiasis in localities where control activities have nearly ceased and where apparent elimination had been achieved [2,3]. In comparison to traditional assessment methods, molecular tools will be increasingly important as China targets regions with low prevalence and low infection intensity for elimination [4-6] on the path to reducing schistosome infection to less than 1% by 2015 [2]. Such tools will be important for high-resolution monitoring of infections in snails and in mammalian hosts, elucidating transmission networks, and improving the targeting of interventions to achieve final elimination of the disease.
This important pathogen has already received attention from population geneticists using microsatellites [7,8]. Most of the loci used had been found by examination of the GenBank accessions for S. japonicum data existing at that time or through testing of primers that amplified microsatellite loci in another bloodfluke, S. mansoni. A near-complete draft genome of S. japonicum has been released by the Chinese Human Genome Center in Shanghai [9] and the raw data are available at http://lifecenter.sgst.cn/schistosoma/cn/schistosomaCnIndexPage.do. An earlier study [10] reported 17 loci from this resource. In this study we report on additional loci suitable for research into gene flow in S. japonicum in Sichuan Province. Results of this search are presented here. We searched this resource for microsatellite loci using the following criteria:
• Repeats should be 2, 3 or 4-mer,
• The number of tandem repeats should be in the range 10-25,
• Loci should not include compound repeats,
• Loci should be flanked by single-copy DNA sequences to which PCR primers could be targeted,
• Loci should be far apart so as to avoid linkage disequilibrium. In practice, since chromosomal assignment of super-contigs is unknown as yet, loci were selected from different super-contigs,
• Loci should not be in, or close to, known or predicted coding regions.
The search was undertaken using the software SciRoKo [11]. Following the above criteria, we identified 72 new loci for which primers were designed and synthesized. For 30 loci showing a single band of the correct size in a preliminary screening using an agarose gel, new forward primers were synthesized to permit M13 tailing [12,13]. All 30 loci were then used for genotyping of ten adult worms. Loci failing to provide clear signals in the expected size range, or that lacked polymorphism, were not considered further. Finally 20 new loci, plus two from [10], were optimized for PCR and used in the genotyping of 20 individual adult worms. Primer annealing temperatures were designed to be very similar with eventual multiplexing in mind.
The Sichuan Center for Disease Control and Prevention (SCDC) maintains S. japonicum lifecycles, including S. japonicum from infected snails sourced from Hubei and Anhui Provinces passed through rabbit hosts. For this study, existing samples were obtained from SCDC of adult schistosomes that were derived from a single passage of mixed Hubei and Anhui cercariae through a definitive host. Genomic DNA was extracted from 10 individual male and 10 female worms by incubation in hot sodium hydroxide with pH adjustment using a Tris solution (HotSHOT) [14]. The lysates were used as templates for PCR directly. Each worm was genotyped individually.
All PCRs were carried out in a 10 μl reaction mixture containing 0.5 μl of template DNA (about 17.5 ng), 0.5 μM of each primer but 0.125 μM of any forward primer with an M13 tail, and 5 μl of 2X GoTaq Green Master Mix (Promega Corporation, WI, USA). For PCR amplification, templates were denatured at 94°C for 5 minutes followed by 30 cycles (94°C 30 seconds, 55°C 45 seconds, 72°C 45 seconds), and then by 8 cycles ( 94°C 30 seconds, 53°C 45 seconds, 72°C 45 seconds), and a final extension at 72°C for 10 minutes. PCR products were separated using an ABI 3130 XL automated DNA sequencer with ABI GS500 LIZ internal size standards. Results were read in GeneMapper 4.0 software (Applied Biosystems).
Estimates of heterozygosity were made, tests conducted for Hardy-Weinberg equilibrium and linkage disequilibrium, and alleles counted. The software package GenAlEx [15] was used for most data analysis. Micro-Checker [16] was used to identify loci at which null (non-amplifying) alleles might be present. Use of the Bonferroni-adjusted 95% confidence interval indicates that null alleles may occur only at locus SjP9, one of the loci reported by [10].
Table 1 presents the findings for each locus, including numbers of alleles and observed heterozygosity (H). Observed heterozygosity (Ho) at all loci was high, never below 0.6. A few loci deviated significantly from Hardy Weinberg expectations (Table 1), including SjP9 at which null alleles were suspected. Surprisingly, many pairs of loci were in linkage disequilibrium (data not shown). We consider this to be a consequence of the fact that adult worms were derived from pooled cercariae from infected snails: each snail is likely to yield many sibling/clonal cercariae, resulting in significant linkage disequilibrium (e.g. [10]). The pooling of cercariae from two distinct populations is likely to increase this effect. Previous workers [7] noted a high frequency of linkage disequilibrium in S. japonicum and considered it due to inbreeding and non-random mating.
Table 1.
Primer sequences and other characteristics for each of 22 microsatellite loci amplified from 20 specimens of Schistosoma japonicum
| Locus name | Primer sequences (tails removed) | Repeat unit | Length of locus in Sj Genome draft (excl tails) | Length range (PCR product - bp excl tail) | No. of alleles | In HWE? | Ho | He |
|---|---|---|---|---|---|---|---|---|
| SjP4 | F:ACAAGCTCCAATCGTCTCTGA R:GAATACTGCCGCCCTTGTAA | TAA | 217 | 182-244 | 14 | 0.789 | 0.831 | |
| SjP9 | F:GATGAAACAGATACCCAGCAC R:TGCATGTAAAAATGGCTTGC | TAA | 283 | 239-301 | 14 | ** | 0.600 | 0.915 |
| SjP18 | F:TCCTTTATCTGGGCTGTGGA R:TTTCAGCAGGATAACATGACG | TGA | 286 | 261-298 | 7 | 0.684 | 0.703 | |
| SjP19 |
F:GGTATCTTCGCTTTTTAGCATGG R:TCCTAGGGTGTGGTATCAGAG |
ATT | 196 | 161-257 | 12 | ** | 0.737 | 0.896 |
| SjP22 | F:CAAAGCCTAAACGTCATAGACAG R:CAACCACCGATAAGTAGAGTGGA | TTA | 150 | 105-167 | 11 | * | 0.850 | 0.892 |
| SjP23 | F:GTACGATATGAGGGAAAGTTCA R:CTCTCCTTCAGACGAATTGAG | TAA | 219 | 192-253 | 14 | 1.00 | 0.933 | |
| SjP26 | F:CAAGGGAACATTGTACATGAAG R:TGGTAAAGGAGAAAGTGAACG | TAA | 307 | 229-312 | 7 | 0.700 | 0.659 | |
| SjP28 | F:TAACGCCTTTTCCCACATTC R:ATAACCACGATGGGAACCAA | TTA | 242 | 232-269 | 13 | ** | 0.900 | 0.926 |
| SjP32 | F:TGTCACCGAGTCTTCATTAGC R:ACAGTCAGTAGACCTGGATAAAC | TTA | 175 | 142-192 | 14 | 0.950 | 0.929 | |
| SjP34 | F:GGCGACCATACATAAGGAGAAT R:GACCGATTTCTAATGGAGCA | TAA | 409 | 381-430 | 13 | * | 0.778 | 0.908 |
| SjP37 | F:TCCTTGACACGAGGTACATGT R:ATTACGTAACAGAAGGCTGGA | TAT | 290 | 240-314 | 8 | 0.833 | 0.714 | |
| SjP39 | F:GACGACTGTTAAGTCCATCTGA R:ATAACCAATCTCCACGAAAGC | ATT | 239 | 223-251 | 8 | 0.900 | 0.871 | |
| SjP42 | F:GCTGCAGCTTCTGTGTAGTAA R:GTCTTGCTCAGATCAGTTCGT | TAA | 216 | 199-234 | 9 | 0.950 | 0.855 | |
| SjP43 | F:ACAATGGCTATTGGTTGAGTAG R:GGAGCATGCGTATATGGAAAA | TAA | 188 | 184-235 | 9 | 0.750 | 0.854 | |
| SjP45 | F:ATAACACCGAATCTGTTCAGC R:TAATCCGGTCAGGATGTATGT | TAT | 156 | 150-244 | 13 | 0.850 | 0.921 | |
| SjP48 | F:TTGTTGGGTAGTGATGGTAGG R:TAGTTCATTCCACCTCTTGGA | TAA | 246 | 251-273 | 6 | 0.650 | 0.795 | |
| SjP54 | F:TTAGGCTTGTTGGTGCTGATA R:AGGTAAAGCAAATCCCATAGC | GGTA | 437 | 373-446 | 9 | 1.00 | 0.712 | |
| SjP58 | F:TCCCAGTACCAATGTAGATGTG R:CTAATAAAGTCGTCAAGGAGCA | AAT | 227 | 439-499 | 12 | ** | 0.800 | 0.921 |
| SjP60 | F:CGATTCATTCATAGCCTGACT R:GAATCCCATCACAGATTAACG | TAT | 155 | 134-165 | 10 | 0.900 | 0.867 | |
| SjP61 | F:TCATCTTGTCACCAACTAGGC R:GCTTGGAGGAGGCTAAAATAC | TAT | 188 | 158-238 | 9 | 0.700 | 0.679 | |
| SjP63 | F:ACCGCCACTACCACTAACCTCA R:TTGACCTGAAATCTGTCCCTA | TAA | 390 | 333-389 | 13 | ** | 0.800 | 0.904 |
| SjP88 | F:GCTTTCCAGGCATAAACTTCAC R:TCTCCTAATGATGGGAACAG | TAA | 408 | 380-417 | 9 | 0.950 | 0.887 | |
The loci presented here are likely to be specific for S. japonicum. Blast searches of the draft genome of S. mansoni (http://www.sanger.ac.uk/Projects/S_mansoni/) failed to find any matches that would indicate conservation of flanking regions in both species (not shown). Searches of the draft genome of S. japonicum yielded only a single "hit" for each locus.
The microsatellite loci reported here are, with one exception (SjP54), perfect trinucleotide repeats, making scoring easier than for dinucleotide and/or compound repeats. The diversity of alleles and genotypes present in the populations we sampled demonstrate the utility of these markers for future studies on epidemiology of S. japonicum in eastern Asia. Finally, the obvious genetic diversity within field populations of S. japonicum in China demonstrated by these polymorphic microsatellite loci confirms the recent report of marked genetic diversity in this parasite detected by analysis of the S. japonicum transcriptome and proteome [4].
Authors' contributions
NX, JR, PB and DB conceived of and designed the study, and were assisted by DQ and RS who coordinated the study. NX and YL carried out the molecular genetic studies, and were assisted by JR, PB and DB in analysing the results. NX, JR, PB and DB drafted the manuscript. All authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Contributor Information
Ning Xiao, Email: ningxiao116@yahoo.com.cn.
Justin Remais, Email: jremais@emory.edu.
Paul J Brindley, Email: mtmpjb@gwumc.edu.
Dongchuan Qiu, Email: qiudongchuan@yahoo.com.cn.
Robert Spear, Email: spear@berkeley.edu.
Yang Lei, Email: jysyck@sina.com.
David Blair, Email: david.blair@jcu.edu.au.
Acknowledgements
The authors wish to thank Kang Junxing, Director of the Sichuan Center for Disease Control and Prevention (Chengdu, People's Republic of China) for his continued support and collaboration. The authors also wish to acknowledge Zhong Bo, Ye Hong, Cui Lina, Chen Lin, Zhang Yi, Meng Xianhong of the Sichuan Center for Disease Control and Prevention for their contribution to the laboratory work. This work was supported in part by the NIH/NSF Ecology of Infectious Disease Program (grant no. 0622743) and the Emory Global Health Institute. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- McManus DP, Gray DJ, Li YS, Feng Z, Williams GM, Stewart D, Rey-Ladino J, Ross AG. Schistosomiasis in the People's Republic of China: the era of the Three Gorges Dam. Clin Microbiol Rev. 2010;23:442–466. doi: 10.1128/CMR.00044-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou XN, Guo JG, Wu XH, Jiang QW, Zheng J, Dang H, Wang XH, Xu J, Zhu HQ, Wu GL, Li YS, Xu XJ, Chen HG, Wang TP, Zhu NQ, Xia G, Wang LY, Zhang SQ, Lin DD, Chen MG, Hao Y. Epidemiology of schistosomiasis in the People's Republic of China, 2004. Emerg Infect Dis. 2007;13:1470–1476. doi: 10.3201/eid1310.061423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liang S, Yang CH, Zhong B, Qiu DC. Re-emerging schistosomiasis in hilly and mountainous areas of Sichuan, China. Bull World Health Organ. 2006;84:139–144. doi: 10.2471/BLT.05.025031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu F, Lu J, Hu W, Wang SY, Cui SJ, Chi M, Yan Q, Wang XR, Song HD, Xu XN, Wang JJ, Zhang XL, Zhang X, Wang ZQ, Xue CL, Brindley PJ, McManus DP, Feng Z, Chen Z, Han ZG. Comparative transcriptomic and proteomic analyses of the human blood fluke, Schistosoma japonicum. PLoS Pathogens. 2006;2:e29. doi: 10.1371/journal.ppat.0020029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu J, Rong R, Zhang HQ, Shi CJ, Zhu XQ, Xia CM. Sensitive and rapid detection of Schistosoma japonicum DNA by loop-mediated isothermal amplification (LAMP) Int J Parasitol. 2010;40:327–331. doi: 10.1016/j.ijpara.2009.08.010. [DOI] [PubMed] [Google Scholar]
- Hung YW, Remais J. Quantitative Detection of Schistosoma japonicum Cercariae in Water by Real-Time PCR. PLoS Negl Trop Dis. 2008;2:e337. doi: 10.1371/journal.pntd.0000337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shrivastava J, Qian BZ, McVean G, Webster JP. An insight into the genetic variation of Schistosoma japonicum in mainland China using DNA microsatellite markers. Mol Ecol. 2005;14:839–849. doi: 10.1111/j.1365-294X.2005.02443.x. [DOI] [PubMed] [Google Scholar]
- Shrivastava J, Barker GC, Johansen MV, Zhou XN, Aligui GD, McGarvey ST, Webster JP. Isolation and characterization of polymorphic DNA microsatellite markers from Schistosoma japonicum. Mol Ecol Notes. 2003;3:406–408. doi: 10.1046/j.1471-8286.2003.00466.x. [DOI] [Google Scholar]
- Schistosoma japonicum Genome Sequencing and Functional Analysis Consortium. The Schistosoma japonicum genome reveals features of host-parasite interplay. Nature. 2009;460:345–351. doi: 10.1038/nature08140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin M, Hu W, Mo X, Wang SY, Brindley PJ, McManus DP, Davis GM, Feng Z, Blair D. Multiple near-identical genotypes of Schistosoma japonicum can occur in snails and have implications for population-genetic analyses. Int J Parasitol. 2008;38:1681–1691. doi: 10.1016/j.ijpara.2008.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kofler R, Schlotterer C, Lelley T. SciRoKo: a new tool for whole genome microsatellite search and investigation. Bioinformatics. 2007;23:1683–1685. doi: 10.1093/bioinformatics/btm157. [DOI] [PubMed] [Google Scholar]
- Schuelke M. An economic method for the fluorescent labeling of PCR fragments. Nature Biotech. 2000;18:233–234. doi: 10.1038/72708. [DOI] [PubMed] [Google Scholar]
- Bandelj D, Jakse J, Javornik B. Amplification of fluorescent-labelled microsatellite markers in olives by a novel, economic method. Acta Agric Slovenica. 2004;83:323–329. [Google Scholar]
- Truett E, Mynatt LR, Truett AA, Walker AJ, Warman LM. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and Tris (HotSHOT) BioTechniques. 2000;29:52–54. doi: 10.2144/00291bm09. [DOI] [PubMed] [Google Scholar]
- Peakall R, Smouse PE. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes. 2006;6:288–295. doi: 10.1111/j.1471-8286.2005.01155.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4:535–538. doi: 10.1111/j.1471-8286.2004.00684.x. [DOI] [Google Scholar]
