Skip to main content
World Journal of Gastrointestinal Oncology logoLink to World Journal of Gastrointestinal Oncology
. 2011 Feb 15;3(2):24–32. doi: 10.4251/wjgo.v3.i2.24

T(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas are heterogeneous with respect to the VH gene mutation status

Xavier Sagaert 1,2,3,4,5, Brigitte Maes 1,2,3,4,5, Vera Vanhentenrijk 1,2,3,4,5, Mathijs Baens 1,2,3,4,5, Eric Van Cutsem 1,2,3,4,5, Gert De Hertogh 1,2,3,4,5, Karel Geboes 1,2,3,4,5, Thomas Tousseyn 1,2,3,4,5
PMCID: PMC3046183  PMID: 21364843

Abstract

AIM: To investigate how t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas relate to other marginal zone lymphomas with respect to the somatic mutation pattern of the VH genes and the expression of the marker CD27.

METHODS: The VH gene of 7 t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas was amplified by PCR using family specific VH primers and a consensus JH primer. PCR products were sequenced and mutation analysis of the CDR and the FR regions was performed. All cases were immunostained for CD27.

RESULTS: One case showed unmutated VH genes while the others showed mutated VH genes with mutation frequencies ranging from 1.3 to 14.7% and with evidence of antigen selection in 2 cases. These data suggest that the translocation t(11;18)(q21;q21) can target either B-cells at different stages of differentiation or naive B-cells that retain the capacity to differentiate upon antigen stimulation. All cases but one displayed weak to strong CD27 expression which did not correlate with the VH gene mutation status.

CONCLUSION: t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas are heterogeneous with respect to the VH mutation status and CD27 is not a marker of somatically mutated B-cells.

Keywords: Gastrointestinal MALT lymphoma, t(11, 18)(q21, q21), VH mutation, Marginal zone, CD27

INTRODUCTION

Extranodal marginal zone lymphoma or MALT lymphoma is listed as a separate disease entity in the World Health Organisation (WHO) classification of lymphoid tumors, and comprises 8% of all non-Hodgkin lymphomas[1]. These tumors typically arise at sites normally devoid of lymphoid tissue, which have accumulated lymphoid tissue in the context of long-standing antigenic stimulation resulting from causes such as chronic bacterial infection [Helicobacter pylori (H. pylori), Campylobacter jejuni, Chlamydia psittaci, Borrelia Burgdorferi], chronic viral infection (Hepatitis C) or autoimmune disease (Sjögren’s syndrome, Hashimoto thyroiditis)[2]. Several genetic aberrations have been identified in MALT lymphomas, some of which appear to be specific for, or at least closely related to, this type of lymphoma. As such, the chromosomal translocations t(11;18)(q21;q21), t(1;14)(p22;q32), t(14;18)(q32;q21), and t(3;14)(p13;q32) are known to occur with variable frequencies in MALT lymphomas, resulting in IGH-BCL10, IGH-MALT1, API2-MALT1 and IGH-FOXP1 rearrangements respectively3-5. The oncogenic activity of the 3 translocations t(1;14)(p22;q32), t(14;18)(q32;q21) and t(11;18)(q21;q21) is linked to the physiological role of the BCL10 and MALT1 proteins in the antigen receptor-mediated activation of NF-kB, which is the transcription factor of a number of survival- and proliferation-related genes in B cells[6,7]. The oncogenic role of the IGH-FOXP1 fusion transcript is unknown.

MALT lymphomas may be encountered at virtually any extranodal site of the human body, among which the stomach is the most frequently involved organ. In this particular location, the occurrence of MALT lymphomas is associated with H. pylori infection[8]. A high incidence (about 25%) of t(11;18)(q21;q21) is detected in gastric MALT lymphomas whereas this translocation is rarely found in MALT lymphomas outside the gastrointestinal tract (with the exception of pulmonary MALT lymphomas)[9-11]. Remarkably, the presence of t(11;18)(q21;q21) in MALT lymphomas correlates with the lack of any further genetic instability or chromosomal imbalance[12,13]. T(11;18)(q21;q21)-positive gastric MALT lymphomas do not differ from their t(11;18)(q21;q21)-negative counterparts, with respect to morphology and immunophenotype[3]. However, several studies have revealed that t(11;18)(q21;q21)-positive gastric MALT lymphomas are more often resistant to H. pylori eradication treatment[11,14-16]. Nevertheless, complete lymphoma regression can still be obtained in 20% of these cases after H. pylori eradication[17]. In addition, for a decade, researchers believed that t(11;18)(q21;q21)-positive gastric MALT lymphomas rarely if ever evolve to a more aggressive diffuse large B-cell lymphoma (DLBCL)[11,14-16], however, new data show that the t(11;18)(q21;q21) can be found in both gastric MALT lymphomas and gastric DLBCLs at approximately equivalent frequencies[18]. Although the presence of t(11;18)(q21;q21) may facilitate and/or confirm the diagnosis of a MALT lymphoma, current guidelines do not recommend a routine screening for the t(11;18)(q21;q21) once the diagnosis of a gastric MALT lymphoma has been established[19].

The immunoglobulin heavy chain (IgH) locus on chromosome 14 contains an estimated 100 to 150 variable (VH) genes, 30 diversity (D) genes, and six junctional (JH) gene segments. During the maturation of a normal B cell, the unique combination of single germline VH, D, and JH gene fragments gives rise to a functional VH-D-JH unit[20]. Added diversity occurs through the junctional insertion of nucleotides at the boundaries of these fragments and through somatic hypermutation, where the nucleotide sequences of the germline fragments are altered. Because somatic hypermutation of Ig VH genes appears to be restricted to B cells proliferating within the microenvironment of the germinal, somatically mutated V-regions are a hallmark of germinal B cells and their descendants[21]. The positive or negative selective pressure of somatic hypermutation in B cell malignancies can pinpoint the developmental stage of the neoplastic cells[22]. Therefore, through positive selective pressure, somatic hypermutations have been found in post-germinal centre B cell lymphomas such as follicular lymphoma[23], but not (or to a much lesser extent) in pregerminal B cell lymphomas, such as mantle cell lymphoma[24]. Lymphomas arising from the marginal zone (e.g. extranodal, nodal and splenic marginal zone lymphomas) seem to carry either unmutated, slightly mutated or highly mutated VH genes, either with or without evidence of antigen selection[25-40]. These findings indicate that MALT lymphomas are heterogeneous with respect to the B cell differentiation stage at which clonal expansion occurs (being either a naive, early or late memory cell) and that direct antigen stimulation may be involved in the development or growth of the lymphoma.

The presence of somatic hypermutations in B cells has been associated, not only with post-germinal centre status, but also with CD27 expression. CD27 is a type I glycoprotein that is member of the tumor necrosis factor (TNF) receptor family, with unique cysteine-rich motifs. It is considered to be a marker for memory B cells based on the following observations: (a) circulating IgM+/IgD+/CD27+ B cells contain somatic VH gene mutations in contrast to peripheral IgM+/IgD+/CD27- B cells[41,42]; (b) immunoglobulin class switching is more frequent among CD27-positive than CD27-negative B cells[43]; (c) upon activation, CD27-positive B cells secrete antibodies more efficiently than CD27-negative B cells[44]; (d) cord blood B cells do not express CD27, while the percentage of CD27-positive B cells in blood increases with age[45]; and (e) in the presence of stimuli such as IL-10, SAC plus IL-2 and IL4, prompt differentiation into plasma cells occurs in CD27-positive B cells but not in CD27-negative B cells[42,46]. CD27 expression has not been investigated yet in lymphomas that are considered to arise from somatically mutated B cells.

Here, we investigated how the t(11;18)(q21;q21)-positive gastrointestinal MALT lymphoma subtype relates to other marginal zone lymphomas with respect to the somatic mutation pattern of the VH genes and analyzed 7 t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas. In addition, these 7 cases were stained for CD27 to correlate expression of this protein with the somatic mutation pattern of the VH genes.

MATERIALS AND METHODS

Cases

For this study, the number of representative cases documented with both surgical resection specimens and frozen tissue (as required for adequate mutation analysis) was limited. This is due to the current conservative treatment of gastric MALT lymphomas (the majority of gastric MALT lymphomas regress after H. pylori eradication therapy) and the rare occurrence of t(11;18)(q21;q21). As such, only 7 gastrointestinal MALT lymphomas, documented by the presence of the t(11;18)(q21;q21) on RT-PCR, were analysed. All these cases were described in detail in a previous study[3]. Freshly frozen tissue samples were obtained from surgical specimen: 6 gastrectomy specimens (case 1, 2, 3, 4, 5 and 7) and 1 enterectomy specimen (case 6). From case 6, in addition to the DNA derived from the intestinal biopsy, DNA derived from a gastric biopsy, taken after 54 months of follow-up, was analysed. In all 7 cases, the breakpoints within the API2 gene occurred consistently in intron 7 (now annotated as intron 6 according to Ensembl gene ENSG00000023445) whereas the breakpoints within the MALT1 coding DNA were variable and located in intron 4 (case 3 and 4), 7 (case 5, 6 and 7) and 8 (case 1 and 2), resulting respectively in API2/exon7-MALT1/exon5, API2/exon7-MALT1/exon8 and API2/exon7-MALT1/exon9 fusions.

The principle clinical features of the MALT lymphoma case are shown in Table 1. It is important to notice that all diagnoses were made in the late eighties before gastric MALT lymphoma was known to be related to chronic H. pylori infection. However, immunostaining for H. pylori at a later time revealed the presence of this bacterium in 5 of the 6 gastrectomy specimens as well as in the enterectomy specimen. As H. pylori eradication therapy was not known yet at time of diagnosis, surgical resection of the lymphoma site was the first choice of treatment in all patients (total gastrectomy in 6 patients and partial enterectomy in one patient). All cases were morphologically reviewed according to the WHO classification criteria for lymphoid neoplasms[1]. Histological examination was performed on paraffin-embedded tissue using HE staining. Paraffin-embedded and frozen sections were subjected to immunohistochemical stainings using the following markers: CD20, CD3, CD5, IgM, IgD, kappa, lambda, CD10, CD23 and CD27 (Table 2).

Table 1.

Clinical details of cases with t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas

Case Age (yr) Sex Hp Site Stage Therapy Follow-up data
1 60 F + Stomach IE Surg CR
2 40 M + Stomach II Surg + RT CR
3 50 M + Stomach II Surg + RT CR
4 52 M + Stomach IE Surg CR
5 42 M + Stomach IE Surg CR
6 46 M + Small intestine IE Surg Relapse in stomach 1 year after initial diagnosis, with PR and SD after (recurrent) therapy (surg, RT, CT, Hp eradication)
7 52 M - Stomach IE Surg Relapse in lung 8 years after initial diagnosis with CR after secondary treatment (CT)

Surg: Surgerical resection; RT: Radiotherapy; CT: Chemotherapy; CR: Complete response; PR: Partial response; SD: Stable disease; Hp: Helicobacter pylori.

Table 2.

Panel of primary antibodies used in immunohistochemical techniques

Antibody Clone Company Dilution Specificity
CD20 L26 Dakocytomation, Denmark 1/100 pan-B cell marker
CD3 - Dakocytomation, Denmark 1/50 pan-T cell marker
CD5 Leu1 Becton, Dickinson and Company, US 1/5 pan-T cell marker, some B cell lymphomas
CD10 56C6 Novocastra, UK 1/20 GC B cells, GC B cell lymphomas
CD23 1B12 Novocastra, UK 1/10 Mature B cells, dendritic cells
CD27 137B4 Novocastra, UK 1/50 T cells, activated B cells
IgM R1/69 Dakocytomation, Denmark 1/5000 B cells
IgD IgD26 Dakocytomation, Denmark 1/10 B cells
Kappa 163-42 Becton, Dickinson and Company, US 1/25 B cells
Lambda 1-155-2 Becton, Dickinson and Company, US 1/100 B cells

PCR amplification of the rearranged IgH gene

For all cases, DNA was extracted from whole frozen tissue sections. PCR for the IgH gene was performed in 6 separate reactions with 6 VH family specific primers (primers VH1-FR1, VH2-FR1, VH3-FR1, VH4-FR1, VH5-FR1, VH6-FR1) directed to the FR1 region and a common consensus primer directed to the JH region (primer JH) (for primer sequences see Table 3). One µL of DNA was used in a final volume of 20 μL containing primers (2 mmol/L), dNTPs (200 μmol/L), commercially prepared PCR buffer (Promega), MgCl2 (2.5 mmol/L) and Taq Polymerase (2.5 units). Thermocycler conditions were: denaturation at 94°C, annealing at 59°C and extension at 72°C, each for 40 s with a total number of 50 cycles. All PCR products were electrophoresed in a 1.5% agarose gel containing ethidium-bromide. All amplifications were performed in duplicate. Positive and negative controls were included, consisting respectively of Namalwa cell line DNA and dH2O. In cases where two or more similarly dominant bands were obtained, a second PCR amplification was performed on the respective PCR products (diluted 1/100), as well as on the original DNA, using primer IgH FR3 region (which is internal to the FR1 primers) (Table 3) and primer JH under the same conditions, allowing amplification of the CDR3 region. The obtained products were electrophoresed on an 8% polyacrylamide gel and visualised with ethidium-bromide. By comparing the lengths of the PCR products, it was established which product of the initial PCR was amplified from the monoclonally rearranged IgH gene.

Table 3.

Primer sequences

Primer Sequence
VH1-FR1 5’CCTCAGTGAAGTCTCCTGCAAGG 3’
VH2-FR1 5’TCCTGCGCTGGTGAAAGCCACACA 3’
VH3-FR1 5’GGTCCCTGAGACTCTCCTGTGCA 3’
VH4-FR1 5’TCGGAGACCCTGTCCCTCACCTGCA 3’
VH5-FR1 5’GAAAAAGCCCGGGGAGTCTCTGGA 3’
VH6-FR1 5’CCTGTGCCATCTCCGGGGACAGTG 3’
JH 5’ACCTGAGGAGACGGTGACC 3’
IgH FR3 5’CTGTCGACACGGCCGTGTATTACTG 3’

Sequencing of PCR products and sequencing analysis

Sequencing was performed in both directions with the same oligonucleotides used in the PCR amplifications. The nucleotide sequences of the amplification products representative of the IgH rearrangements were compared with the VBASE directory (VBASE Sequence Directory, I.M.; Tomlinson, MRC Centre for Protein Engineering, Cambridge, UK; URL: www.mrc-cpe.cam.ac.uk/imt-doc)[47] using the DNAPLOT analysis software. A diversity (D) germline segment was assigned to the longest stretches with the highest nucleotide homology with a minimum of six successive matches or seven matches interrupted by one mismatch.

Somatic mutation analysis

Mutations in the variable region were identified by comparing the nucleotide sequence of each case with the closest germline VH sequence. Two nucleotide exchanges in one codon resulting in a replacement (R) mutation, was considered as a single mutation. Mutations at the FR1 primer site and at the joining site of the VH segment were not regarded as mutations. The number of expected R mutations in the complementary determining region (CDR) or framework region (FR) was calculated using the formula: Exp R (CDR or FR) = n × (CDR Rf or Fr Rf) × (CDRrel or FRrel); where n is the total number of observed mutations, CDRrel or FRrel is the relative size of CDRs or FRs and Rf is the inherent replacement frequency to CDRs or FRs sequences. The Rf value was calculated for the amplified region (excluding primer site) of each VH germline gene used by our cases, according to Chang and Casali[48]. According to the binomial distribution model, the probability that excess or scarcity of R mutations in CDRs or FRs occurred on the basis of chance alone was calculated using the formula: p = {n!/[k! (n - k)!]} × qk × (1 - q)n-k; where k is the number of observed mutations in the CDRs or FRs and q is the probability that an R mutation will localise to CDRs or FRs (q = CDRrel × CDR Rf or FR rel × FR Rf)48.

RESULTS

Morphology and immunohistochemistry

All 7 gastrointestinal MALT lymphomas demonstrated a similar monomorphic morphology, being a proliferation predominantly composed of centrocyte-like cells mixed with a small number of lymphocyte-like cells and large activated B-cells. The results of the immunohistostainings are summarized in Table 4. Of interest, in all but one cases, weak to strong CD27 expression was present.

Table 4.

Immunohistochemical staining data

Case CD20 CD3 CD5 CD10 CD23 CD27 IgM IgD Igκ/Igλ
1 + - - - - - + -/+ Igκ
2 + - - - - + + - Igλ
3 + - - - - ++ + - Igκ
4 + - - - - + + - Igκ
5 + - - - - ++ + - Igλ
6 + - - - - ++ + - Igκ
7 + - - - - ++ + -/+ Igκ

PCR amplification of the rearranged IgH gene

A predominant band was obtained in cases 2, 3, 6 and 7. Cases 1, 4 and 5 revealed two similarly dominant bands but PCR of the CDR3 region allowed identification the VH family involved (Figure 1). PCR analysis thus revealed the use of VH3 family, VH4 family and VH1 family genes in case 4, 2 and 1 respectively (Table 5). The corresponding PCR products were used for sequencing.

Figure 1.

Figure 1

Gel electrophoresis of PCR products from case 1, obtained with 6 primer sets amplifying the FR1-JH region (A) and the FR3-JH region (B). Experiments were performed in duplicate. For all amplifications, the reverse primer was JH. A: The forward primers used are indicated on the gel. The agarose gel shows predominant bands with primer sets VH3-JH and VH5-JH; B: Polyacrylamide gel showing FR3-JH amplicons of the same length starting from the VH3-JH PCR product (lanes 1, 2) and from the initial DNA sample (lanes 5, 6). No monoclonal FR3-JH product was obtained starting from the VH5-JH PCR product (lanes 3, 4). These results indicate that the lymphoma cells use a VH3 family gene and that the product obtained with the VH5-JH set is an unspecific product.

Table 5.

Usage of the rearranged VH, DH and JH gene segments and VH mutation analysis of gastric MALT-type lymphoma, characterised by the presence or absence of the API2-MALT1 fusion abnormality

Case API2-MALT1 Germline VH
Identity (%) Obs R/S CDR Obs R/S FR Exp R/S CDR Exp R/S FR pCDR pFR DH JH
Locus Name
1 + VH3-30 DP-49 92.4 4/2 5/4 3/1 8/3 0.217 0.062 DH3-10 JH3
2 + VH3 HHG4 97.7 1/2 0/1 1/0 2/1 0.421 - NI JH4
3 + VH1-69 DP-10 85.3 11/3 11/4 7/2 15/5 0.030 0.040 DH1-1 JH5
4 + VH4-34 DP-63 98.7 0/0 1/2 1/0 2/1 - 0.352 NI JH6
5 + VH4-39 DP-79 98.6 0/0 0/3 1/0 2/1 - - NI JH4
61 + VH3-33 DP-50 100 0/0 0/0 - - - - DH1-20 JH6
7 + VH3-30 DP-49 95.1 5/0 2/2 2/1 5/2 0.030 0.048 DH3-10 JH4
1

Results obtained on the diagnostic intestinal biopsy as well as on a gastric biopsy after 54 mo follow-up; VH genes: Immunoglobulin heavy chain variable gene; R: Replacement mutation; S: Silent mutation; CDR: Complementarity determining regions; FR: Framework regions; Obs R/S CDR and Obs R/S FR: Number of the observed R and S mutations in the CDR and FR, respectively; Exp R/S CDR and Exp R/S FR: Number of expected R and S mutations in the CDR and FR, respectively; pCDR and pFR: Probability that excess or scarcity of the R mutations in the VH gene CDR or FR resulted from chance only; P values < 0.05 were considered statistical significant; NI: Not identified. VH sequences were compared with germline VH sequences included in the VBASE sequence directory.

Sequence analysis

All VDJ rearrangements were in frame and none contained a stop codon, indicating that all were productive. Results are summarised in Table 5.

Of the 4 cases using a VH3 family gene, 2 (cases 1 and 7) used a VH gene most closely related to the VH3-30 (DP-49) germline gene with a nucleotide similarity of 92.4 and 95.1%, respectively. Other VH3 family germline genes were the VH3-33 (DP-50) gene (case 6) and the HHG4 gene (case 2) with identities of 100 and 97.7% respectively. In the one case using a VH1 family gene (case 3), the VH segment was closely related to the same germline gene, being the VH1-69 (DP-10) gene with 85.3% homology. The 2 VH4 family genes identified showed the highest homology to the VH4-34 (DP-63) (case 4, 98.7% homology) and the VH4-39 (DP-79) (case 5, 98.6% homology) germline genes.

DH segments and JH segments were assigned in respectively 4 and 7 of 7 cases. A preferential use of the JH4 segment was observed (3 times). Both cases with involvement of the VH3-30 germline gene (cases 1 and 7), used the same DH segment (DH3-10) but different JH segments (JH3 and JH4 respectively).

The follow-up gastric sample (taken at 54 mo follow-up) of case 6 revealed the same VDJ rearrangement as obtained from the diagnostic sample.

Mutation analysis

In 6 of 7 cases, the VH segment showed single nucleotide substitutions with respect to the closest germline gene with identities ranging from 85.3% to 98.8% (Table 5). Some of these nucleotide differences may represent polymorphisms. However, sequence polymorphism among VH genes is generally low and the detected differences probably represent somatic mutations[7]. The VH segment used by the remaining case (case 6) was 100% identical to the assigned VH gene. Furthermore, in case 6, the VH gene amplified from the gastric follow-up sample did not show somatic mutations. The nucleotide sequences of the VH genes and comparison to the germline sequences for cases 1 and 7, both using the DP-49 germline, are illustrated in Figure 2.

Figure 2.

Figure 2

Mutation analysis of the DP-49 gene used in cases 1 and 7, compared to the germline DP-49 gene sequence. CDR regions are indicated. Dashes indicate sequence similarity. Replacement mutations are shown in bold.

The distribution of replacement (R) and silent (S) somatic mutations in each VH sequence was analysed according to Chang and Casali (Table 5). The P values indicating whether excess or scarcity of the R mutations in the CDR or FR resulted from chance alone were considered statistically significant if below 0.05. For cases 3 and 7, a preferential clustering of R mutations in the CDR regions was observed (P values respectively 0.03 and 0.03) as well as a significantly lower number of R mutations than expected in the FR regions (P values respectively 0.040 and 0.048). This somatic mutation pattern is indicative for positive antigen selection as well as negative selection against R mutations within the FR regions to preserve the structure of the immunoglobulin. No significant clustering of R mutations was observed for the remaining cases with somatic VH mutations (cases 1, 2 and 4).

DISCUSSION

This is the first study analysing the VH mutation status in a series of gastrointestinal MALT lymphomas characterised by t(11;18)(q21;q21). One of the investigated cases (case 6) showed unmutated VH genes while the others showed mutated VH genes with mutation frequencies ranging from 1.3 to 14.7%. Two of the cases with mutated VH gene (cases 3 and 7) showed evidence of both positive and negative antigen-driven selection with clustering of replacement mutations within the CDR regions and a lower incidence of replacement mutations than expected in the FR regions. The latter was also observed in a further mutated case (case 1: statistical significance not reached), without evidence for positive selective pressure, and is consistent with a selection to preserve immunoglobulin structure. Three VH mutated cases (case 2, 4, 5) showed only few differences from the corresponding germline genes, not indicative of antigen mediated selection. The presence of a low number of somatic VH mutations without evidence of antigen selection may indicate an origin from an early memory B cell which had not yet undergone multiple rounds of antigen selection in the germinal centre[49].

These data show that t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas may harbour unmutated, slightly or highly mutated VH genes, indicating that they are composed either of naive B cells or of early or late memory B cells. The fact that at least part of the cases were composed of memory B cells, shows evidence of antigen selection that may have taken place at the onset of the lymphomatous process. This heterogeneity within t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas is consistent with that reported in similar studies on both gastric and non-gastric MALT lymphomas in which data on the presence of t(11;18)(q21;q21) was not available[26,27,30,32-36,38-40]. In addition, analysis of the VH mutation status in 2 t(11;18)(q21;q21)-negative MALT lymphomas (data not shown) revealed a mutation frequency of 0% and 4.5% respectively, indicating that, similar to what is observed in t(11;18)(q21;q21)-positive MALT lymphomas, t(11;18)(q21;q21)-negative MALT lymphomas can be derived from both naïve and memory B cells. Thus, the presence or absence of the API2-MALT1 fusion transcript is not related to a particular B cell stage from which the MALT lymphoma originates. Our results are also in line with studies analysing the composition of the reactive marginal zone, which is thought to represent the normal counterpart of marginal zone cell lymphomas. Indeed, mutation analysis of the rearranged VH genes of reactive marginal zone B cells indicated that the marginal zone is composed of a heterogeneous B cell population, with naive as well as memory B cells[50,51]. A subpopulation of memory B cells present in the normal marginal zone shows a characteristic pattern of somatic mutations indicative of antigen selection and therefore probably participates in the T cell dependent immune reaction[52,53]. It is of interest that 3 distinct pathways for recruitment of B cells in the marginal zone have been demonstrated in animal models: (a) maturation of virgin recirculating B cells, a process that occurs in the absence of T cells and does not require B cell proliferation; (b) colonisation by memory B cells generated in the germinal centres; (c) recruitment of both virgin and memory marginal zone B cells into antibody responses[54].

Our results also show that t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas predominantly rearrange VH3 family and to a lesser extent VH4 and VH1 family genes, in cases 4, 2 and 1 respectively. This is similar to what was previously observed in several studies on MALT lymphoma[27,30,32-35,39] and one study on nodal marginal zone lymphoma[28]. In addition, it was found that the two t(11;18)(q21;q21)-negative gastric MALT lymphomas rearranged VH3 and VH1 family genes respectively (data not shown). The restricted use of VH genes further suggests that antigen stimulation may play a role in MALT lymphomagenesis. Interestingly, one particular VH gene was represented twice, i.e.the VH3-30 (DP-49) gene in cases 1 and 7. In both cases, the VH3-30 gene was joined with the D3-10 gene and the mutation pattern was indicative for antigen selection. The VH3-30 gene seems to be frequently involved in auto-antibody production[38,55]. Therefore, our results support the idea that at least some t(11;18)(q21;q21)-positive gastric MALT lymphomas may result from the transformation of auto-reactive B cell clones. This is in line with the observation that gastric MALT lymphoma cells produce immunoglobulins that do recognise various autoantigens[55]. Also, antibodies to gastric epithelial cells are commonly present in serum samples from patients with H. pylori gastritis, and an anti-idiotype antibody to immunoglobulins of a gastric MALT lymphoma cross-reacts specifically with reactive B cells in H. pylori gastritis[56,57]. Another VH gene, VH1-69 (DP-10), was also found in two gastric MALT lymphoma cases, one a t(11;18)(q21;q21)-positive case (case 3) and the other a t(11;18)(q21;q21)-negative case (data not shown). The VH1-69 gene was reported to be used frequently in nodal marginal zone lymphomas, with a similar mutation pattern as observed in our study, and also in salivary gland MALT lymphomas[26,36]. This indicates that nodal marginal zone lymphomas and MALT lymphomas, occurring at different anatomic sites and either with or without the t(11;18)(q21;q21), may be derived from B cells that are driven by similar antigen epitopes. Moreover, Marasca et al. observed an association between the use of the VH1-69 gene in a series of nodal marginal zone lymphomas and the occurrence of Hepatitis C virus infection. Unfortunately, the Hepatitis C virus infection status of our 2 cases using VH1-69 gene was not known.

In view of the reported association between CD27 expression in B cells and the presence of somatic hypermutations, we stained all 7 MALT lymphomas for CD27 and correlated these immunohistochemical data with the VH gene mutation status. No specific correlation between CD27 expression and the mutation status of the VH gene was found, as strong CD27 expression did occur in the one case (case 6) with an intact germline VH gene, while there was a lack of CD27 expression in the one case (case 1) that displayed the second most diversified VH gene. This observation is in line with data on mice models that questioned whether CD27 is a marker of memory B cells, since CD27 expression did occur in somatically unmutated B cells and CD27 deficiency did not affect somatic diversification in a CD27 knockout mice model[58]. As such, our study does not support the hypothesis that CD27 is a general marker of somatically mutated B cells and further emphasises that the only definitive marker of memory B cells thus far identified is the presence of somatically mutated immunoglobulins. However, our data on CD27 expression should be interpreted with caution as the precise role of (loss of) CD27 expression in (marginal zone) lymphomas remains to be investigated.

Apart from the evidence for antigen selection of the lymphomatous cells, others have found that ongoing mutation (i.e. intraclonal variation) of the VH genes indicating that continuing antigen stimulation may play a role in the clonal expansion of the MALT lymphoma B cells[30,32,34,35,38]. Our approach using direct sequencing of DNA extracted from whole tissue sections does not allow the identification of subclones within a lymphomatous proliferation. Nevertheless, from case 6, we were able to analyse DNA from the diagnostic sample as well as DNA from a gastric biopsy taken 54 months later. Case 6 was a t(11;18)(q21;q21)-positive MALT lymphoma diagnosed with large masses in the upper intestine, extending into the stomach. This patient showed evidence of minimal residual disease at all time points of his follow-up, as shown by the detection of the API2-MALT1 fusion transcripts and of the reciprocal genomic fusion. The latter is confirmed by the results of the present study, demonstrating the presence of lymphoma cells in the stomach harbouring the same VDJ rearrangement as used by the initial intestinal lymphoma cells, 4.5 years after the original diagnosis. Moreover, the VH gene was unmutated in both samples. The lack of VH somatic mutations in the diagnostic as well as in the follow-up sample, indicates that this t(11;18)(q21;q21)-positive MALT lymphoma is composed of naive B cells that have not yet gone through the germinal centre reaction and, therefore, tumor growth seems not to be stimulated by a T cell dependent antigen response. As shown in Table 1, this case was characterised by relapse in the stomach after one year, with stable disease thereafter (despite intensive therapy). Remarkably, in some B cell non-Hodgkin lymphomas, the lack of somatic mutations has been linked to an unfavourable clinical outcome. As such, patients with chronic lymphocytic leukaemia or mantle cell lymphoma whose tumors have mutated VH genes have a better prognosis than those with intact germline VH genes[59-61].

As all cases analysed in this study showed the presence of the t(11;18)(q21;q21), we may speculate on the stage of B cell differentiation at which this genetic abnormality is acquired. Several possibilities can be considered. Firstly, our results may indicate that the t(11;18)(q21;q21) can be acquired at different stages of B cell differentiation.However, the hypothesis that the t(11;18)(q21;q21) may confer a transforming potential to the preceding antigen mediated lymphoid proliferation, is supported only by some of the cases, i.e. those with mutated VH genes and evidence of antigen selection. Secondly, it may be hypothesised that the acquisition of the t(11;18)(q21;q21) occurs at a naive B cell stage in all cases, representing the primary proliferation stimulus, and that somatic VH mutations are acquired after the malignant transformation induced by the API2-MALT1 fusion transcript. An additional pathogenic role of antigen stimulation at the origin and/or expansion of the lymphoma, acting synergistic with the API2-MLT fusion protein cannot be excluded. The evidence for (auto-)antigen selection that we found in some of the cases may be supportive of this latter suggestion. However, this hypothesis seems to conflict with the fact that H. pylori reactive T-cells have been shown to drive gastric MALT lymphoma cells, regardless of the presence or absence of the t(11;18)(q21;q21)[62]. Alternatively, the acquisition of somatic VH mutations in an t(11;18)(q21;q21)-positive MALT lymphoma might represent an epiphenomenon without important significance.

COMMENTS

Background

MALT lymphomas are tumors that arise from the marginal zone compartment of the B-follicle at extranodal sites. Gastric MALT lymphoma accounts for 5% of all gastric neoplasia and at least 50% of all gastric lymphomas, making it the most frequent lymphoma of the gastrointestinal tract. Its pathogenesis is clearly linked with Helicobacter pylori (H. pylori) gastritis and 25% of all gastric MALT lymphomas display the translocation t(11;18)(q21;q21).

Research frontiers

The t(11;18)(q21;q21) results in the expression of the aberrant API2-MALT1 fusion protein. Presence of API2-MALT1 in gastric MALT lymphomas is associated with resistance to H. pylori eradication therapy and with the absence of any further genetic instability or chromosomal imbalances. In this study, the authors investigate how t(11;18)(q21;q21)-positive gastrointestinal MALT lymphomas relate to other marginal zone lymphomas with respect to the somatic mutation pattern of the VH genes and the expression of the marker CD27.

Innovations and breakthroughs

Reports show that both gastric and non-gastric MALT lymphomas harbour unmutated, slightly or highly mutated VH genes, indicating that they are composed either of naive B cells or of early or late memory B cells. This is the first study analysing the VH mutation status in a series of gastrointestinal MALT lymphomas in correlation with the t(11;18)(q21;q21). It was found that the presence or absence of the API2-MALT1 fusion transcript is not related to a particular B cell stage from which the MALT lymphoma originates. In addition, we provide evidence that CD27 is not a marker of somatically mutated B-cells, contrary to what is generally believed.

Applications

By understanding at what B-cell stage the t(11;18)(q21;q21) is acquired, this study may contribute to a better understanding of the pathogenesis of gastrointestinal MALT lymphomas in general and may be of importance to therapeutic strategies that target the API2-MALT1 fusion transcript and/or interfere with the NF-kB pathway.

Terminology

API2 and MALT1 are proteins that play a key role in the antigen receptor-mediated activation of NF-kB, which is the transcription factor of a number of survival- and proliferation-related genes in B cells. Not surprisingly, the formation of an aberrant fusion protein API2-MALT1 will deregulate the NF-kB pathway and result in uncontrolled B-cell proliferation and thus (gastrointestinal MALT) lymphomagenesis.

Peer review

In this work, the author reported the association between the VH gene mutation and T(11;18)(q21;q21)-positive gastric MALT lymphomas. And they suggest that this translocation will target different stage of B-cells. Their observation is interesting, however, the clinical sample size is somewhat small.

Acknowledgments

The authors thank Miet Vanherck for excellent technical assistance.

Footnotes

Supported by A Grant of the “Belgian Cancer Association” and the “Fonds voor Wetenschappelijk Onderzoek Vlaanderen”

Peer reviewer: Joseph T Tseng, Assistant Professor, Institute of Bioinformatics, College of Bioscience and Biotechnology, National Cheng-Kung University, No.1 University Rd, Tainan, 701, Taiwan, China

S- Editor Wang JL L- Editor Hughes D E- Editor Ma WH

References

  • 1.Jaffe ES, Harris N, Stein H, Vardiman J. World Health Organisation Classification of Tumours: Pathology and Genetics: Tumours of Haemopoietic and Lymphoid Tissues. Lyon, France: IAR Press;; 2008. [Google Scholar]
  • 2.Suarez F, Lortholary O, Hermine O, Lecuit M. Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation. Blood. 2006;107:3034–3044. doi: 10.1182/blood-2005-09-3679. [DOI] [PubMed] [Google Scholar]
  • 3.Baens M, Maes B, Steyls A, Geboes K, Marynen P, De Wolf-Peeters C. The product of the t(11;18), an API2-MLT fusion, marks nearly half of gastric MALT type lymphomas without large cell proliferation. Am J Pathol. 2000;156:1433–1439. doi: 10.1016/S0002-9440(10)65012-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Streubel B, Lamprecht A, Dierlamm J, Cerroni L, Stolte M, Ott G, Raderer M, Chott A. T(14;18)(q32;q21) involving IGH and MALT1 is a frequent chromosomal aberration in MALT lymphoma. Blood. 2003;101:2335–2339. doi: 10.1182/blood-2002-09-2963. [DOI] [PubMed] [Google Scholar]
  • 5.Wlodarska I, Veyt E, De Paepe P, Vandenberghe P, Nooijen P, Theate I, Michaux L, Sagaert X, Marynen P, Hagemeijer A, et al. FOXP1, a gene highly expressed in a subset of diffuse large B-cell lymphoma, is recurrently targeted by genomic aberrations. Leukemia. 2005;19:1299–1305. doi: 10.1038/sj.leu.2403813. [DOI] [PubMed] [Google Scholar]
  • 6.Ruland J, Duncan GS, Wakeham A, Mak TW. Differential requirement for Malt1 in T and B cell antigen receptor signaling. Immunity. 2003;19:749–758. doi: 10.1016/s1074-7613(03)00293-0. [DOI] [PubMed] [Google Scholar]
  • 7.Ruefli-Brasse AA, French DM, Dixit VM. Regulation of NF-kappaB-dependent lymphocyte activation and development by paracaspase. Science. 2003;302:1581–1584. doi: 10.1126/science.1090769. [DOI] [PubMed] [Google Scholar]
  • 8.Isaacson PG, Du MQ. MALT lymphoma: from morphology to molecules. Nat Rev Cancer. 2004;4:644–653. doi: 10.1038/nrc1409. [DOI] [PubMed] [Google Scholar]
  • 9.Sagaert X, Laurent M, Baens M, Wlodarska I, De Wolf-Peeters C. MALT1 and BCL10 aberrations in MALT lymphomas and their effect on the expression of BCL10 in the tumour cells. Mod Pathol. 2006;19:225–232. doi: 10.1038/modpathol.3800523. [DOI] [PubMed] [Google Scholar]
  • 10.Streubel B, Simonitsch-Klupp I, Müllauer L, Lamprecht A, Huber D, Siebert R, Stolte M, Trautinger F, Lukas J, Püspök A, et al. Variable frequencies of MALT lymphoma-associated genetic aberrations in MALT lymphomas of different sites. Leukemia. 2004;18:1722–1726. doi: 10.1038/sj.leu.2403501. [DOI] [PubMed] [Google Scholar]
  • 11.Ye H, Liu H, Attygalle A, Wotherspoon AC, Nicholson AG, Charlotte F, Leblond V, Speight P, Goodlad J, Lavergne-Slove A, et al. Variable frequencies of t(11;18)(q21;q21) in MALT lymphomas of different sites: significant association with CagA strains of H pylori in gastric MALT lymphoma. Blood. 2003;102:1012–1018. doi: 10.1182/blood-2002-11-3502. [DOI] [PubMed] [Google Scholar]
  • 12.Starostik P, Patzner J, Greiner A, Schwarz S, Kalla J, Ott G, Müller-Hermelink HK. Gastric marginal zone B-cell lymphomas of MALT type develop along 2 distinct pathogenetic pathways. Blood. 2002;99:3–9. doi: 10.1182/blood.v99.1.3. [DOI] [PubMed] [Google Scholar]
  • 13.Müller-Hermelink HK. Genetic and molecular genetic studies in the diagnosis of B-cell lymphomas: marginal zone lymphomas. Hum Pathol. 2003;34:336–340. doi: 10.1053/hupa.2003.98. [DOI] [PubMed] [Google Scholar]
  • 14.Alpen B, Neubauer A, Dierlamm J, Marynen P, Thiede C, Bayerdörfer E, Stolte M. Translocation t(11;18) absent in early gastric marginal zone B-cell lymphoma of MALT type responding to eradication of Helicobacter pylori infection. Blood. 2000;95:4014–4015. [PubMed] [Google Scholar]
  • 15.Liu H, Ruskon-Fourmestraux A, Lavergne-Slove A, Ye H, Molina T, Bouhnik Y, Hamoudi RA, Diss TC, Dogan A, Megraud F, et al. Resistance of t(11;18) positive gastric mucosa-associated lymphoid tissue lymphoma to Helicobacter pylori eradication therapy. Lancet. 2001;357:39–40. doi: 10.1016/S0140-6736(00)03571-6. [DOI] [PubMed] [Google Scholar]
  • 16.Sugiyama T, Asaka M, Nakamura T, Nakamura S, Yonezumi S, Seto M. API2-MALT1 chimeric transcript is a predictive marker for the responsiveness of H. pylori eradication treatment in low-grade gastric MALT lymphoma. Gastroenterology. 2001;120:1884–1885. doi: 10.1053/gast.2001.25305. [DOI] [PubMed] [Google Scholar]
  • 17.Zullo A, Hassan C, Cristofari F, Andriani A, De Francesco V, Ierardi E, Tomao S, Stolte M, Morini S, Vaira D. Effects of Helicobacter pylori eradication on early stage gastric mucosa-associated lymphoid tissue lymphoma. Clin Gastroenterol Hepatol. 2010;8:105–110. doi: 10.1016/j.cgh.2009.07.017. [DOI] [PubMed] [Google Scholar]
  • 18.Toracchio S, Ota H, de Jong D, Wotherspoon A, Rugge M, Graham DY, Samani A, El-Zimaity HM. Translocation t(11;18)(q21;q21) in gastric B-cell lymphomas. Cancer Sci. 2009;100:881–887. doi: 10.1111/j.1349-7006.2009.01128.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Fischbach W, Malfertheiner P, Hoffmann JC, Bolten W, Bornschein J, Götze O, Höhne W, Kist M, Koletzko S, Labenz J, et al. [S3-guideline "Helicobacter pylori and gastroduodenal ulcer disease"] Z Gastroenterol. 2009;47:68–102. doi: 10.1055/s-0028-1109062. [DOI] [PubMed] [Google Scholar]
  • 20.Sagaert X, De Wolf-Peeters C. Classification of B-cells according to their differentiation status, their micro-anatomical localisation and their developmental lineage. Immunol Lett. 2003;90:179–186. doi: 10.1016/j.imlet.2003.09.007. [DOI] [PubMed] [Google Scholar]
  • 21.Küppers R, Zhao M, Hansmann ML, Rajewsky K. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. EMBO J. 1993;12:4955–4967. doi: 10.1002/j.1460-2075.1993.tb06189.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Küppers R, Klein U, Hansmann ML, Rajewsky K. Cellular origin of human B-cell lymphomas. N Engl J Med. 1999;341:1520–1529. doi: 10.1056/NEJM199911113412007. [DOI] [PubMed] [Google Scholar]
  • 23.Bahler DW, Levy R. Clonal evolution of a follicular lymphoma: evidence for antigen selection. Proc Natl Acad Sci USA. 1992;89:6770–6774. doi: 10.1073/pnas.89.15.6770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hummel M, Tamaru J, Kalvelage B, Stein H. Mantle cell (previously centrocytic) lymphomas express VH genes with no or very little somatic mutations like the physiologic cells of the follicle mantle. Blood. 1994;84:403–407. [PubMed] [Google Scholar]
  • 25.Algara P, Mateo MS, Sanchez-Beato M, Mollejo M, Navas IC, Romero L, Solé F, Salido M, Florensa L, Martínez P, et al. Analysis of the IgV(H) somatic mutations in splenic marginal zone lymphoma defines a group of unmutated cases with frequent 7q deletion and adverse clinical course. Blood. 2002;99:1299–1304. doi: 10.1182/blood.v99.4.1299. [DOI] [PubMed] [Google Scholar]
  • 26.Bahler DW, Miklos JA, Swerdlow SH. Ongoing Ig gene hypermutation in salivary gland mucosa-associated lymphoid tissue-type lymphomas. Blood. 1997;89:3335–3344. [PubMed] [Google Scholar]
  • 27.Bahler DW, Kim BK, Gao A, Swerdlow SH. Analysis of immunoglobulin V genes suggests cutaneous marginal zone B-cell lymphomas recognise similar antigens. Br J Haematol. 2006;132:571–575. doi: 10.1111/j.1365-2141.2005.05904.x. [DOI] [PubMed] [Google Scholar]
  • 28.Camacho FI, Algara P, Mollejo M, García JF, Montalbán C, Martínez N, Sánchez-Beato M, Piris MA. Nodal marginal zone lymphoma: a heterogeneous tumor: a comprehensive analysis of a series of 27 cases. Am J Surg Pathol. 2003;27:762–771. doi: 10.1097/00000478-200306000-00006. [DOI] [PubMed] [Google Scholar]
  • 29.Conconi A, Bertoni F, Pedrinis E, Motta T, Roggero E, Luminari S, Capella C, Bonato M, Cavalli F, Zucca E. Nodal marginal zone B-cell lymphomas may arise from different subsets of marginal zone B lymphocytes. Blood. 2001;98:781–786. doi: 10.1182/blood.v98.3.781. [DOI] [PubMed] [Google Scholar]
  • 30.Coupland SE, Foss HD, Anagnostopoulos I, Hummel M, Stein H. Immunoglobulin VH gene expression among extranodal marginal zone B-cell lymphomas of the ocular adnexa. Invest Ophthalmol Vis Sci. 1999;40:555–562. [PubMed] [Google Scholar]
  • 31.Craig VJ, Arnold I, Gerke C, Huynh MQ, Wündisch T, Neubauer A, Renner C, Falkow S, Müller A. Gastric MALT lymphoma B cells express polyreactive, somatically mutated immunoglobulins. Blood. 2010;115:581–591. doi: 10.1182/blood-2009-06-228015. [DOI] [PubMed] [Google Scholar]
  • 32.Du M, Diss TC, Xu C, Peng H, Isaacson PG, Pan L. Ongoing mutation in MALT lymphoma immunoglobulin gene suggests that antigen stimulation plays a role in the clonal expansion. Leukemia. 1996;10:1190–1197. [PubMed] [Google Scholar]
  • 33.Du MQ, Xu CF, Diss TC, Peng HZ, Wotherspoon AC, Isaacson PG, Pan LX. Intestinal dissemination of gastric mucosa-associated lymphoid tissue lymphoma. Blood. 1996;88:4445–4451. [PubMed] [Google Scholar]
  • 34.Hara Y, Nakamura N, Kuze T, Hashimoto Y, Sasaki Y, Shirakawa A, Furuta M, Yago K, Kato K, Abe M. Immunoglobulin heavy chain gene analysis of ocular adnexal extranodal marginal zone B-cell lymphoma. Invest Ophthalmol Vis Sci. 2001;42:2450–2457. [PubMed] [Google Scholar]
  • 35.Kurosu K, Yumoto N, Furukawa M, Kuriyama T, Mikata A. Low-grade pulmonary mucosa-associated lymphoid tissue lymphoma with or without intraclonal variation. Am J Respir Crit Care Med. 1998;158:1613–1619. doi: 10.1164/ajrccm.158.5.9709132. [DOI] [PubMed] [Google Scholar]
  • 36.Marasca R, Vaccari P, Luppi M, Zucchini P, Castelli I, Barozzi P, Cuoghi A, Torelli G. Immunoglobulin gene mutations and frequent use of VH1-69 and VH4-34 segments in hepatitis C virus-positive and hepatitis C virus-negative nodal marginal zone B-cell lymphoma. Am J Pathol. 2001;159:253–261. doi: 10.1016/S0002-9440(10)61691-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Miranda RN, Cousar JB, Hammer RD, Collins RD, Vnencak-Jones CL. Somatic mutation analysis of IgH variable regions reveals that tumor cells of most parafollicular (monocytoid) B-cell lymphoma, splenic marginal zone B-cell lymphoma, and some hairy cell leukemia are composed of memory B lymphocytes. Hum Pathol. 1999;30:306–312. doi: 10.1016/s0046-8177(99)90010-2. [DOI] [PubMed] [Google Scholar]
  • 38.Qin Y, Greiner A, Trunk MJ, Schmausser B, Ott MM, Müller-Hermelink HK. Somatic hypermutation in low-grade mucosa-associated lymphoid tissue-type B-cell lymphoma. Blood. 1995;86:3528–3534. [PubMed] [Google Scholar]
  • 39.Tierens A, Delabie J, Pittaluga S, Driessen A, DeWolf-Peeters C. Mutation analysis of the rearranged immunoglobulin heavy chain genes of marginal zone cell lymphomas indicates an origin from different marginal zone B lymphocyte subsets. Blood. 1998;91:2381–2386. [PubMed] [Google Scholar]
  • 40.Traverse-Glehen A, Davi F, Ben Simon E, Callet-Bauchu E, Felman P, Baseggio L, Gazzo S, Thieblemont C, Charlot C, Coiffier B, et al. Analysis of VH genes in marginal zone lymphoma reveals marked heterogeneity between splenic and nodal tumors and suggests the existence of clonal selection. Haematologica. 2005;90:470–478. [PubMed] [Google Scholar]
  • 41.Klein U, Rajewsky K, Küppers R. Human immunoglobulin (Ig)M+IgD+ peripheral blood B cells expressing the CD27 cell surface antigen carry somatically mutated variable region genes: CD27 as a general marker for somatically mutated (memory) B cells. J Exp Med. 1998;188:1679–1689. doi: 10.1084/jem.188.9.1679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tangye SG, Liu YJ, Aversa G, Phillips JH, de Vries JE. Identification of functional human splenic memory B cells by expression of CD148 and CD27. J Exp Med. 1998;188:1691–1703. doi: 10.1084/jem.188.9.1691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Maurer D, Holter W, Majdic O, Fischer GF, Knapp W. CD27 expression by a distinct subpopulation of human B lymphocytes. Eur J Immunol. 1990;20:2679–2684. doi: 10.1002/eji.1830201223. [DOI] [PubMed] [Google Scholar]
  • 44.Maurer D, Fischer GF, Fae I, Majdic O, Stuhlmeier K, Von Jeney N, Holter W, Knapp W. IgM and IgG but not cytokine secretion is restricted to the CD27+ B lymphocyte subset. J Immunol. 1992;148:3700–3705. [PubMed] [Google Scholar]
  • 45.Agematsu K, Nagumo H, Yang FC, Nakazawa T, Fukushima K, Ito S, Sugita K, Mori T, Kobata T, Morimoto C, et al. B cell subpopulations separated by CD27 and crucial collaboration of CD27+ B cells and helper T cells in immunoglobulin production. Eur J Immunol. 1997;27:2073–2079. doi: 10.1002/eji.1830270835. [DOI] [PubMed] [Google Scholar]
  • 46.Agematsu K, Nagumo H, Oguchi Y, Nakazawa T, Fukushima K, Yasui K, Ito S, Kobata T, Morimoto C, Komiyama A. Generation of plasma cells from peripheral blood memory B cells: synergistic effect of interleukin-10 and CD27/CD70 interaction. Blood. 1998;91:173–180. [PubMed] [Google Scholar]
  • 47.Cook GP, Tomlinson IM. The human immunoglobulin VH repertoire. Immunol Today. 1995;16:237–242. doi: 10.1016/0167-5699(95)80166-9. [DOI] [PubMed] [Google Scholar]
  • 48.Chang B, Casali P. The CDR1 sequences of a major proportion of human germline Ig VH genes are inherently susceptible to amino acid replacement. Immunol Today. 1994;15:367–373. doi: 10.1016/0167-5699(94)90175-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kepler TB, Perelson AS. Cyclic re-entry of germinal center B cells and the efficiency of affinity maturation. Immunol Today. 1993;14:412–415. doi: 10.1016/0167-5699(93)90145-B. [DOI] [PubMed] [Google Scholar]
  • 50.Stein K, Hummel M, Korbjuhn P, Foss HD, Anagnostopoulos I, Marafioti T, Stein H. Monocytoid B cells are distinct from splenic marginal zone cells and commonly derive from unmutated naive B cells and less frequently from postgerminal center B cells by polyclonal transformation. Blood. 1999;94:2800–2808. [PubMed] [Google Scholar]
  • 51.Tierens A, Delabie J, Michiels L, Vandenberghe P, De Wolf-Peeters C. Marginal-zone B cells in the human lymph node and spleen show somatic hypermutations and display clonal expansion. Blood. 1999;93:226–234. [PubMed] [Google Scholar]
  • 52.Dunn-Walters DK, Isaacson PG, Spencer J. Analysis of mutations in immunoglobulin heavy chain variable region genes of microdissected marginal zone (MGZ) B cells suggests that the MGZ of human spleen is a reservoir of memory B cells. J Exp Med. 1995;182:559–566. doi: 10.1084/jem.182.2.559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Dunn-Walters DK, Isaacson PG, Spencer J. Sequence analysis of rearranged IgVH genes from microdissected human Peyer's patch marginal zone B cells. Immunology. 1996;88:618–624. [PMC free article] [PubMed] [Google Scholar]
  • 54.Morse HC 3rd, Kearney JF, Isaacson PG, Carroll M, Fredrickson TN, Jaffe ES. Cells of the marginal zone--origins, function and neoplasia. Leuk Res. 2001;25:169–178. doi: 10.1016/s0145-2126(00)00107-7. [DOI] [PubMed] [Google Scholar]
  • 55.Hussell T, Isaacson PG, Crabtree JE, Dogan A, Spencer J. Immunoglobulin specificity of low grade B cell gastrointestinal lymphoma of mucosa-associated lymphoid tissue (MALT) type. Am J Pathol. 1993;142:285–292. [PMC free article] [PubMed] [Google Scholar]
  • 56.Greiner A, Marx A, Heesemann J, Leebmann J, Schmausser B, Müller-Hermelink HK. Idiotype identity in a MALT-type lymphoma and B cells in Helicobacter pylori associated chronic gastritis. Lab Invest. 1994;70:572–578. [PubMed] [Google Scholar]
  • 57.Negrini R, Savio A, Poiesi C, Appelmelk BJ, Buffoli F, Paterlini A, Cesari P, Graffeo M, Vaira D, Franzin G. Antigenic mimicry between Helicobacter pylori and gastric mucosa in the pathogenesis of body atrophic gastritis. Gastroenterology. 1996;111:655–665. doi: 10.1053/gast.1996.v111.pm8780570. [DOI] [PubMed] [Google Scholar]
  • 58.Xiao Y, Hendriks J, Langerak P, Jacobs H, Borst J. CD27 is acquired by primed B cells at the centroblast stage and promotes germinal center formation. J Immunol. 2004;172:7432–7441. doi: 10.4049/jimmunol.172.12.7432. [DOI] [PubMed] [Google Scholar]
  • 59.Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL, Buchbinder A, Budman D, Dittmar K, Kolitz J, et al. Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood. 1999;94:1840–1847. [PubMed] [Google Scholar]
  • 60.Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood. 1999;94:1848–1854. [PubMed] [Google Scholar]
  • 61.Kienle D, Kröber A, Katzenberger T, Ott G, Leupolt E, Barth TF, Möller P, Benner A, Habermann A, Müller-Hermelink HK, et al. VH mutation status and VDJ rearrangement structure in mantle cell lymphoma: correlation with genomic aberrations, clinical characteristics, and outcome. Blood. 2003;102:3003–3009. doi: 10.1182/blood-2003-05-1383. [DOI] [PubMed] [Google Scholar]
  • 62.Du MQ, Isaccson PG. Gastric MALT lymphoma: from aetiology to treatment. Lancet Oncol. 2002;3:97–104. doi: 10.1016/s1470-2045(02)00651-4. [DOI] [PubMed] [Google Scholar]

Articles from World Journal of Gastrointestinal Oncology are provided here courtesy of Baishideng Publishing Group Inc

RESOURCES