Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Feb 28.
Published in final edited form as: Biol Reprod. 2008 Feb 14;78(6):1064–1072. doi: 10.1095/biolreprod.107.063743

Matrix Metalloproteinase 9 (MMP9) Expression in Preeclamptic Decidua and MMP9 Induction by Tumor Necrosis Factor Alpha and Interleukin 1 Beta in Human First Trimester Decidual Cells1

Charles J Lockwood 3, Ceyda Oner 3, Yesim H Uz 3,4, Umit A Kayisli 3, S Joseph Huang 3, Lynn F Buchwalder 3, William Murk 3, Edmund F Funai 3, Frederick Schatz 3,2
PMCID: PMC3045968  NIHMSID: NIHMS104137  PMID: 18276934

Abstract

Extravillous trophoblasts (EVTs) invade human decidua via sequential integrin-mediated binding and proteolysis of basement membrane proteins in the extracellular matrix (ECM). In preeclampsia, shallow EVT invasion impairs spiral artery and arteriole remodeling to reduce uteroplacental blood flow. Excess decidual cell-expressed matrix metalloproteinases (MMPs) 2 and 9, in response to preeclampsia-related interleukin 1 beta (IL1B) and tumor necrosis factor alpha (TNF), may inappropriately degrade these basement membrane proteins and impede EVT invasion. This study found significantly higher immunohistochemical MMP9 levels in decidual cells and adjacent interstitial trophoblasts in placental sections of preeclamptic versus gestational age-matched control women. In contrast, immunostaining for MMP2 and tissue inhibitor of matrix metalloproteinases 1 and 2 (TIMP1 and TIMP2) were similar in preeclamptic and control groups. First-trimester decidual cells were incubated with estradiol (E2) or E2 + medroxyprogesterone acetate (MPA), with or without TNF or IL1B. As measured by ELISA, both cytokines elicited concentration-dependent increases in secreted MMP9 levels that were unaffected by MPA. In contrast, secreted levels of MMP2, TIMP1, and TIMP2 were unchanged in all treatment groups. Substrate gel zymography and Western blotting confirmed that each cytokine increased secreted levels of MMP9 but not MMP2. Similarly, quantitative RT-PCR found that TNF and IL1B enhanced MMP9, but not MMP2, mRNA levels. At the implantation site, inflammatory cytokine-enhanced MMP9 may promote preeclampsia by disrupting the decidual ECM to interfere with normal stepwise EVT invasion.

Keywords: cytokines, decidua, extracellular matrix, matrix metalloproteinase, pregnancy

Introduction

Progesterone transforms estradiol (E2)-primed human endometrial stromal cells into decidual cells in the luteal phase of the menstrual cycle and during gestation [1, 2]. Decidualization involves conversion of the follicular-phase interstitial extracellular matrix (ECM) to a peridecidual ECM enriched in basement membrane-type components [3–5]. Extravillous trophoblasts (EVTs) penetrate the decidua and then breach its capillaries to provide the embryo with oxygen and nutrients prior to placentation [6]. Subsequently, EVTs traverse the decidua and penetrate into the myometrium. Migrating EVTs enter and remodel spiral arteries and arterioles [7, 8] to create low-resistance, high-capacitance vessels that increase blood flow to the intervillous space required for growth and development of the fetoplacental unit [8].

Invasion of the decidua involves sequential attachment of EVT-expressed adhesion molecules, such as the integrins (ITGs) ITG alpha 1/ITG beta 1 and ITG alpha 5/ITG beta 1, which recognize laminin/collagen IV and fibronectin, respectively, in the decidual ECM [3, 4, 9], as well as vascular endothelial cadherin, an endothelial cell receptor [10]. A dysregulated pattern of decidual adhesion molecule expression is associated with shallow EVT invasion and incomplete vascular transformation [11]. The resulting reduced uteroplacental blood flow produces a placenta that becomes hypoxic [12] and secretes several putative inducers of endothelial cell activation and vascular damage into the maternal circulation (reviewed in Karumanchi and Bdolah [13] and Borzychowki et al. [14]). Ultimately, hypertension and proteinuria, the hallmarks of the maternal syndrome, ensue [15, 16].

The decidual ECM composition reflects a balance between new basement membrane protein synthesis and ECM-degrading protease expression. The matrix metalloproteinases (MMPs) are a family of zinc-dependent proteases that bear the primary responsibility for degrading the bulk of ECM components. Members of this family are generally classified on the basis of substrate specificity and include collagenases, which mediate proteolysis of fibrillar collagens; stromelysins, which can degrade an extremely broad array of ECM components and activate the zymogenic form of other MMPs; and gelatinases, which degrade denatured fibrillar collagens (gelatins) as well as basement membrane-associated proteins [17–19] Members of all three MMP classes, as well as tissue inhibitors of MMPs (TIMPs), are expressed by human endometrial stromal/decidual cells and are implicated in ECM turnover [20–24]. Among the MMPs, gelatinase A (MMP2) and gelatinase B (MMP9) preferentially degrade basement membrane components [17, 18].

By altering turnover of the decidual ECM, aberrant decidual cell-expressed MMP2 and/or MMP9 expression could promote preeclampsia by interfering with adhesion molecule-mediated stepwise EVT invasion. The proinflammatory cytokines interleukin 1 beta (IL1B) and tumor necrosis factor alpha (TNF) are associated with various aspects of preeclampsia [25–27]. Underlying maternal infections in subsets of preeclamptic cases (reviewed in Sibai et al. [16]) and an excess of decidual macrophages in the preeclamptic decidua [28–30] are likely sources of these cytokines [31]. The crucial role played by progesterone in pregnancy maintenance prompted assessment of IL1B and TNF effects with and without a progestin on MMP2 and MMP9 expression in first-trimester decidual cells, the major cell type encountered by invading EVTs at the implantation site [32, 33]. These in vitro studies were complemented by immunohistochemical localization of MMP2 and MMP9 in the decidua of preeclamptic versus gestational age-matched control placental sections.

Materials and Methods

Tissues

For immunohistochemical studies, placentas and attached fetal membranes were obtained from uncomplicated pregnancies after cesarean or vaginal idiopathic spontaneous preterm delivery (n = 11) and from cesarean and vaginal preterm deliveries indicated by preeclampsia (n = 11) after receiving written informed consent at the Yale-New Haven Hospital under Human Investigation Committee approval. The mean ± SEM gestational ages were 30.5 ± 1.2 wk and 30.3 ± 1.0 wk for preterm controls and preeclampsia cases, respectively. The gestational ages of the control and preeclamptic patients were not statistically different. Gestational age was estimated by the last menstrual period and ultrasound in the first 20 wk of pregnancy. None of the patients exhibited signs of decidual hemorrhage or chorioamnionitis or chronic villitis or other indications of underlying acute or chronic inflammation as determined from histological examination of each specimen.

Preeclampsia was defined by standard criteria [34] as systolic and diastolic blood pressures of ≥ 140 mm Hg and ≥90 mm Hg, respectively, and proteinuria defined as ≥0.3 g protein in a 24-h urine collection occurring after 20 wk of gestation in a woman with previously normal blood pressure. Severe preeclampsia (8 of the 11 patients) was defined as systolic and diastolic blood pressures of ≥160 mm Hg and ≥110 mm Hg, respectively, on two occasions at least 6 h apart during bed rest and/or proteinuria of ≥5 g in a 24-h urine specimen or ≥300 mg/dl on two random urine samples collected at least 4 h apart.

For cell cultures, decidual specimens from eight uncomplicated, elective terminations between 6 and 12 wk of gestation were obtained under Institutional Review Board approval at Bellevue Hospital (New York, NY). The decidua was separated, and a small portion of the former was formalin fixed and paraffin embedded and then examined histologically for signs of underlying acute and chronic inflammation. The remainder was used for the isolation of decidual cells.

Immunohistochemistry

Formalin-fixed, paraffin-embedded 5-μm sections were deparaffinized in xylene and rehydrated in a graded series of ethanol. Immunostaining for MMP2, tissue inhibitor of matrix metalloproteinase 1 (TIMP1), tissue inhibitor of matrix metalloproteinase 2 (TIMP2), vimentin, and cytokeratin involved boiling in citrate buffer (10 mM; pH 6.0) for 20 min, and thereafter sections for vimentin staining were incubated in a humidified chamber with trypsin for 5 min for antigen retrieval. Sections for cytokeratin, MMP2, MMP9, TIMP1, and TIMP2 staining were immersed in 3% hydrogen peroxide (in 50% methanol/50% distilled water) for 10 min to block endogenous peroxidase activity. After washing several times in Tris-buffered saline (TBS; pH 7.6), slides were incubated in a humidified chamber with 5% normal horse or goat serum (Vector Laboratories Inc., Burlingame, CA) in TBS for 30 min at room temperature to block nonspecific binding. After removing excess serum, the sections were incubated with primary antibodies (mouse MMP2 monoclonal antibody [1:140 dilution; Calbiochem Inc., San Diego, CA] at room temperature for 60 min; rabbit MMP9 polyclonal antibody [1:100 dilution; NeoMarkers, Fremont, CA] overnight at 4°C; rabbit TIMP1 or TIMP2 polyclonal antibody [1:400 dilution; NeoMarkers] overnight at 4°C; mouse vimentin monoclonal antibody [1:100 dilution; Abcam, Cambridge, MA] at room temperature for 30 min; and mouse cytokeratin monoclonal antibody [1:100 dilution; DAKO Inc., Carpinteria, CA] at room temperature for 45 min) in a humidified chamber. For negative controls, sections were treated with either normal mouse immunoglobulin G1 (IgG1) isotype monoclonal or normal rabbit IgG antibodies (R&D Systems Inc., Minneapolis, MN). Sections were rinsed in TBS three times for 5 min each, then biotinylated horse anti-mouse or anti-rabbit antibodies (Vector Laboratories) were added at a 1:400 dilution for 30 min at room temperature. After washing three times in TBS for 5 min each, the antigen-antibody complex was detected with an avidin-peroxidase kit or avidin-alkaline phosphatase kit (Vector Laboratories). The immunoreaction was developed using the chromogens diaminobenzidine (3, 3-diaminobenzidine tetrahydrochloride dehydrate; Vector Laboratories) for MMP2, MMP9, TIMP1, and TIMP2, and Fast Red (Vector Laboratories) for vimentin and cytokeratin. Sections were counterstained with hematoxylin (Sigma) and mounted with Permount (Fisher Chemicals, Springfield, NJ) on glass slides.

The intensities of MMP2, MMP9, TIMP1, and TIMP2 immunostaining were evaluated semiquantitatively by the following categories: 0 (no staining), 1+ (weak, but detectable, staining), 2+ (moderate or distinct staining), and 3+ (intense staining). For each tissue, an HSCORE value was derived by taking the sum of the percentage of cells that stained at each intensity category and multiplying that value by the weighted intensity of the staining, using the formula HSCORE = Σ Pi (i + l), where i represents the intensity score and Pi the corresponding percentage of cells staining. In each slide, five different areas and 100 cells per field were evaluated microscopically with ×40 objective magnification. The average score was obtained after evaluation by two investigators blinded to the samples.

Isolation of Decidual Cells

Tissues were minced and digested with 0.1% collagenase type IV and 0.01% DNAse in RPMI-1640 containing 20 μg/ml penicillin/streptomycin, 1 μl/ml fungizone (Gibco, Grand Island, NY) in a 37°C shaking water bath for 30 min. After washing with sterile PBS, the digestate was washed three times and subjected to consecutive filtration through 100-μm, 70-μm, and 40-μm millipore filters. Cells were resuspended in RPMI-1640, grown to confluence on polystyrene tissue culture dishes, harvested using trypsin/EDTA, and analyzed by flow cytometric analysis with anti-CD45 and anti-CD14 mAbs (BD Pharmingen, San Diego, CA) to monitor the presence of leukocytes after each passage. After three to four passages, cell cultures were found to be leukocyte free (<1%). Monolayers of these decidual cells were vimentin positive and cytokeratin negative and displayed decidualization-related morphological and biochemical changes during incubation with a progestin. The latter included enhanced expression of prolactin and of plasminogen activator inhibitor 1 (PAI1) and inhibited expression of MMP1 and MMP3 (data not shown). Cell aliquots were frozen in fetal calf serum/dimethyl sulfoxide (9:1; Sigma-Aldrich) and stored in liquid nitrogen.

Experimental Decidual Cell Incubations

Thawed cells were incubated in basal medium, a phenol red-free 1:1 v/v mix of Dulbecco MEM (Gibco) and Ham F-12 (Flow Labs, Rockville, MD), with 100 U/ml penicillin, 100 μg/ml streptomycin, 0.25 μg/ml fungizone supplemented with 10% charcoal-stripped calf serum (BMS). After two additional passages, confluent cultures were incubated in parallel in BMS containing either 10−8 M E2 or E2 + 10−7 M medroxyprogesterone acetate (MPA; Sigma-Aldrich), which was used in place of progesterone because of its greater stability under culture conditions [35]. After 7 days, the cultures were washed twice with Hanks balanced salt solution to remove residual serum. The cultures then were switched to a defined medium (DM) consisting of basal medium plus ITS+ (Collaborative Research, Waltham, MA), 5 μM FeSO4, 50 μM ZnSO4, 1 nM CuSO, 20 nM Na2SeO3, trace elements (Gibco), 50 μg/ml ascorbic acid (Sigma-Aldrich), and 50 ng/ml epidermal growth factor (Becton-Dickinson, Bedford, MA), with either vehicle control (0.1% ethanol) or steroids added with or without 0.01–10 ng/ml IL1B or TNF (R&D Systems). After the test period, cells were harvested by scraping into ice-cold PBS, pelleted, and extracted in ice-cold lysis buffer. Conditioned medium supernatants and cell lysates were stored at −70°C. In parallel incubations, total RNA was extracted with Tri Reagent (Sigma-Aldrich).

Biochemical Assays

Total cell protein levels were measured by a modified Lowry assay (Bio-Rad Laboratories, Hercules, CA). Commercial ELISA kits were used to measure total, noncomplexed immunoreactive levels each of MMP2, MMP9, TIMP1, and TIMP2 in the cell-conditioned medium according to instructions provided by the manufacturer (Quantikine kits; R&D Systems). Both MMP ELISAs have sensitivities of 0.16 ng/ml. The MMP2 assay coefficients of variation for intraassay and interassay are 4.8% and 7.7%, respectively. The MMP9 assay coefficients of variation for intraassay and interassay are 2.3% and 7.5%, respectively. Both of the TIMP ELISAs have sensitivities less than 0.011 ng/ml. The TIMP1 coefficients of variation for intraassay and interassay are 4.8% and 7.7%, respectively. The TIMP2 coefficients of variation for intraassay and interassay are 5.6% and 6.9%, respectively.

Substrate Gel Zymography

Gel zymography, with gelatin as the substrate in the gel, was used to detect the proteolytic activity of MMP2 and MMP9. Conditioned media from decidual cell cultures were centrifuged, and the supernatants were pretreated with dimethyl sulfoxide at a concentration of less than 7% of the total volume, with and without 2 mM aminophenylmercuric acetate (APMA; Sigma) at 37°C for 2 h. This APMA converts latent (pro) forms of the MMPs to their active forms. This reaction was stopped by mixing the samples 1:1 with nonreducing Zymogram sample buffer (Bio-Rad Laboratories) and then incubating for 10 min at room temperature. Samples were loaded onto a 10% gelatin Zymogram gel (Bio-Rad Laboratories), then electrophoresed for 1.75 h in Tris-glycine SDS running buffer. To enable the enzymes to renature, the gel was incubated for 45 min in 2.5% Triton X-100 (BioRad Laboratories) at room temperature and incubated in Zymogram development buffer (Bio-Rad Laboratories) for 30 min, and then placed in fresh Zymogram development buffer overnight at 37°C. The gel was stained with 0.5% Coomassie Brilliant Blue (Sigma) solution of methanol/acetic acid/water (40:10:50 v/v) for 2 h at room temperature, and then destained with methanol/acetic acid/water (30:10:60 v/v) for 4 h at room temperature. The presence of clear bands in the gels at the appropriate molecular weights reflects gelatonolytic activity of the latent (pro) and active forms of MMP2 and MMP9.

Western Blot

Western blot analysis was carried out on concentrated conditioned DM supernatants, which were diluted 1:6 in Laemmli 6× sample buffer (Boston Bioproducts, Boston, MA) and then boiled for 4 min. The centrifuged media were subjected to SDS-PAGE on a 7.5% Tris-HCl gel (Bio-Rad Laboratories), with subsequent electroblotting transfer onto a 0.2-μm nitrocellulose membrane (Bio-Rad Laboratories). After transfer, the membrane was blocked overnight in Tris-buffered saline (Fisher, Fairlawn, NJ) with 4% nonfat dry milk and then incubated for 2 h with 0.1 μg/ml of a mouse anti-human MMP9 monoclonal antibody (R&D Systems). Membranes were rinsed in PBS and 0.1% Tween 20 prior to and after incubation with horseradish peroxidase-conjugated anti-mouse IgG (ICN Biomedicals, Aurora, OH). Chemiluminescence was detected with ECL reagents (Perkin-Elmer Life Sciences, Boston, MA) and autoradiography film (Amersham Pharmacia) according to the manufacturer's instructions. The same membrane then was rinsed as above and incubated in stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7) for 30 min at 50°C, with subsequent rinsing and reblocking as indicated above. The membrane then was incubated for 2 h with 1 μg/ml of a mouse anti-human MMP2 monoclonal antibody (Oncogene, San Diego, CA) and processed as indicated above.

Quantitative Real-Time RT-PCR

To verify that the MMP2, MMP9, and beta-actin (ACTB) probes yielded the correct bands, extracted RNA from experimental cell incubations was subjected to semiquantitative RT-PCR using a kit from Invitrogen (Carlsbad, CA) and carrying out 35 cycles with the Eppendorf Mastercycler (Eppendorf, Westbury, NY). To perform quantitative real-time RT-PCR, reverse transcription was initially carried out with AMV reverse transcriptase (Invitrogen). A quantitative standard curve was created between 1 and 40 ng cDNA with a Roche Light Cycler (Roche, Indianapolis, IN) by monitoring increasing fluorescence of PCR products during amplification. Upon establishing the standard curve, quantification of the unknowns was determined with the Roche Light Cycler and adjusted to the quantitative expression of ACTB from the corresponding unknowns. Melting curve analysis determined the specificity of the amplified products and the absence of primer-dimer formation. All products obtained yielded correct melting temperatures. The primers listed in Table 1 were synthesized and gel purified at the Yale DNA Synthesis Laboratory, Critical Technologies.

TABLE 1.

Primers used for quantitative real-time RT-PCR.

Probe Sense (5′ to 3′) Antisense (5′ to 3′) Size
ACTB CGTACCACTGGCATCGTGAT GTGTTGGCGTACAGGTCTTTG 452 bp
MMP2 CCACTGCCTTCGATACAC GAGCCACTCTCTGGAATCTTAAA 133 bp
MMP9 GTTCCCGGAGTGAGTTGA TTTACATGGCACTGCAAAGC 109 bp
Open in a new tab

Statistical Analysis

Comparisons of control and the various treatment groups were performed using the Kruskal-Wallis ANOVA on Ranks test followed by the Student-Newman-Keuls posthoc test, with a P value < 0.05 representing statistical significance. For immunohistochemistry analysis of HSCORES, t-tests were employed to compare control versus preeclamptic specimens, with P < 0.05 representing statistical significance.

Results

Immunostaining of MMP9 and MMP2 in Decidua

Decidual cells in sections from the decidua basalis from preterm controls (Figs. 1B and 2B) and preeclamptic specimens (Figs. 1D and 2D) were distinguished by vimentin immunoreactivity. Interstitial cytotrophoblast cells in sections from the decidua basalis from preterm controls (Figs. 1B and 2B, insets) were distinguished by cytokeratin immunoreactivity.

FIG. 1.

FIG. 1

Open in a new tab

Immunohistochemical MMP9 expression in decidual cells from preterm specimens. MMP9 immunoreactivity (brown) is evident in preterm control (A) and preeclamptic (C) decidual tissues. Decidual cells are stained for vimentin (red) in the decidua of women with preterm control (B) and preeclamptic (D) deliveries. Inset box in B demonstrates interstitial trophoblast cells stained for cytokeratin (red). E) Negative control. Original magnification ×40. HSCORE values for MMP9 expression (F) are compared between decidual cells of preterm controls (n = 11) and those from preeclamptic specimens (n = 11; *P < 0.001) as well as between interstitial trophoblast cells from preterm controls and preeclamptic specimens (not significant).

FIG. 2.

FIG. 2

Open in a new tab

Immunohistochemical MMP2 expression in decidual cells from preterm specimens. Matrix metalloproteinase 2 immunoreactivity (brown) is evident in preterm control (A; n = 11) and preeclamptic (C; n = 11) decidual tissues. Decidual cells are stained for vimentin (red) in the decidua of women with preterm control (B) and preeclamptic (D) deliveries. E) Negative control. Original magnification ×40. Inset box in B demonstrates interstitial trophoblast cells stained for cytokeratin (red). HSCORE values for MMP2 expression (F) are compared between decidual cells of preterm controls versus those from preeclamptic specimens, as well as between interstitial trophoblast cells of controls versus preeclamptic specimens (both not significant).

Matrix metalloproteinase 9 immunoreactivity (brown stain) is shown in the decidual cells of both preterm control (Fig. 1A) and preeclamptic specimens (Fig. 1C). The HSCORE values of MMP9 levels (Fig. 1F) in the decidual cells of preeclamptic specimens (mean ± SEM: 183 ± 5) were significantly higher than those found in preterm controls (125 ± 9; P < 0.001). Immunostaining for MMP9 in interstitial cytotrophoblasts was not significantly different between preeclamptic (127 ± 7) and preterm control (115 ± 10) specimens. Negative antibody control is seen in Figure 1E.

Likewise, MMP2 immunoreactivity (brown stain) is shown in the decidual cells of both preterm control (Fig. 2A) and preeclamptic specimens (Fig. 2C). There were no significant changes in the HSCORE values for MMP2 immunoreactivity (Fig. 2F) in decidual cells from preeclamptic specimens (mean ± SEM: 162 ± 6) compared with those from preterm controls (139 ± 11). Similarly, there was no significant difference between the HSCORE values of MMP2 immunoreactivity in interstitial cytotrophoblast cells from preterm controls (105 ± 8) and preeclamptic specimens (111 ± 9). Negative antibody control is seen in Figure 2E.

Immunostaining of TIMP1 and TIMP2 in Decidua

Tissue inhibitor of MMP1 showed weak immunoreactivity in both preterm control (Fig. 3A) and preeclamptic (Fig. 3C) specimens. HSCORE values of TIMP1 staining (Fig. 3G) were not significantly different between preterm control and preeclamptic specimens in either decidual cells (mean ± SEM: 32 ± 10 vs. 36 ± 4, respectively) or interstitial cytotrophoblasts (30 ± 9 vs. 22 ± 4, respectively). Tissue inhibitor of MMP2 immunoreactivity was also weak in preterm control (Fig. 3B) and preeclamptic (Fig. 3D) specimens. Tissue inhibitor of MMP2 HSCORE values (Fig. 3H) were not significantly different between preterm control and preeclamptic specimens in either decidual cells (80 ± 24 vs. 102 ± 13, respectively) or interstitial trophoblasts (64 ± 15 vs. 63 ± 12, respectively). Negative antibody control for TIMP1 and TIMP2 revealed no staining, as shown in Figure 3, E and F, respectively.

FIG. 3.

FIG. 3

Open in a new tab

Immunohistochemical TIMP1 and TIMP2 expression in decidual cells from preterm specimens. TIMP1 and TIMP2 immunoreactivity (brown) is evident in preterm control (A and B, respectively; n = 5) and preeclamptic (C and D, respectively; n = 6) decidual tissues. Negative controls for TIMP1 and TIMP2 are shown (E and F, respectively). Original magnification ×40. HSCORE values for TIMP1 (G) and TIMP2 (H) expression are compared between decidual cells of preterm controls versus those from preeclamptic specimens, as well as between interstitial trophoblast cells of controls versus preeclamptic specimens (both not significant). For preterm controls, n =5; for preeclampsia cases, n = 6. The gestational ages were 28.5 ± 1.3 wk and 29.9 ± 1.0 wk (mean ± SEM) for preterm controls and preeclampsia cases, respectively. The gestational ages were not statistically different.

MMP9 and MMP2 Protein Expression in Decidual Cell Monolayer Cultures

Figure 4 describes the separate and interactive effects of MPA and cytokines on MMP2 (Fig. 4A) and MMP9 (Fig. 4B) output by leukocyte-free, first-trimester decidual cells. Circulating levels of E2 and progesterone are elevated during the first trimester, prompting use of E2 as the control incubation for E2 + MPA. Basal output of MMP2 was several-fold higher than that of MMP9 and was unaffected by exposure to either MPA or inflammatory cytokines (Fig. 4A). Although basal MMP9 output was also unaffected by MPA, it was markedly upregulated during incubations with the proinflammatory cytokines (Fig. 4B). Compared with the basal output in cultures incubated with E2 alone (0.29 ± 0.02 pg/ml per microgram of cell protein, n = 8), MMP9 output was elevated to 42.5 ± 19.7 and 264.7 ± 151.5 (P < 0.05) by 1 ng/ml of IL1B and TNF, respectively. Similarly, in cultures incubated in parallel with E2 + MPA, IL1B and TNF elevated MMP9 output to 51.0 ± 27.1 and 495.1 ± 269.6, respectively, compared with 0.44 ± 0.16 pg/ml per microgram of cell protein in cultures maintained in E2 + MPA alone (P < 0.05). Moreover, E2 + MPA neither affected MMP9 output compared with E2 alone nor did it alter the response to IL1B and TNF. Figure 4C displays the results of Figure 4, A and B as fold-changes from E2 for each experiment to contrast constitutive MMP2 output with the marked enhancement of MMP9 output elicited by IL1B (214 ± 128-fold) and by TNF (1977 ± 1125-fold), P < 0.05.

FIG. 4.

FIG. 4

Open in a new tab

Effects of E2, MPA, IL1B, and TNF on MMP2 and MMP9 output by first-trimester decidual cell monolayers. Confluent, leukocyte-free decidual cells were incubated for 7 days in 10−8 M E2, or E2 + 10−7 M MPA, then switched to DM with corresponding steroid(s) with or without 1 ng/ml of IL1B or TNF for 24 h. Matrix metalloproteinase 2 and MMP9 levels measured by ELISA in conditioned DM and normalized to cell protein (n = 8; mean ± SEM). A) MMP2; linear plot: ordinate ng/ml per microgram of protein. B) MMP9; linear plot: ordinate pg/ml per microgram of protein. C) MMP2 and MMP9; semi log plot: ordinate fold change from E2. *Versus E2 or E2 + MPA; **versus corresponding MMP2 fold change; P < 0.05.

The zymograms depicted in Figure 5 demonstrate that decidual cell-conditioned medium contains discrete zones of gelatinolytic activity that correspond to MMP2 and MMP9 at 72 kDa and 92 kDa, respectively; that is, the pro-forms of the MMPs. [36]. As evidenced by the zymograms, pretreatment of the decidual cell-conditioned medium with the organomercurial APMA shifts virtually all of the pro-MMP forms to the active MMP forms (66 kDa for MMP2 and 86 kDa for MMP9). Consistent with the differential regulation of MMP2 and MMP9 indicated by the ELISA results of Figure 4, neither the cytokines nor MPA affected the magnitude of MMP2, whereas that of MMP9 was markedly increased by IL1B and TNF but unaltered by MPA. The Western blot depicted in Figure 6 confirms the ELISA and zymography results by demonstrating that the decidual cells secrete MMP2 and MMP9 in their pro-forms that correspond to the molecular weights of pro-form positive controls.

FIG. 5.

FIG. 5

Open in a new tab

Effects of E2, MPA, IL1B, and TNF on MMP2 and MMP9 gelatinase activity by first-trimester decidual cell monolayers. Confluent, leukocyte-free decidual cells were incubated for 7 days in 10−8 M E2 (upper panel), or E2 + 10−7 M MPA (lower panel), then switched to DM with corresponding steroid(s) with or without 1 ng/ml of IL1B or TNF for 24 h. Aliquots of conditioned DM were subjected to gelatin zymography after pretreatment with and without the organomercurial APMA, which converts the pro-forms (Pro) of the MMPs to their active forms (Act). Cont, Control; neg, negative control.

FIG. 6.

FIG. 6

Open in a new tab

Western blot of effects of E2, MPA, IL1B, and TNF on secreted MMP2 and MMP9 levels by first-trimester decidual cell monolayers. Confluent, leukocyte-free decidual cells were incubated for 7 days in 10–8 M E2 or E2 + 10−7 M MPA, then switched to DM with corresponding steroid(s) with or without 1 ng/ml of IL1B or TNF for 24 h. Aliquots of conditioned DM were subjected to reducing SDS-PAGE, transferred to nitrocellulose and immunostained for MMP9, then stripped and reprobed for MMP2. Positive controls were recombinant human proteins that are only the pro-forms of MMP2 and MMP9.

As the addition of a progestin did not modulate either basal or cytokine-enhanced MMP9 output, the dose-response effects of IL1B and TNF on MMP9 output by decidual cells that were performed after priming with E2 + MPA are shown in Figure 7. These results indicate that secreted MMP9 levels were enhanced by IL1B (Fig. 7A) and by TNF (Fig. 7B) in a concentration-dependent manner.

FIG. 7.

FIG. 7

Open in a new tab

Concentration-dependent effects of TNF and IL1B on MMP9 output by E2 + MPA-treated first-trimester decidual cell monolayers. Confluent, leukocyte-free decidual cells were incubated for 7 days in 10–8 M E2 + 10−7 M MPA, then switched to DM with steroids alone and with IL1B (A) or TNF (B) for 24 h. The abscissa indicates cytokine concentrations in ng/ml units. Matrix metalloproteinase 9 levels were measured by ELISA in conditioned DM and normalized to cell protein (n = 4; mean ± SEM). *Versus E2 + MPA; **versus 0.1 ng/ml TNF; P < 0.05.

MMP9 and MMP2 mRNA Expression in Decidual Cell Monolayer Cultures

Figure 8 displays steady-state MMP2 (Fig. 8A) and MMP9 (Fig. 8B) mRNA levels as determined by quantitative real-time RT-PCR in parallel cultures primed with either E2 or with E2 + MPA. Consistent with the results for secreted MMP2 and MMP9 levels shown in Figure 4, neither MPA, IL1B, or TNF exerted significant effects on MMP2 mRNA levels, whereas MMP9 mRNA levels were markedly upregulated by IL1B and TNF. As shown in Figure 8C, the fold changes compared with E2 treatment alone indicate the absence of a statistically significant effect of MPA on MMP9 mRNA levels, whereas IL1B and TNF enhanced MMP9 mRNA levels by 54.3 ± 13.7-fold and 103.9 ± 40.0-fold, respectively.

FIG. 8.

FIG. 8

Open in a new tab

Effects of E2, MPA, IL1B, and TNF on MMP2 and MMP9 mRNA levels in first-trimester decidual cell monolayers. Confluent passaged, leukocyte-free decidual cells were incubated for 7 days in 10−8 M E2 + 10−7 M MPA, then switched to DM with E2 + 10−7 M MPA alone or with IL1B or TNF for 6 h. Quantitative real-time RT-PCR was performed on extracted RNA for MMP2 and MMP9 normalized to ACTB mRNA (n = 4; mean ± SEM). P < 0.05 *versus E2 or E2 + MPA; **versus corresponding MMP2 fold change. A) MMP2; linear plot: ordinate RNA/ACTB mRNA. B) MMP9; linear plot: ordinate RNA/ACTB mRNA. C) MMP2 and MMP9; semi log plot: ordinate fold change from E2.

TIMP1 and TIMP2 Protein Expression in Decidual Cell Monolayer Cultures

Figure 9 displays the ELISA results of the addition of IL1B and TNF on secreted levels of TIMP1 and TIMP2 by first-trimester human decidual cell cultures. Note that in contrast to the marked increased MMP9 responses, there were no significant effects of either cytokine on either TIMP1 or TIMP2 levels.

FIG. 9.

FIG. 9

Open in a new tab

Effects of E2, MPA, IL1B, and TNF on TIMP1 (top panel) and TIMP2 (bottom panel) output by first-trimester decidual cell monolayers. Confluent, leukocyte-free decidual cells were incubated for 7 days in 10−8 M E2, or E2 + 10−7 M MPA, then switched to DM with corresponding steroid(s) with or without 1 ng/ml of IL1B or TNF for 24 h. Secreted levels of TIMP1 and TIMP2 were measured by ELISA in conditioned DM and normalized to cell protein (n = 8; mean ± SEM). No significance was found when comparing baseline to either cytokine for either TIMP1 or TIMP2.

Discussion

The pivotal role played by the depth of EVT invasion of human decidua in remodeling spiral arteries and arterioles into low-resistance, high-capacitance vessels, taken together with the impact that this transformation exerts on uteroplacental blood flow have provoked numerous investigations into the invasiveness of normal and immortalized first-trimester EVTs. Such studies indicate that EVT migration and invasion can be modulated by several factors expressed by trophoblasts and decidual cells at the maternal-fetal interface. These include insulin-like growth factor 2 (IGF2), its IGF2 mannose-6 phosphate receptor [37] and IGF-binding protein 1 (IGFBP1) [38, 39], prostaglandin E2 and its EP1 receptor (PTGER1) [40], and transforming growth factor beta (TGFB) isoforms and decorin, which stores TGFB in the decidual ECM [41–43].

Migration and invasion of human EVTs exhibit similarities with the extensively studied processes in tumor cells. Tumor cell invasion also involves sequential integrin-mediated adherence to, then proteolysis of, ECM components of the host tissue [18, 44]. Numerous observations from studies on tumor cells emphasize the important roles played by urokinase [45] and MMPs, particularly MMP2 and MMP9 [17, 46], and the respective modulating actions of plasminogen activator inhibitor 1 (PAI1) [45] and TIMPs [46]. Use of immunohistochemistry and in situ hybridization in human tissues, taken together with studies in transgenic cancer mouse models indicate that during tumor growth, invasion, and metastasis, the host stromal cells are the major contributors of urokinase and MMPs, with the cancer cells relegated primarily to stimulating neighboring stromal cells to synthesize key components that regulate ECM turnover [47, 48].

Compared with invasion of host tissues by tumor cells, EVT invasion is under far more stringent spatial and temporal control, as it is limited to the endometrium and proximal myometrium and is terminated by midgestation [18, 44, 49]. The decisive role played by the decidua in restraining intrinsic EVT invasiveness is evident from the uncontrolled invasion, with often life-threatening consequences associated with implantation at sites where the decidua is absent, as in ectopic pregnancies, including cesarean scar pregnancies, or deficient, as in placenta accreta [50]. Despite the major responsibility borne by host stromal cell-expressed proteases in tumor cell invasion, studies of EVT invasion of the decidua have primarily focused on MMP2 and MMP9 expression by the trophoblasts [18, 23, 49, 51]. In this regard, trophoblasts from preeclamptic pregnancies were recently found to express lower levels of MMP2 and MMP9 than their normal counterparts [52]. By contrast, there is a dearth of studies evaluating the potential contribution that stromal/decidual-derived proteases could contribute to this invasion.

The current study assessed immunostaining for MMP9 and MMP2 in preeclamptic and control decidual sections. Statistically significant augmentation of staining for MMP9 was observed in the decidual cells of preeclamptic versus control specimens, with no significant differences in MMP2 decidual cell immunostaining in evidence. In contrast, immunostaining for MMPs was not different in the adjacent interstitial trophoblasts of preeclamptic versus control placentas. Consistent with our observations of a marked preeclampsia-related increase in MMP9 immunostaining in the decidua, this study found that IL1B and TNF markedly upregulated MMP9 mRNA and protein expression in cultured leukocyte-free first-trimester decidual cells, whereas MPA affected neither basal nor cytokine-enhanced MMP9 expression. Unlike MMP9, MMP2 expression appears to be constitutive, since it was unaffected by MPA or inflammatory cytokines added separately or together.

Zymography results revealed that, as in other cell systems, first-trimester decidual cells secrete MMP2 and MMP9 as zymogens [19]. Activation of the secreted MMP2 zymogen is usually mediated by membrane type 1 MMP [53, 54]. However, during early human pregnancy several studies suggest that urokinase-type plasminogen activator (uPA) bound to trophoblast surface receptors generates plasmin, which activates ECM-degrading pro-MMP2 and pro-MMP9 to promote EVT invasion (reviewed in Ferretti et al. [44]). Although trophoblasts are generally thought to secrete the pro-MMP2 and pro-MMP9 that drive invasion, the current results suggest that: 1) expression of both MMPs by decidual cells, the predominant cell type encountered by invading EVTs [32, 33], may regulate EVT invasion; 2) overexpression of MMP9 by decidual cells contributes to shallow placentation by interfering with the normal stepwise integrin-mediated EVT invasion of the decidua. Such dysregulation is likely intensified by decidual cell-expressed stromelysin 1 (MMP3), a documented pro-MMP9 activator [55]. We recently found MMP3 to be markedly enhanced by TNF and IL1B in first-trimester human decidual cells with significantly higher immunoreactive MMP3 levels in decidual cells of preeclamptic versus gestational age-matched control placental sections (W. Murk et al., unpublished results).

Studies in several tissues suggest that the activity of secreted pro-MMPs can be blocked by extracellular TIMPs [19]. While all of the TIMPs can bind to some degree to all the MMPs, TIMP2 is generally constitutively expressed and specific for MMP2 [56], whereas expression of TIMP1 binds with high affinity to MMP9 and can be regulated by proinflammatory cytokines [57–59]. The current study in first-trimester decidual cell monolayers observed the expected lack of regulation in MMP2 and TIMP2 expression. However, it found a striking discordance between MMP9 and TIMP1 expression with the multi-fold elevation in MMP9 protein expression elicited by IL1B and TNF, respectively, that was unaccompanied by a significant increase in secreted TIMP1 levels. Immunostaining revealed no differences between preeclamptic versus gestational age-matched control decidual specimens for TIMP1 or TIMP2 levels, with TIMP1 being present at low levels.

Previous studies in specimens of human endometrium obtained during the menstrual cycle found that mRNA levels for several MMPs are downregulated during the progesterone-dominated luteal phase and markedly upregulated in the progesterone withdrawal-initiated menstrual phase. By contrast, mRNAs for TIMP1 and TIMP2 are essentially unchanged over this period [22, 24]. In cultured stromal cells obtained from predecidualized human endometrium, incubation with progestin inhibited expression of MMP3 [60] (and interstitial collagenase [MMP1]), but not that of MMP2 or TIMP1 [20]. Moreover, progestin withdrawal enhanced expression of MMP3 and MMP1 but did not alter MMP2, TIMP1, or TIMP2 expression [20, 61]. Incubation of such stromal cells with IL1B and TNF elevated the expression of MMP1 and MMP9, whereas the expression of MMP2, TIMP1, and TIMP2 was unaffected by the cytokines [62].

While prior reports indicate that IL1B and TNF enhance EVT invasiveness by enhancing levels of MMP9 mRNA, immunoreactive protein, and/or activity [63–65], these increases are orders of magnitude lower than the hundred- to thousand-fold enhancement of MMP9 protein expression by the decidual cells elicited by IL1B and TNF, respectively. Indeed, the hypothesis that IL1B and TNF would induce a net increase in trophoblast invasion of first-trimester decidua is disputed by: 1) the documented association between these cytokines and preeclampsia [25–27]; 2) the established involvement between preeclampsia and impaired EVT invasion of the decidua [7–12]; 3) reports that TNF inhibits trophoblast invasiveness [27, 66]; and 4) the recent observation that inhibition of trophoblast invasiveness by lipopolysaccharide-activated macrophages was relieved by a TNF neutralizing antibody [67]. In summary, our results suggest that enhancement of decidual cell-expressed MMP9 by IL1B and TNF may disrupt the integrity of the decidual ECM composition. The consequent interference with the normal stepwise integrin-mediated invasion of the decidua by EVT would promote the shallow placentation found in preeclampsia.

Footnotes

1

Supported by National Institutes of Health grants 2 R01HD33937-05 and 1 R01 HL070004-04 to C.J.L.

References

  • 1.Tabanelli S, Tang B, Gurpide E. In vitro decidualization of human endometrial stromal cells. J Steroid Biochem Mol Biol. 1992;42:337–344. doi: 10.1016/0960-0760(92)90137-8. [DOI] [PubMed] [Google Scholar]
  • 2.Wynn RM. Ultrastructural development of the human decidua. Am J Obstet Gynecol. 1974;118:652–670. doi: 10.1016/s0002-9378(16)33740-1. [DOI] [PubMed] [Google Scholar]
  • 3.Aplin JD, Charlton AK, Ayad S. An immunohistochemical study of human endometrial extracellular matrix during the menstrual cycle and first trimester of pregnancy. Cell Tissue Res. 1988;253:231–240. doi: 10.1007/BF00221758. [DOI] [PubMed] [Google Scholar]
  • 4.Loke YW, Gardner L, Burland K, King A. Laminin in human trophoblast–decidua interaction. Hum Reprod. 1989;4:457–463. doi: 10.1093/oxfordjournals.humrep.a136926. [DOI] [PubMed] [Google Scholar]
  • 5.Farrar JD, Carson DD. Differential temporal and spatial expression of mRNA encoding extracellular matrix components in decidua during the peri-implantation period. Biol Reprod. 1992;46:1095–1108. doi: 10.1095/biolreprod46.6.1095. [DOI] [PubMed] [Google Scholar]
  • 6.Moore KL. The Developing Human. 4th. Philadelphia, PA: W.B. Saunders Company; 1988. [Google Scholar]
  • 7.Damsky CH, Fisher SJ. Trophoblast pseudo-vasculogenesis: faking it with endothelial adhesion receptors. Curr Opin Cell Biol. 1998;10:660–666. doi: 10.1016/s0955-0674(98)80043-4. [DOI] [PubMed] [Google Scholar]
  • 8.Pijnenborg R, Vercruysse L, Hanssens M. The uterine spiral arteries in human pregnancy: facts and controversies. Placenta. 2006;27:939–958. doi: 10.1016/j.placenta.2005.12.006. [DOI] [PubMed] [Google Scholar]
  • 9.Damsky CH, Librach C, Lim KH, Fitzgerald ML, McMaster MT, Janatpour M, Zhou Y, Logan SK, Fisher SJ. Integrin switching regulates normal trophoblast invasion. Development. 1994;120:3657–3666. doi: 10.1242/dev.120.12.3657. [DOI] [PubMed] [Google Scholar]
  • 10.Bulla R, Villa A, Bossi F, Cassetti A, Radillo O, Spessotto P, De Seta F, Guaschino S, Tedesco F. VE-cadherin is a critical molecule for trophoblast–endothelial cell interaction in decidual spiral arteries. Exp Cell Res. 2005;303:101–113. doi: 10.1016/j.yexcr.2004.09.015. [DOI] [PubMed] [Google Scholar]
  • 11.Zhou Y, Damsky CH, Chiu K, Roberts JM, Fisher SJ. Preeclampsia is associated with abnormal expression of adhesion molecules by invasive cytotrophoblasts. J Clin Invest. 1993;91:950–960. doi: 10.1172/JCI116316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Caniggia I, Winter J, Lye SJ, Post M. Oxygen and placental development during the first trimester: implications for the pathophysiology of preeclampsia. Placenta. 2000;21(suppl A):S25–S30. doi: 10.1053/plac.1999.0522. [DOI] [PubMed] [Google Scholar]
  • 13.Karumanchi SA, Bdolah Y. Hypoxia and sFlt-1 in preeclampsia: the “chicken-and-egg” question. Endocrinology. 2004;145:4835–4837. doi: 10.1210/en.2004-1028. [DOI] [PubMed] [Google Scholar]
  • 14.Borzychowski AM, Sargent IL, Redman CW. Inflammation and preeclampsia. Semin Fetal Neonatal Med. 2006;11:309–316. doi: 10.1016/j.siny.2006.04.001. [DOI] [PubMed] [Google Scholar]
  • 15.Gammill HS, Roberts JM. Emerging concepts in preeclampsia investigation. Front Biosci. 2007;12:2403–2411. doi: 10.2741/2242. [DOI] [PubMed] [Google Scholar]
  • 16.Sibai B, Dekker G, Kupferminc M. Pre-eclampsia. Lancet. 2005;365:785–799. doi: 10.1016/S0140-6736(05)17987-2. [DOI] [PubMed] [Google Scholar]
  • 17.Westermarck J, Kahari VM. Regulation of matrix metalloproteinase expression in tumor invasion. FASEB J. 1999;13:781–792. [PubMed] [Google Scholar]
  • 18.Cohen M, Meisser A, Bischof P. Metalloproteinases and human placental invasiveness. Placenta. 2006;27:783–793. doi: 10.1016/j.placenta.2005.08.006. [DOI] [PubMed] [Google Scholar]
  • 19.Nagase H, Visse R, Murphy G. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res. 2006;69:562–573. doi: 10.1016/j.cardiores.2005.12.002. [DOI] [PubMed] [Google Scholar]
  • 20.Lockwood CJ, Krikun G, Hausknecht VA, Papp C, Schatz F. Matrix metalloproteinase and matrix metalloproteinase inhibitor expression in endometrial stromal cells during progestin-initiated decidualization and menstruation-related progestin withdrawal. Endocrinology. 1998;139:4607–4613. doi: 10.1210/endo.139.11.6304. [DOI] [PubMed] [Google Scholar]
  • 21.Zhang J, Salamonsen LA. Tissue inhibitor of metalloproteinases (TIMP)-1, -2 and -3 in human endometrium during the menstrual cycle. Mol Hum Reprod. 1997;3:735–741. doi: 10.1093/molehr/3.9.735. [DOI] [PubMed] [Google Scholar]
  • 22.Rodgers WH, Matrisian LM, Giudice LC, Dsupin B, Cannon P, Svitek C, Gorstein F, Osteen KG. Patterns of matrix metalloproteinase expression in cycling endometrium imply differential functions and regulation by steroid hormones. J Clin Invest. 1994;94:946–953. doi: 10.1172/JCI117461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Seval Y, Akkoyunlu G, Demir R, Asar M. Distribution patterns of matrix metalloproteinase (MMP)-2 and -9 and their inhibitors (TIMP-1 and TIMP-2) in the human decidua during early pregnancy. Acta Histochem. 2004;106:353–362. doi: 10.1016/j.acthis.2004.07.005. [DOI] [PubMed] [Google Scholar]
  • 24.Goffin F, Munaut C, Frankenne F, Perrier D'Hauterive S, Béliard A, Fridman V, Nervo P, Colige A, Foidart JM. Expression pattern of metalloproteinases and tissue inhibitors of matrix-metalloproteinases in cycling human endometrium. Biol Reprod. 2003;69:976–984. doi: 10.1095/biolreprod.103.015933. [DOI] [PubMed] [Google Scholar]
  • 25.Rinehart BK, Terrone DA, Lagoo-Deenadayalan S, Barber WH, Hale EA, Martin JN, Bennett WA. Expression of the placental cytokines tumor necrosis factor alpha, interleukin 1beta, and interleukin 10 is increased in preeclampsia. Am J Obstet Gynecol. 1999;181:915–920. doi: 10.1016/s0002-9378(99)70325-x. [DOI] [PubMed] [Google Scholar]
  • 26.Hefler LA, Tempfer CB, Gregg AR. Polymorphisms within the interleukin-1 beta gene cluster and preeclampsia. Obstet Gynecol. 2001;97:664–668. doi: 10.1016/s0029-7844(01)01128-0. [DOI] [PubMed] [Google Scholar]
  • 27.Bauer S, Pollheimer J, Hartmann J, Husslein P, Aplin JD, Knofler M. Tumor necrosis factor-alpha inhibits trophoblast migration through elevation of plasminogen activator inhibitor-1 in first-trimester villous explant cultures. J Clin Endocrinol Metab. 2004;89:812–822. doi: 10.1210/jc.2003-031351. [DOI] [PubMed] [Google Scholar]
  • 28.Lockwood CJ, Matta P, Krikun G, Koopman LA, Masch R, Toti P, Arcuri F, Huang ST, Funai EF, Schatz F. Regulation of monocyte chemoattractant protein-1 expression by tumor necrosis factor-alpha and interleukin-1beta in first trimester human decidual cells: implications for preeclampsia. Am J Pathol. 2006;168:445–452. doi: 10.2353/ajpath.2006.050082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Abrahams VM, Kim YM, Straszewski SL, Romero R, Mor G. Macrophages and apoptotic cell clearance during pregnancy. Am J Reprod Immunol. 2004;51:275–282. doi: 10.1111/j.1600-0897.2004.00156.x. [DOI] [PubMed] [Google Scholar]
  • 30.Reister F, Frank HG, Kingdom JC, Heyl W, Kaufmann P, Rath W, Huppertz B. Macrophage-induced apoptosis limits endovascular trophoblast invasion in the uterine wall of preeclamptic women. Lab Invest. 2001;81:1143–1152. doi: 10.1038/labinvest.3780326. [DOI] [PubMed] [Google Scholar]
  • 31.Nathan CF. Secretory products of macrophages. J Clin Invest. 1987;79:319–326. doi: 10.1172/JCI112815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Dunn CL, Kelly RW, Critchley HO. Decidualization of the human endometrial stromal cell: an enigmatic transformation. Reprod Biomed Online. 2003;7:151–161. doi: 10.1016/s1472-6483(10)61745-2. [DOI] [PubMed] [Google Scholar]
  • 33.Moffett-King A. Natural killer cells and pregnancy. Nat Rev Immunol. 2002;2:656–663. doi: 10.1038/nri886. [DOI] [PubMed] [Google Scholar]
  • 34.ACOG Committee on Practice Bulletins—Obstetrics Diagnosis and management of preeclampsia and eclampsia. Number 33, January 2002, American College of Obstetricans and Gynecologists. Obstet Gynecol. 2002;99:159–167. doi: 10.1016/s0029-7844(01)01747-1. [DOI] [PubMed] [Google Scholar]
  • 35.Arici A, Marshburn PB, MacDonald PC, Dombrowski RA. Progesterone metabolism in human endometrial stromal and gland cells in culture. Steroids. 1999;64:530–534. doi: 10.1016/s0039-128x(99)00029-x. [DOI] [PubMed] [Google Scholar]
  • 36.Romanic AM, White RF, Arleth AJ, Ohlstein EH, Barone FC. Matrix metalloproteinase expression increases after cerebral focal ischemia in rats: inhibition of matrix metalloproteinase-9 reduces infarct size. Stroke. 1998;29:1020–1030. doi: 10.1161/01.str.29.5.1020. [DOI] [PubMed] [Google Scholar]
  • 37.Zygmunt M, McKinnon T, Herr F, Lala PK, Han VK. HCG increases trophoblast migration in vitro via the insulin-like growth factor-II/mannose-6 phosphate receptor. Mol Hum Reprod. 2005;11:261–267. doi: 10.1093/molehr/gah160. [DOI] [PubMed] [Google Scholar]
  • 38.Irwin JC, Suen LF, Martina NA, Mark SP, Giudice LC. Role of the IGF system in trophoblast invasion and pre-eclampsia. Hum Reprod. 1999;14(suppl 2):90–96. doi: 10.1093/humrep/14.suppl_2.90. [DOI] [PubMed] [Google Scholar]
  • 39.Irwin JC, Suen LF, Faessen GH, Popovici RM, Giudice LC. Insulin-like growth factor (IGF)-II inhibition of endometrial stromal cell tissue inhibitor of metalloproteinase-3 and IGF-binding protein-1 suggests paracrine interactions at the decidua:trophoblast interface during human implantation. J Clin Endocrinol Metab. 2001;86:2060–2064. doi: 10.1210/jcem.86.5.7451. [DOI] [PubMed] [Google Scholar]
  • 40.Nicola C, Timoshenko AV, Dixon SJ, Lala PK, Chakraborty C. EP1 receptor-mediated migration of the first trimester human extravillous trophoblast: the role of intracellular calcium and calpain. J Clin Endocrinol Metab. 2005;90:4736–4746. doi: 10.1210/jc.2005-0413. [DOI] [PubMed] [Google Scholar]
  • 41.Caniggia I, Grisaru-Gravnosky S, Kuliszewsky M, Post M, Lye SJ. Inhibition of TGF-beta 3 restores the invasive capability of extravillous trophoblasts in preeclamptic pregnancies. J Clin Invest. 1999;103:1641–1650. doi: 10.1172/JCI6380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Lysiak JJ, Hunt J, Pringle GA, Lala PK. Localization of transforming growth factor beta and its natural inhibitor decorin in the human placenta and decidua throughout gestation. Placenta. 1995;16:221–2231. doi: 10.1016/0143-4004(95)90110-8. [DOI] [PubMed] [Google Scholar]
  • 43.Xu G, Guimond MJ, Chakraborty C, Lala PK. Control of proliferation, migration, and invasiveness of human extravillous trophoblast by decorin, a decidual product. Biol Reprod. 2002;67:681–689. doi: 10.1095/biolreprod67.2.681. [DOI] [PubMed] [Google Scholar]
  • 44.Ferretti C, Bruni L, Dangles-Marie V, Pecking AP, Bellet D. Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts. Hum Reprod Update. 2007;13:121–141. doi: 10.1093/humupd/dml048. [DOI] [PubMed] [Google Scholar]
  • 45.Dano K, Behrendt N, Hoyer-Hansen G, Johnsen M, Lund LR, Ploug M, Romer J. Plasminogen activation and cancer. Thromb Haemost. 2005;93:676–681. doi: 10.1160/TH05-01-0054. [DOI] [PubMed] [Google Scholar]
  • 46.Bjorklund M, Koivunen E. Gelatinase-mediated migration and invasion of cancer cells. Biochim Biophys Acta. 2005;1755:37–69. doi: 10.1016/j.bbcan.2005.03.001. [DOI] [PubMed] [Google Scholar]
  • 47.Almholt K, Johnsen M. Stromal cell involvement in cancer. Recent Results Cancer Res. 2003;162:31–42. doi: 10.1007/978-3-642-59349-9_3. [DOI] [PubMed] [Google Scholar]
  • 48.Pedersen TX, Pennington CJ, Almholt K, Christensen IJ, Nielsen BS, Edwards DR, Romer J, Dano K, Johnsen M. Extracellular protease mRNAs are predominantly expressed in the stromal areas of microdissected mouse breast carcinomas. Carcinogenesis. 2005;26:1233–1240. doi: 10.1093/carcin/bgi065. [DOI] [PubMed] [Google Scholar]
  • 49.Librach CL, Werb Z, Fitzgerald ML, Chiu K, Corwin NM, Esteves RA, Grobelny D, Galardy R, Damsky CH, Fisher SJ. 92-kD type IV collagenase mediates invasion of human cytotrophoblasts. J Cell Biol. 1991;113:437–449. doi: 10.1083/jcb.113.2.437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Norwitz ER. Defective implantation and placentation: laying the blueprint for pregnancy complications. Reprod Biomed Online. 2006;13:591–599. doi: 10.1016/s1472-6483(10)60649-9. [DOI] [PubMed] [Google Scholar]
  • 51.Hu Y, Dutz JP, MacCalman CD, Yong P, Tan R, von Dadelszen P. Decidual NK cells alter in vitro first trimester extravillous cytotrophoblast migration: a role for IFN-gamma. J Immunol. 2006;177:8522–8530. doi: 10.4049/jimmunol.177.12.8522. [DOI] [PubMed] [Google Scholar]
  • 52.Campbell S, Rowe J, Jackson CJ, Gallery ED. Interaction of cocultured decidual endothelial cells and cytotrophoblasts in preeclampsia. Biol Reprod. 2004;71:244–252. doi: 10.1095/biolreprod.103.026716. [DOI] [PubMed] [Google Scholar]
  • 53.Zhang J, Hampton AL, Nie G, Salamonsen LA. Progesterone inhibits activation of latent matrix metalloproteinase (MMP)-2 by membrane-type 1 MMP: enzymes coordinately expressed in human endometrium. Biol Reprod. 2000;62:85–94. doi: 10.1095/biolreprod62.1.85. [DOI] [PubMed] [Google Scholar]
  • 54.Thanabalasingam U, Veinot JP, Chretien M, Seidah NG, Fleck E, Graf K. Furin-like proprotein convertases are central regulators of the membrane type matrix metalloproteinase-pro-matrix metalloproteinase-2 proteolytic cascade in atherosclerosis. Circulation. 2005;111:2820–2827. doi: 10.1161/CIRCULATIONAHA.104.502617. [DOI] [PubMed] [Google Scholar]
  • 55.Rigot V, Marbaix E, Lemoine P, Courtoy PJ, Eeckhout Y. In vivo perimenstrual activation of progelatinase B (proMMP-9) in the human endometrium and its dependence on stromelysin 1 (MMP-3) ex vivo. Biochem J. 2001;358:275–280. doi: 10.1042/0264-6021:3580275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Murphy G, Willenbrock F. Tissue inhibitors of matrix metalloendopeptidases. Methods Enzymol. 1995;248:496–510. doi: 10.1016/0076-6879(95)48032-3. [DOI] [PubMed] [Google Scholar]
  • 57.Nee L, Tuite N, Ryan MP, McMorrow T. TNF-alpha and IL-1 beta-mediated regulation of MMP-9 and TIMP-1 in human glomerular mesangial cells. Nephron Exp Nephrol. 2007;107:e73–e86. doi: 10.1159/000108645. [DOI] [PubMed] [Google Scholar]
  • 58.Lauder SN, Carty SM, Carpenter CE, Hill RJ, Talamas F, Bondeson J, Brennan P, Williams AS. Interleukin-1beta induced activation of nuclear factor-kappab can be inhibited by novel pharmacological agents in osteoarthritis. Rheumatology (Oxford) 2007;46:752–758. doi: 10.1093/rheumatology/kel419. [DOI] [PubMed] [Google Scholar]
  • 59.Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP. Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol. 1997;74:111–122. [PubMed] [Google Scholar]
  • 60.Schatz F, Papp C, Toth-Pal E, Lockwood CJ. Ovarian steroid-modulated stromelysin-1 expression in human endometrial stromal and decidual cells. J Clin Endocrinol Metab. 1994;78:1467–1472. doi: 10.1210/jcem.78.6.8200951. [DOI] [PubMed] [Google Scholar]
  • 61.Salamonsen LA, Butt AR, Hammond FR, Garcia S, Zhang J. Production of endometrial matrix metalloproteinases, but not their tissue inhibitors, is modulated by progesterone withdrawal in an in vitro model for menstruation. J Clin Endocrinol Metab. 1997;82:1409–1415. doi: 10.1210/jcem.82.5.3920. [DOI] [PubMed] [Google Scholar]
  • 62.Singer CF, Marbaix E, Lemoine P, Courtoy PJ, Eeckhout Y. Local cytokines induce differential expression of matrix metalloproteinases but not their tissue inhibitors in human endometrial fibroblasts. Eur J Biochem. 1999;259:40–45. doi: 10.1046/j.1432-1327.1999.00001.x. [DOI] [PubMed] [Google Scholar]
  • 63.Meisser A, Chardonnens D, Campana A, Bischof P. Effects of tumour necrosis factor-alpha, interleukin-1 alpha, macrophage colony stimulating factor and transforming growth factor beta on trophoblastic matrix metalloproteinases. Mol Hum Reprod. 1999;5:252–260. doi: 10.1093/molehr/5.3.252. [DOI] [PubMed] [Google Scholar]
  • 64.Karmakar S, Das C. Regulation of trophoblast invasion by IL-1beta and TGF-beta1. Am J Reprod Immunol. 2002;48:210–219. doi: 10.1034/j.1600-0897.2002.01151.x. [DOI] [PubMed] [Google Scholar]
  • 65.Cohen M, Meisser A, Haenggeli L, Bischof P. Involvement of MAPK pathway in TNF-alpha-induced MMP-9 expression in human trophoblastic cells. Mol Hum Reprod. 2006;12:225–232. doi: 10.1093/molehr/gal023. [DOI] [PubMed] [Google Scholar]
  • 66.Renaud SJ, Postovit LM, Macdonald-Goodfellow SK, McDonald GT, Caldwell JD, Graham CH. Activated macrophages inhibit human cytotrophoblast invasiveness in vitro. Biol Reprod. 2005;73:237–243. doi: 10.1095/biolreprod.104.038000. [DOI] [PubMed] [Google Scholar]
  • 67.Renaud SJ, Macdonald-Goodfellow SK, Graham CH. Coordinated regulation of human trophoblast invasiveness by macrophages and interleukin 10. Biol Reprod. 2007;76:448–454. doi: 10.1095/biolreprod.106.055376. [DOI] [PubMed] [Google Scholar]

RESOURCES