Engagement of the B cell receptor for antigen differentially affects B cell responses to Toll-like receptor-7 agonists and antagonists in BXSB mice

Abstract

Nucleic acid sensors of the Toll-like receptor (TLR) family play a well-established role in the pathogenesis of lupus. This is particularly true for a single-stranded RNA-sensing TLR-7 receptor, as lupus mice lacking TLR-7 show ameliorated disease. Cytosine–guanosine dinucleotide (CpG)-DNA-sensing TLR-9, conversely, has a complex regulatory role in systemic lupus erythematosus (SLE). Much less is known about whether signals through the B cell receptor for antigen (BCR) may affect the ability of B cells to respond to suboptimal TLR-7 agonists and antagonists. We studied this question in prediseased BXSB male and female B cells. We found that male B cells responded more vigorously to numerous TLR-7 ligands and this responsiveness was enhanced further upon co-engagement of the BCR. This synergy was seen primarily with the interleukin (IL)-6 secretion. A number of 32-mer inhibitory oligonucleotides (INH-ODNs) with a nuclease-resistant phosphorothioate backbone were capable of blocking TLR-7, but not BCR-induced B cell activation, with an inhibitory concentration (IC)₅₀ of approximately 100 nm. Surprisingly, while the presence of a single TGC motif at the 5′ end of an ODN did not increase its inhibitory capacity, INH-ODNs containing multiple TGC motifs had greater inhibitory potency. When BCR and TLR-7 were co-engaged, INH-ODNs showed a differential effect on B cell activation. Whereas apoptosis protection and G1-M entry completely escaped suppression, IL-6 secretion remained sensitive to inhibition, although with a 10-fold lower potency. Our results suggest that while TLR-7 antagonists may be considered as lupus therapeutics, simultaneous co-engagement of the TLR-7 and BCR might favour autoreactive B cell survival. This hypothesis needs further experimental validation.

Introduction

B cell-derived autoimmune responses in systemic lupus erythematosus (SLE) tend to cluster around double-stranded DNA, and DNA- or RNA-associated nucleoproteins such as Ro and/or La antigens (Ro/La), Smith/ribonucleoprotein (Sm/RNP), nucleosomes or Ku-autoantigen [1,2]. Several nucleic acid-sensing cytosolic and endosomal receptors have been identified recently and their role in SLE pathogenesis is suspected [3]. Recognition of DNA (or RNA) by cytosolic receptors such as DNA-dependent activator of IRFs/Z-DNA binding protein 1 (DAI/ZBP-1), RNA-polymerase III (Pol III), haematopoietic interferon (IFN)-inducible nuclear proteins with a 200-amino-acid repeat (HIN-200), absent in melanoma 2 (AIM2), retinoid-inducible gene 1 (RIG-I) or melanoma differentiation associated gene-5 (MDA-5) triggers a relatively limited cellular response characterized by IFN regulatory factor (IRF)-dependent type I IFN production and nuclear factor-kappa B (NF-κB) activation [4–16]. These cytosolic receptors are relatively DNA/RNA-sequence independent, allowing them to respond to a variety of nucleic acids including forcibly expressed self-DNA (or RNA) [17]. In contrast to cytosolic receptors, endosomal Toll-like receptors (TLRs) are less promiscuous and are involved in recognition of either double-stranded RNA (TLR-3)[18], single-stranded RNA (TLR-7 and TLR-8) [19,20] or hypomethylated cytosine–guanosine dinucleotide (CpG)-DNA (TLR-9) [21] derived from extracellular bacteria or viruses. Rapid innate response via endosomal TLRs involves not only type I IFN and NF-κB pathways, but also triggers a stress kinase pathway generating a broader response [22]. This enables responder cells to produce multiple proinflammatory cytokines and chemokines, and to up-regulate major histocompatibility complex (MHC) class II and co-stimulatory molecules (e.g. CD40, CD80 and CD86). In mouse B cells, TLR ligands also induce T cell-independent polyclonal immunoglobulin (Ig)M and IgG3 secretion [23,24].

Interestingly, in humans, B cells and pDCs express exclusively TLR-7 and TLR-9 [25], two receptors heavily implicated in the pathogenesis of SLE [26]. Several animal models of lupus (e.g. pristane-induced lupus [27,28], Murphy Roths Large (MRL)-Fas-^lpr/lpr[29] and male BXSB mice [30–32]) favour the pathogenic role of TLR-7, while TLR-9 appears to have a regulatory role at least in some strains by suppressing TLR-7-induced autoantibodies and subsequent tissue damage [33–37]. For example, MRL-Fas ^lpr/lpr mice lacking TLR-7 show ameliorated disease [29]. Similarly, pristane-induced lupus requires TLR-7 for the production of anti-Sm/RNP, but not anti-DNA autoantibodies [27]. BXSB male mice possess a Y-accelerator which contains X-chromosome-derived TLR-7 and 16 additional genes resulting in TLR-7 duplication and autoimmunity [30,31,38]. However, in young 8-week-old MRL-Fas^lpr/lpr mice [39], in contrast to 16–18-week-old mice [40,41], only TLR-9 agonists, but not TLR-3 or TLR-7 agonists, could promote B cell proliferation and anti-DNA autoantibody production and trigger the onset of lupus nephritis, further fuelling the controversy about the roles of TLR-7 and -9 in SLE.

Co-engagement of the B cell receptor for antigen (BCR) and TLR-9 (or TLR-7) in both autoreactive and non-autoreactive B cells has been shown to decrease the threshold for B cell activation, allowing responsiveness to low-affinity TLR-7/-9 ligands [42–49]. For example, we and others have shown that mouse resting follicular B cells and human peripheral blood B cells are poorly responsive to bacterial DNA and type A(D) CpG-oligonucleotides (ODNs) unless the BCR is engaged simultaneously, or B cells primed with either B cell activating factor (BAFF) or with type I IFN [24,45]. Importantly, both BAFF and type I IFN are believed to play an important role in the pathogenesis of SLE [15,16,50,51]. Blocking BAFF activity, as shown in a recent clinical trial, may provide benefits to SLE patients [52]. Conversely, human peripheral blood mononuclear cells from SLE patients show evidence of an ‘IFN-α genetic signature’[50,53–56]. The interrelationship between BAFF, TLRs (and other nucleic acid sensing receptors) and the type I IFN system may explain the complex pathogenesis of human SLE and its variable clinical presentation.

Therefore, a therapeutic strategy aimed at targeting intracellular DNA/RNA sensors, along with neutralization of BAFF and/or type I IFN, may be a preferred way for preventing/treating human lupus at a very early stage of disease development, before T cell-mediated damage embarks. Indeed, an ODN-based therapeutic approach has already shown promise, as inhibitory (INH)-ODNs targeting TLR-7 and/or TLR-9 proved effective in various models of animal lupus [57–62]. However, the structural requirements for TLR-7 inhibition in B cells and the role of BCR in INH-ODN-mediated TLR-7 inhibition have not yet been clarified. Recent work from the Barrat–Coffman group suggested that adding a TGC triplet to the 5′ end of a TLR-9-specific INH-ODN can convert this ODN into a dual TLR-7/-9 inhibitor [63,64]. Such chimeric ODN was capable of preventing spontaneous lupus in the New Zealand black/white (NZB/W)-F₁ model of lupus [60]. Others have shown that similar ODNs containing multiple TGC repeats were effective in the MRL-Fas ^lpr/lpr strain [61].

We have addressed the above questions in B cells derived from BXSB male and female mice. Despite the fact that male B cells demonstrated a twofold higher TLR-7 responsiveness compared to their female counterparts (this paper and [30,32]), a number of 32-mer INH-ODNs made with the phosphorothioate (PS) backbone were equally effective inhibitors in both strains. This inhibition was irrelevant of the ODNs primary or secondary structure, or of the presence or absence of a TGC triplet at their 5′ end. However, INH-ODNs containing multiple TGC motifs were slightly more powerful inhibitors in B cells, particularly against higher-affinity TLR-7 ligands. The engagement of the BCR had a differential effect on the ability of INH-ODNs to block TLR-7 co-stimulation. For example, while these ODNs were still capable of blocking interleukin (IL)-6 secretion (although with a 10-fold lower potency), B cell proliferation and protection against spontaneous apoptosis completely escaped inhibition. Thus, BCR engagement may inadvertently affect the ability of TLR-7 antagonists to block BCR–TLR-7-mediated B cell activation, a finding that may have important therapeutic implications for the development of novel lupus-specific therapeutics.

Materials and methods

Oligonucleotides and polyclonal anti-IgM antibodies

Synthetic ODNs with the PS backbone were synthesized and purified by Integrated DNA Technologies (IDT, Coralville, IA, USA). The prototype type B(K) CpG-ODN used in our experiments was 1826 (5′ TCCATGACGTTCCTGACGTT′– all PS bonds), a strong specific stimulator of TLR-9 in all TLR-9-expressing mouse cells. It was used at a 33 nm concentration, which was shown previously to give a suboptimal stimulation [48]. Sequences of INH-ODN used in the study are given in Table 1. For TLR-9-inhibitory activity two base triplets (CCT and GGG) were considered ‘critical elements’ because base changes in these areas profoundly reduced INH-ODN activity. Titrations were performed with concentrations ranging from 1 to 1000 nm.

Table 1.

Oligonucleotides used in the study.

No.	Sequence
2114	TCCTGGAGGGGAAGT
4084F	CCTGGATGGGAA
INH-1	CCTGGATGGGAA-TTCCCATCCAGG
INH-18	CCTGGATGGGAA-CTTACCGCTGCA
INH-18b	CCTGGATGGGAA-GAGATCATACAC
Poly-T	TTTTTTTTTTTTTTTTTTTTTTTT
IRS-661	TGCT-TGCA-AGCT-TGCA-AGCA
TL7-24	TGCT-TGCT-TGCT-TGCT-TGCT
IRS-954	TGCT-CCTGGAGGGGTTGT
TL7-06	TGCT-CCTGGATGGGAATTCCCATCCAGG-AGCA (TGCT-INH-1-palindromic-AGCA)
TL7-08	TGCT-CCTGGATGGGAAGAGATCATACAC-TGCT (TGCT-INH-18b-linear-TGCT)
TL7-18	TGCT-TATGGATTTTAATTAAAATCCATA-AGCA (TGCT-Palindromic control-AGCA)
TL7-19	TGCT-TATGGATTTTAAGAGATCATACAC-TGCT (TGCT-Linear control-TGCT)
TL7-20	TAAT-CCTGGATGGGAATTCCCATCCAGG-ATTA (TAAT-INH-1-palindromic-ATTA)
TL7-21	TAAT-CCTGGATGGGAAGAGATCATACAC-TAAT (TAAT-INH-18b-linear-TAAT)
TL7-22	TAAT-TATGGATTTTAATTAAAATCCATA-ATTA (TAAT-Palindromic control-ATTA)
TL7-23	TAAT-TATGGATTTTAAGAGATCATACAC-TAAT (TAAT-Linear control-TAAT)

Polyclonal anti-IgM F(ab')₂ fragments (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) were tested over the 0·01–100 µg/ml concentration range. A10 µg/ml concentration of anti-IgM antibody consistently promoted a suboptimal B cell response and was used subsequently in all BCR–TLR-7 cross-talk studies.

Flow cytometric analysis of the cell cycle entry and apoptosis

Stimulation with TLR-7, TLR-9 or CD40 ligands can rescue primary B cells from spontaneous cell death and induce cell cycle entry. Cell cycle entry and apoptosis protection were measured using acridine orange staining as described previously [65] The term ‘cell cycle entry’ applied to cells in G₁, G₂, S and M phases of cell cycle, with the majority of cells in G₁. Fluorescence activated cell sorter (FACS) analysis was performed on a Becton Dickinson FACScan at the University of Iowa Core Flow Cytometry Facility.

Native polyacrylamide gel electrophoresis (PAGE)

ODNs were analysed by native PAGE. Lyophilized oligonucleotides were dissolved in phosphate-buffered saline (PBS) at concentration of 1 µg/µl. Samples (2 µl of each) dispensed in 1× Tris-HCL pH 6·8, 10% (v/v) glycerol were run on a native gel [20% polyacrylamide, in Tris–borate–ethylenediamine tetraacetic acid (TBE) buffer] and electrophoresed at 150 V 80 mA for 120 min. The gel was stained overnight using Stains-All (Sigma-Aldrich, St Louis, MO, USA).

INH-ODN activity in mouse B cells

B cells were isolated from spleens of 5–10-week-old male and female BXSB mice. In some experiments, B cells obtained from TLR-7^−/− mice (kindly provided by Dr S. Perlman, University of Iowa), TLR-9^−/− (kindly provided by Dr J. Kline, University of Iowa) and control C57BL6 mice were used to study requirements for intracellular TLRs in the activity of INH-ODNs. Following red blood cell lysis with ammonium chloride, total splenic B cells were negatively selected using anti-CD43-coated magnetic beads and passing them over the LD column on a Midi-Macs from Miltenyi Biotec (Auburn, CA, USA). Purified B cells were cultured at 1 × 10⁶ ml in RPMI-1640 (Gibco-BRL, Life Technologies, Gaithersburg, MD, USA) and 10% fetal calf serum (FCS). Cells were stimulated with suboptimal concentrations of indicated TLR-7/-8 ligands (Loxoribine, R-837, R-848, CL-075, CL-097), as determined in preliminary experiments (data not shown). Concentrations giving ∼60–75% stimulation were used throughout.

IL-6 enzyme-linked immunosorbent assay (ELISA)

B cell cultures were harvested after 42 h of stimulation and their supernatants tested for IL-6 secretion. MP5-20F3 and biotin-labelled MP5-32C11 antibodies were used for detection (eBioscience, San Diego, CA, USA). Assay sensitivity was 16 pg/ml. High-binding Greiner Microlon plates were coated overnight at 4°C with 2 µg/ml of MP5-20F3 antibody in a carbonate buffer (pH 9·5). After blocking with 10% FCS–PBS for 1 h, and subsequent washes with PBS–0·05% Tween 20, plates were incubated with culture supernatants diluted with 10% FCS–PBS for 2 h. Following additional washes, plates were incubated with 1 µg/ml of biotin-labelled MP5-32C11 antibody plus extravidin-peroxidase for an additional 1 h. After further washes, the TMB substrate (KPL Laboratories, Gaithersburg, MD, USA) was added to detect peroxidase activity. Absorbance was measured at 450 nm in a Molecular Devices ELISA reader.

Statistics

Non-parametric Wilcoxon's signed-rank test and Student's t-test were used to calculate differences between groups. P < 0·05 was considered significant.

Results

BCR and TLR-7 cross-talk in primary B cells

TLR-7 translocates from the endoplasmic reticulum to endosomes with the help of UNC93b1 shuttle protein [66,67]. The lack of UNC93b1 ameliorates animal lupus [68]. In this study we show that BCR engagement resulted in TLR-7-dependent enhancement of IL-6 production in primary B cells by as much as 10-fold. This effect was dependent on both BCR ligand [polyclonal anti-IgM F(ab')₂ fragments] and TLR-7 concentrations. Conversely, BCR ligands, by themselves, were very weak IL-6 inducers in B cells even when used at concentrations as high as 100 µg/ml (Fig. 1).

Fig. 1.

Toll-like receptor (TLR)-7 and B cell receptor (BCR) synergize for interleukin (IL)-6 production in B cells. Purified CD43^– splenic B cells from either TLR-7^+/+ or TLR-7^−/− mice were stimulated for 42 h with a TLR-7 ligand CL-075 alone and/or with anti-immunoglobulin (Ig)M F(ab')₂ fragments added over the concentration range shown. Culture supernatants were tested for IL-6 production by enzyme-linked immunosorbent assay; n = 3–5. *P < 0·05.

We next studied the BCR–TLR-7 cross-talk in prediseased B cells from lupus prone BXSB-male and control BXSB-female B cells (Fig. 2). As expected, TLR-7 duplication enabled BXSB male B cells to respond more efficiently to lower concentrations of TLR-7 ligands. This enhanced responsiveness was seen particularly with the IL-6 (Fig. 2) and polyclonal IgM (data not shown) secretion. This difference in IL-6 between male and female B cells remained even after engaging the BCR (Fig. 2). BXSB male B cells also showed decreased spontaneous cell death, which was further reduced by engaging the TLR-7 receptor. However, neither TLR-7- nor TLR-7 + anti-IgM-induced cell cycling in BXSB-male B cells was not different from controls, even though BCR–TLR-7 co-engagement appeared to have a mild additive effect on G1-M entry in both sexes (Fig. 2).

Fig. 2.

Cross-talk between the Toll-like receptor (TLR)-7 and B cell receptor (BCR) in prediseased BXSB male and female B cells. Purified CD43^– splenic B cells from BXSB mice were stimulated for 42 h with a TLR-7 ligand CL-075 alone (1 µg/ml), anti-immunoglobulin (Ig)M F(ab')₂ fragments alone (10 µg/ml) or with their combination. Apo-protection and G1-M entry were determined using acridine orange flow cytometry, while interleukin (IL)-6 was measured by enzyme-linked immunosorbent assay; n = 3–5. *P < 0·05.

Figure 3 shows a difference in TLR-7-induced IL-6 secretion in male compared to female B cells, which was induced by a variety of TLR-7 ligands whose potency ranged from low nanomolar to high micromolar concentration (e.g. Loxoribine, CL-075, R-837, R-848) (Fig. 3a). This heightened reactivity occurred in a dose-dependent manner (Fig. 3b) but was, interestingly, not seen when a potent TLR-9 ligand (ODN-1826) was used for stimulation (Fig. 3a).

Fig. 3.

Differences in interleukin (IL)-6 secretion between BXSB male and female B cells are observed with a variety of Toll-like receptor (TLR)-7 ligands, but not with a linear TLR-9 ligand. Splenic B cells from male or female BXSB mice were stimulated for 42 h with a TLR-9 ligand CpG-1826 (33 nm), with optimal concentrations of various TLR-7 ligands as determined in pilot experiments (a), or with a TLR-7-ligand R-848 used over the concentration range shown (b). Culture supernatants were tested for IL-6; n = 4. *P < 0·05.

Therefore, prediseased BXSB-male B cells show an intrinsic hyperreactivity to TLR-7 ligands, which may be relevant to the pathogenesis of lupus in the BXSB strain.

Differential effect of palindromic (class R) and linear (class B) INH-ODNs on TLR-7 and TLR-9 stimulation in primary B cells

During a course of experiments aimed at characterizing the optimal sequence requirements for TLR-9 inhibition in primary mouse B cells, we observed a 10–100-fold potency difference in favour of linear sequences over palindromic INH-ODNs [59]. This was observed only in B cells, while ODN secondary structure did not play a major role in the ability of INH-ODNs to block stimulation in other TLR-9-expressing cells, e.g. macrophages and dendritic cells (DCs) [59]. Both classes of INH-ODNs contained the optimal inhibitory motif characterized by a 12-mer sequence: CCTxxxxGGGxx (x = random nucleotide), which was followed by either a random or complementary 12-mer nucleotide stretch to create a linear ODN or a full palindrome (Table 1). In contrast to TLR-9 inhibition (Fig. 4a), palindromic TLR-9-antagonist INH-1, linear antagonist INH-18 and the control Poly-T ODN all had sequence-independent inhibitory effects on TLR-7 stimulation (Fig. 4b). Interestingly, TLR-7 inhibition did not require TLR-9 expression (Fig. 4d), while TLR-9 inhibition did not require TLR-7 expression (Fig. 4c).

Fig. 4.

Primary sequence- and secondary structure-specific effects of inhibitory oligonucleotides (INH-ODNs) on Toll-like receptor (TLR)-9 stimulation and their effects on TLR-7 stimulation. Purified splenic B cells from wild-type mice, TLR-7^−/− or TLR-9^−/− knock-outs were stimulated for 42 h with a TLR-7 ligand R-848 (0·1 µg/ml) or with a linear TLR-9 ligand cytosine–guanosine dinucleotide (CpG)-1826 (33 nm). INH-ODNs were used over the concentration range shown and were added to the cultures at the time of stimulation. Supernatants were tested for IL-6; n = 3–4.

Contribution of 5′ TGCT to the TLR-7 inhibition in primary B cells

Recent work from the Barrat–Coffman group suggested that simple addition of a TGCT motif to the 5′ end of an otherwise canonical TLR-9 inhibitor generates a powerful TLR-7/-9 dual inhibitor [63]. Their prototypic ODN (IRS 954) was even capable of preventing the spontaneous lupus in the MRL-Fas ^lpr/lpr and NZB/W-F₁ strains of lupus mice [60,61]. To verify this hypothesis we synthesized a series of 32-mer INH-ODNs (Table 1, from TL7-06 to TL7-23). We created INH-ODNs in which the TGCT quartet preceded the canonical TLR-9 inhibitory motif wrapped in either a linear or a palindromic core. Alternatively, a random control sequence lacking the TLR-9 motif was chosen. In INH-ODNs TL7-20, 21, 22 and 23, the 5′ TGCT motif was replaced with the TAAT motif to create INH-ODNs of equal length.

Herein, we first show that none of these 32-mer ODNs had any stimulatory activity on spontaneous B cell proliferation, protection against apoptosis or IL-6 secretion (Fig. 5, upper panels). Interestingly, when B cells were co-stimulated through their BCR receptors with anti-IgM F(ab)'₂ fragments, only palindromic, but not linear INH-ODNs showed an ability to co-stimulate B cell proliferation and protection against apoptosis significantly (Fig. 5, lower panels, and Fig. 6). However, none of the INH-ODNs tested had any effect on IL-6 secretion. Importantly, this phenomenon was observed in both male and female BXSB B cells, suggesting that this effect may be independent of the TLR-7 gene dosing.

Fig. 5.

Effect of inhibitory oligonucleotides (INH-ODNs) on medium- or anti-immunoglobulin (Ig)M-induced B cell stimulation. INH-ODNs were used over the concentration range shown and added to B cell cultures simultaneously with anti-IgM F(ab')₂ fragments (used at 10 µg/ml). Apo-protection and G1-M entry were determined using acridine orange flow cytometry, while interleukin (IL)-6 was measured by enzyme-linked immunosorbent assay; n = 3.

Fig. 6.

Palindromic, but not linear inhibitory oligonucleotides (INH-ODNs) enhance B cell receptor (BCR)-induced cell cycle entry. The results shown are differences between palindromic INH-ODNs (TL7-06; 18, 20 and 22) and linear INH-ODNs (TL7-08, 19, 21, and 23) used at 1000 nm concentration when added to anti-immunoglobulin (Ig)M F(ab')₂ (10 µg/ml)-stimulated splenic B cell cultures. G1-M entry was determined by acridine orange flow cytometry; n = 12, *P < 0·05.

We next studied the ability of these INH-ODNs to block stimulation of primary mouse B cells via their TLR-7 receptors. We used intermediate-affinity TLR-7 ligand CL-075 initially. Surprisingly, addition of the TGCT motif to the 5′ end of an INH-ODN did not increase its inhibitory potency for TLR-7-induced stimulation in BXSB male (Fig. 7, lower panels) and female B cells (Fig. 7, upper panels). All eight ODN variants tested showed similar inhibitory potency, suggesting clearly that neither primary or secondary ODN structure, nor a mere presence of the TGCT motif at the 5′ end of an ODN was required for the inhibitory potential of INH-ODNs made with the nuclease-resistant PS backbone. The average inhibitory concentration (IC)₅₀ for IL-6 secretion was found to be approximately in the 100 nm range.

Fig. 7.

Addition of a TGC motif to the 5′ end of an inhibitory oligonucleotide (INH-ODN) does not increase its inhibitory potency for Toll-like receptor (TLR)-7 stimulation in primary B cells. Purified splenic B cells from male or female BXSB mice were stimulated for 42 h with a TLR-7 ligand CL-075 alone (1 µg/ml) or combined with INH-ODNs used over the concentration range shown. Apo-protection and G1-M entry were determined using acridine orange flow cytometry, while interleukin (IL)-6 was measured by enzyme-linked immunosorbent assay; n = 3–4. Differences between groups were non-significant.

Interestingly, the inhibitory potency of INH-ODNs for IL-6 secretion decreased by at least 10-fold when a strong TLR-7/-8 agonist R-848 was used for stimulation (Fig. 8, upper panels). This result is consistent with the data in the literature showing that ODN backbone-dependent inhibition of TLR-7-induced activation depends heavily on a nature (potency) of TLR-7 ligand used for stimulation [43,63]. However, INH-ODNs containing multiple TGC repeats such as IRS-661 [63] or TL7-24 were significantly more potent TLR-7 inhibitors when compared to controls (Fig. 8, lower panels).

Fig. 8.

Inhibitory oligonucleotides (INH-ODNs)-mediated Toll-like receptor (TLR)-7 inhibition depends on a type of TLR-7 ligand used for stimulation and is enhanced by a presence of multiple TGC motifs in an INH-ODN structure. Upper panels: purified splenic B cells from either male or female BXSB mice were stimulated for 42 h with optimal concentrations of TLR-7 ligands CL-075 or R-848 either alone or combined with INH-ODNs TL7-06 or TL7-8 used over the concentration range shown. Data for TL7-06 and TL7-08 were pulled together, as there were no significant differences between them; n = 8, *P < 0·05. Lower panels: ODNs: INH-1, INH-18, TL7-24 and IRS-661 were used at 10 nm or 100 nm concentrations and added to wild-type B cell cultures stimulated with a potent TLR-7 ligand R-848 (0·1 µg/ml) for 42 h. IL-6 was measured by enzyme-linked immunosorbent assay; n = 3, *P < 0·05.

BCR signals differentially affect the ability of INH-ODNs to block TLR-7- and BCR-induced B cell activation

Our recent study on TLR-9 and BCR cross-talk suggested that BCR engagement may increase the potency of palindromic (class R) INH-ODNs for TLR-9-co-stimulated primary B cells [48]. However, it is not known whether the same conclusion can be extended to TLR-7-stimulated B cells.

To address this question we stimulated primary B cells from both male and female BXSB mice with the TLR-7 ligand CL-075 and anti-IgM F(ab')₂ fragments (Fig. 9). INH-ODNs were added to cell cultures simultaneously with the TLR-7–BCR ligands. Surprisingly, INH-ODNs completely lost the ability to block TLR-7 × BCR-induced B cell cycling and protection against spontaneous apoptosis, while they still retained the ability to inhibit TLR-7-dependent IL-6 secretion, although with a ∼10-fold lower potency. There were no differences between male and female BXSB B cells, suggesting that this effect was independent of the TLR-7 gene dosing.

Fig. 9.

Outcome-dependent effects of inhibitory oligonucleotides (INH-ODNs) on B cell receptor (BCR) plus Toll-like receptor (TLR)-7 cross-talk. Purified splenic B cells from either male or female BXSB mice were stimulated for 42 h with CL-075 alone or combined with anti-immunoglobulin (Ig)M F(ab')₂ fragments (10 µg/ml). INH-ODNs were added over the concentration range shown (1–1000 nm). Apo-protection and G1-M entry were determined by acridine orange flow cytometry, while interleukin (IL)-6 was measured in enzyme-linked immunosorbent assay; n = 3. Differences between groups were non-significant.

Therefore, we concluded that BCR engagement has opposite effects on TLR-7 and TLR-9 inhibition by INH-ODNs, suggesting a different mechanism of inhibition. These results may have important implications for designing ODN-based TLR inhibitors for future human clinical trials in SLE, as co-engagement of the BCR and TLR-7 may blunt the inhibitory potential of these small synthetic compounds and at least theoretically favour autoreactive B cell activation and survival. Further studies are needed to clarify this controversy and to determine the exact mechanism responsible for the differential effect of INH-ODNs in B cells.

Discussion

The primary objective of this study was to investigate the cross-talk between the BCR and TLR-7 in primary mouse splenic B cells and to determine whether synthetic oligodeoxyribonucleotides (INH-ODN) can interfere with this interaction. We additionally investigated the primary and secondary sequence requirements for TLR-7 inhibition in B cells, including the contribution from the TGC triplets and canonical TLR-9 inhibitory motifs.

The BCR and TLR-7 cross-talk was studied in prediseased splenic B cells from BXSB male and female mice. BXSB male mice develop a lupus-like disease characterized by shorter life-span, splenomegaly, production of multiple autoantibodies and kidney disease [69]. The YAA accelerator comprising TLR-7 and 16 additional genes [30–32] is responsible for this accelerated disease in males. It is due to TLR-7 duplication, resulting in higher sensitivity to low-affinity TLR-7 (but not TLR-9) ligands (Figs 2 and 3). This hypersensitivity appears to be intrinsic to B cells and probably not a result from priming with either type I IFN or BAFF, as other B cell ligands fail to induce such a hypersensitive response. Interestingly, in other lupus strains (e.g. Palmerston North, MRL-Fas^lpr/lpr, NZB/W-F₁) B cell hypersensitivity is much more promiscuous and is mediated by an expanded population of ‘innate-like’ marginal zone B cells [23,24]. The cross-talk between the BCR and TLR-7 in non-transgenic B cells is synergistic for only some outcomes (e.g. for IL-6 and IgM secretion), but not for others (Figs 1 and 2). For example, when these two signals are combined there is only a minor additive effect on B cell cycling or apoptosis protection. The synergy for IL-6 secretion requires a signalling downstream of TLR-7 (but not TLR-9), as mice lacking TLR-7 fail to respond. Others have shown that TLR-7, in addition to BCR, can also co-operate with CD40 for enhanced IL-6 secretion through a pathway dependent on c-Jun N-terminal kinase (JNK) activation and subsequent nuclear translocation of active c-Jun and s-Fos [46,70].

IL-6 production in response to low/intermediate-affinity TLR-7 ligands and TLR-7–BCR co-signals is, as expected, at least twofold higher in BXSB male versus female B cells. Interestingly, BXSB male B cells also show relative resistance to spontaneous apoptosis and slightly better response to suboptimal TLR-7 signals but, surprisingly, not to BCR–TLR-7 co-signals. We hypothesize that this may reflect relative independence of these later outcomes on the JNK/activator protein-1 (AP-1) pathway and reliance on the NF-κB activation.

All biological outcomes induced by TLR-7 activation (but not BCR activation) with low/intermediate-activity TLR-7 ligands (e.g. Apo-protection, G1-M entry, IL-6 and polyclonal IgM secretion) were sensitive to inhibition with either canonical TLR-9 INH-ODNs [3,71–73] or control ODNs made with the nuclease-resistant PS backbone suggesting a sequence-independent mechanism. In contrast, TLR-7 stimulation was relatively resistant to inhibition with ODNs made with the natural phosphodiester backbone (data not shown).

To address the possible contribution from the TGC triplets, as suggested by the Barrat–Coffman group [63], we created INH-ODNs where either TGCT/AGCA or TGCT/TGCT motifs were added to the 5′ and 3′ ends of a TLR-9-specific INH-ODN or a control ODN, respectively. We have also varied the primary ODN sequence in order to create either full palindromes or alternatively linear sequences [48]. In some ODNs, the TGCT/AGCA (palindromic ODNs) or TGCT/TGCT (linear) ends were replaced with either TAAT/ATTA (palindromic) or by TAAT/TAAT (linear) ends. This choice of ODNs has enabled us to study the contribution from linear/palindromic sequences, canonical TLR-9 inhibitory motifs and TGC triplets to TLR-7 inhibition in primary non-transgenic B cells.

Much to our surprise, the TLR-7 inhibition in B cells derived from either control or autoimmune male BXSB mice was equally sensitive to all INH-ODNs tested, suggesting a primary/secondary sequence-independent mechanism of inhibition. This clearly contrasts with previous studies, suggesting that a simple addition of the TGC motif to the 5′ end of an ODN can convert a TLR-9 inhibitor into a powerful dual pathway (TLR-7/-9) inhibitor [63]. Moreover, a recent study from the same group suggested that such a dual inhibitor (but surprisingly, not a control ODN) can prevent spontaneous lupus in the NZB/W-F₁ strain of lupus mice [60].

While our data suggest that a 5′ TGC may not provide additional benefits to an 32-mer ODN in B cells, repetitive TGC motifs such as in TL7-24 and in IRS-661 resulted in more potent inhibition of the TLR-7 pathway, particularly when used at lower (suboptimal) concentrations and against the higher-affinity TLR-7 ligands (e.g. R-848), clarifying this controversy (Fig. 8).

Therefore, our data strongly support a conclusion that a PS backbone in synthetic ODNs by itself possesses potent TLR-7 inhibitory activity in B cells. Notably, PS modification was developed primarily to protect synthetic ODNs from degradation by nucleases, thus allowing longer half-lives of ODNs in vivo. Such PS-modified ODNs, compared to ODNs with the phosphodiester backbone, also bind with a higher avidity to TLR-9 and possibly to TLR-7 [74,75]. These backbone-dependent effects may contribute to ODNs agonistic or antagonistic effects, depending on a particular experimental model studied [75]. Interestingly, in human TLR-7/-8 expressing cells poly T sequences made with the PS backbone were capable of redirecting stimulation from the TLR-7 to TLR-8 by blocking TLR-7 and synergizing with the TLR-8 activation [76]. However, in mice, in contrast to humans, TLR-8 appears to be inactive, although there is still some controversy about this issue in the literature [77].

INH-ODNs have differential effects on BCR–TLR-7 cross-talk compared to the BCR–TLR-9 cross-talk [48]. While engagement of BCR allows primary follicular B cells to respond to a variety of TLR-9 ligands, including bacterial DNA and class A(D) CpG-ODNs [24], it also results in a 10-fold higher sensitivity to palindromic TLR-9 INH-ODNs, but has a minimal effect on linear TLR-9 inhibitors [48,59]. This was first observed in autoreactive rheumatoid factor-specific AM14 B cells stimulated with either linear CpG-ODNs or with PL2-3 immune complexes [59]. When stimulated with linear TLR-9 ligands, linear INH-ODNs were 10-fold more powerful inhibitors; however, this difference was lost when AM14 B cells were stimulated via their BCRs with PL2-3 immune complexes in a manner dependent on TLR-9. This observation was confirmed recently in non-autoreactive B cells [48], ruling out BCR-mediated delivery of INH-ODNs as an explanation for this enhanced inhibition [48]. Contrasting these TLR-9 studies, the BCR engagement clearly has a negative effect on the ability of INH-ODNs (including those with multiple TGC motifs) to block the TLR-7-dependent stimulation. G1-M entry and apoptosis protection completely escaped inhibition, while the potency for IL-6 secretion decreased at least 10-fold (Fig. 9). Differential effects on cell cycle entry versus IL-6 suggest that a simple competition for B cell uptake is an unlikely mechanism, as it should result in a proportional inhibition, independent of the BCR engagement. Furthermore, TLR-7 binding by ODNs is also an unlikely explanation, as INH-ODNs have similar potency for TLR-7 inhibition in both BXSB male and female B cells despite a twofold difference in TLR-7 expression. However, the possibility that BCR engagement diverts INH-ODNs and TLR-7 ligands into different subcellular compartments cannot be excluded completely at this time.

Our results have important implications for a development of novel lupus therapeutics based on TLR-7 and/or -9 inhibitions. The ability of INH-ODNs to non-specifically block the TLR-7 pathway was also observed by others [43,62,76,77]. Moreover, INH-ODNs may have non-specific effects on various cellular functions independent of TLR-9 and dependent on the ODNs ability to undergo G4 stacking resulting in larger aggregates [73]. INH-ODNs may even act as mild co-agonists in cells engaged only through their BCRs, an effect which may, theoretically, lead to expansion of autoreactive B cells, thus worsening lupus. However, it remains to be elucidated whether targeted B cell receptor-mediated delivery of INH-ODNs into autoreactive B cells may affect the BCR–TLR-7/-9 cross-talk in a more predictive manner.

Disclosure

None.