Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Mar 7.
Published in final edited form as: Insect Biochem Mol Biol. 2000 Oct;30(10):991–997. doi: 10.1016/s0965-1748(00)00074-6

Novel point mutations in the German cockroach para sodium channel gene are associated with knockdown resistance (kdr) to pyrethroid insecticides

Zhiqi Liu a, Steven M Valles b, Ke Dong a,*
PMCID: PMC3049294  NIHMSID: NIHMS276021  PMID: 10899465

Abstract

Knockdown resistance (kdr) to pyrethroid insecticides has been attributed to point mutations in the para sodium channel gene in more than a half dozen insect pest species. In this study, we identified two novel para mutations in five highly resistant kdr-type German cockroach strains. The two mutations, from glutamic acid (E434) to lysine (K434) and from cysteine (C764) to arginine (R764), respectively, are located in the first intracellular linker connecting domains I and II. E434K is located near the beginning of the linker (closest to domain I), whereas C764R is found toward the end of the linker (closest to domain II). Two additional mutations from aspartic acid (D58) to glycine (G58), and from proline (P1880) to leucine (L1888), respectively, were found in one of the resistant strains. The four mutations coexist with the previously identified leucine to phenylalanine (L993F) kdr mutation in IIS6, and are present only in the highly resistant individuals of a given strain. These findings suggest that these mutations might be responsible for high levels of knockdown resistance toward pyrethroid insecticides in the German cockroach.

Keywords: Ion channel, Insecticide resistance

1. Introduction

For several decades, pyrethroid insecticides have been used widely to control many insect pests. Because of the intensive use of pyrethroids, however, many pest populations have developed resistance to these compounds. One class of the most important resistance mechanisms recognized is knockdown resistance (kdr). It confers resistance to both knockdown (rapid paralysis) and killing by pyrethroids and dichloro diphenyl trichloroethane (DDT) through reduced neuronal sensitivity to these compounds (see Soderlund and Bloomquist, 1990 and references therein).

The primary target site for pyrethroids is voltage-dependent sodium channels in the nervous system (Narahashi, 1988). An insect sodium channel gene, para, was first identified in Drosophila (Loughney et al., 1989). Orthologs for para have been isolated from several other insect species, including the German cockroach. The deduced amino acid sequence of Para shares striking homology with all known sodium channel α-subunits in overall organization. Each consists of four repeated homologous domains (I–IV), having six membrane-spanning segments (S1–6) in each domain. Expression of Para in Xenopus oocytes confirmed that para encodes a functional voltage-gated sodium channel (Feng et al., 1995; Warmke et al., 1997).

Recent studies show that point mutations in the Para sodium channel protein are responsible for kdr and super-kdr (which confers much higher levels of resistance than kdr) resistance in insects. The kdr resistance in the house fly and German cockroach is associated with a leucine (L) to phenylalanine (F) mutation in segment 6 of domain II (IIS6) (Williamson et al., 1996; Miyazaki et al., 1996; Dong, 1997). The super-kdr resistance in house fly is associated with an additional methionine (M) to threonine (T) mutation in the linker region between S4 and S5 of domain II (Williamson et al., 1996). The house fly sodium channel carrying these two mutations is much less sensitive to the pyrethroid cismethrin than the wild-type when expressed in Xenopus oocytes (Smith et al., 1997; Lee et al., 1999). The L to F kdr mutation also has been detected in other pyrethroid resistant insects, including horn flies (Haematobia irritans) (Jamroz et al., 1998), mosquitoes (Anopheles gambiae) (Martinez-Torres et al., 1998) and aphids (Myzus persicae) (Martinez-Torres et al., 1999). The L to H (histidine) mutation at the same position is found in pyrethroid-resistant Heliothis virescens (Park and Taylor, 1997). One additional mutation (from valine to methionine in IS6) is associated with pyrethroid resistance in several Heliothis virescens strains (Park et al., 1997; Lee et al., 1999). The second mutation (M to T) in super-kdr house flies also was detected the in horn fly (Jamroz et al., 1998).

In a recent survey, we found the L to F kdr mutation (IIS6) in 20 of 24 field-collected pyrethroid-resistant German cockroach strains (Dong et al., 1998). However, the M to T mutation detected in super-kdr house flies was absent in all five of the highly resistant cockroach strains (Dong et al., 1998). In the present study, we conducted further sequence analysis of cockroach para from five highly resistant German cockroach strains that possess the L to F mutation in IIS6. We have identified four additional mutations associated with the high level of kdr in the German cockroach.

2. Materials and methods

2.1. Strains

Two susceptible strains, CSMA and Orlando (Koehler and Patterson, 1986), Ectiban-R, a kdr strain (Scott et al., 1990), and eight recently field-collected pyrethroid-resistant German cockroach strains were used in this study. Of the eight recently field-collected pyrethroid-resistant German cockroach strains, five (Malo, Pinellis 214, Marietta, Swine and Fuerte) had been used in previous studies and were known to possess the L993F mutation (Dong et al., 1998), and three (Aves, Pinellis 417 and NASJAX) were collected from the field and characterized more recently (Valles, 1998; Valles et al., 2000).

2.2. Bioassays

The field-collected pyrethroid-resistant German cockroach strains were heterogeneous for kdr, so bioassays using a pyrethroid, cypermethrin, were conducted to separate knockdown susceptible from resistant individuals (Dong et al., 1998). Separation was achieved by topically treating 50 adult male cockroaches with piperonyl butoxide (PBO) and S,S,S-tributyl phosphorotrithioate (DEF) (100 and 30 µg/cockroach, respectively) to minimize the contribution of detoxification. One hour later, two groups of 25 treated cockroaches were each placed into a glass Mason jar (1 pint) coated with cypermethrin at a concentration of 300 µg/jar. With this dose, individuals were all knocked down during a 4 h bioassay. The first five and last five knocked-down individuals were collected for isolating total RNA for subsequent polymerase chain reactions (PCR)/sequencing analyses.

2.3. RNA isolation and cDNA synthesis

Total RNA and poly(A+) RNA were isolated from cockroach heads and thoraces, using RNA isolation kits (Promega) according to the manufacturer’s instructions. First strand cDNA was synthesized from 5 µg of total RNA using SuperScript II RNase H− reverse transcriptase (GIBO/BRL). A para-specific antisense primer (no. 18 in Table 1), complementary to the sequence at the 3′ end of the para coding sequence, was used in cDNA synthesis. To increase the specificity of cDNA, the temperature for reverse transcription reaction was raised to 50°C instead of 42°C as recommended in the product manual.

Table 1.

Oligodeoxynucleotide primers used in PCR

Primer no.a Nucleotide sequence (5′ to 3′) Amino acid
position
Region in Para
Primers used to amplify cDNAs encoding mainly transmembrane regions
1 gcgaaccacagcagcaatg 5′-UTR N-terminus–IS5
2 gcatgccagttctcatcattca 303–309
3 gctccgagctttgaagactgtc 232–238 IS5–IS6
4 gctagttctgctgctgctaat 464–470
5 gatgacgagggtccaacagtta 739–745 IIS1–IIS6
6 cttgttggtttcattgtc 1025–1030
7 tgaggacgtcatgatgtcagaatatcc 1228–1235 IIIS1–IIIS6
8 tctagcgaccctcctgcc 1546–1552
9 gcagccaatcagggaaacgaacatc 1504–1511 IIIS6–IVS6
10 caaagcatccaaaatgtccacac 1915–1922
Primers used to amplify cDNAs covering the entire coding region
11 gcgaaccacagcagcaatg 5′-UTR
12 gctccatcatcactgtctgctgac 686–694
13 gctccatcatcactgtctgctgac 623–629
14 gctcctttggactcttcttgtctc 1094–1101
15 gctgacaatgaaaccaacaagatt 1025–1032
16 tctagcgaccctcctgcc 1546–1552
17 gcagccaatcagggaaacgaacatc 1504–1511
18 aatcaagcgaagatgtgag 3′-UTR
a

The odd number primers are sense primers, whereas the even number primers are antisense primers.

2.4. PCR, cloning and sequencing

The first strand cDNA was used as template to amplify para cDNA. PCRs were performed in a Perkin–Elmer 480 thermal cycler using Taq polymerase (Gibco/BRL). PCR mix (50 µl) contained: 1 µl cDNA, 5 µl 10x PCR buffer, 0.5 µM of each primer, 200 µM of each dNTP, 1.5 mM MgCl2 and 2.5 U Taq polymerase. PCR was started by addition of polymerase at high temperature (94°C) prior to cycling. The PCR conditions were: 30 cycles of 30 s at 94°C, 30 s at 58°C, and 1 min at 72°C. The PCR products were extracted with an equal volume of phenol:chloroform:isoamylalcohol (25:24:1) followed by agarose gel electrophoresis. The Prep-A-Gene kit (Bio-Rad) was used to isolate the PCR products from agarose gel for cloning or direct sequencing. Sequence was determined in the W.M. Keck Laboratory at Yale University.

Direct sequencing of the PCR products generated decent sequence results, except for certain regions where alternative splice sites reside. For sequence analysis of these regions, we cloned the PCR products and sequencing inserts from multiple clones.

3. Results and discussion

Compared with the strain Ectiban-R, which contains only the L to F kdr mutation, the five strains (Malo, Pinellis 214, Fuerte, Pinellis 417 and NASJAX) were significantly more resistant to knockdown by cypermethrin (Table 2). Our previous study (Dong et al., 1998) showed that the kdr individuals in all of these strains possessed the L993F mutation. However, they all lack the second M to T mutation, which is associated with super-kdr in the house fly. We hypothesized that additional mutations in the para gene may be responsible for the higher level of kdr resistance in these cockroach strains. Our hypothesis was not without precedent. Mutero et al. (1994) reported that five point mutations in the acetylcholinesterase gene (Ace) of Drosophila were responsible for resistance to various organophosphorus and carbamate insecticides. They showed that a combination of several point mutations within the Ace gene conferred greater levels of resistance than any single point mutation.

Table 2.

Knockdown times and para mutations among different German cockroach strains

Strain para mutation Time to knockdown (min)

L993Fa D58G G330A E434K C764R P1880L First fiveb Last fiveb
CSMA L D G E C P <20c
Orlando L D G E C P <18c
Ectiban-R F D G E C P 45–70c
S/Rd S/R S/R S/R S/R S/R
Swine L/Le –f – –/E –/C – 15–20 >60
Aves –/F D/D – –/E –/C P/P 17–23 >80
Malo L/F D/G A/A E/K C/R P/L 50–81 >275
Pinellis 214 L/F – – E/K C/R – 8–37 >120
Pinellis 417 L/F D/D – E/K C/R P/P 11–29 >140
Fuerte L/F – A/A E/K C/R – 14–48 >280
NASJAX –/F – – E/K C/R – 15–30 >100
b

Time at which the first five or the 45th individual of 50 cockroaches was knocked down in the cypermethrin residue bioassay.

c

Time at which all 50 individuals were knocked down.

d

Phenotype: susceptible (S; the first five knocked-down individuals)/resistant (R; the last five knocked-down individuals).

e

Genotype: the amino acid residue in the first five knocked down individuals/the amino acid in the last five knocked down individuals.

f

Not examined.

To identify possible additional mutations, we amplified para cDNA fragments encoding the four transmembrane domains using RNA isolated from the last five knocked-down individuals of Malo, Pinellis 214, Fuerte, Pinellis 417 and NASJAX strains. Equals amount of PCR products from five individual cockroaches were pooled before sequencing. The primers used in PCR and sequencing are listed in Table 1. As reported previously, our method was capable of detecting the L993F mutation if it was present in at least one of five pooled PCR reactions from five individuals (Dong et al., 1998). In this study, we employed the same detection method to determine whether additional para mutations were present in these strains. We first confirmed the previous finding that the last five individuals of all five strains, Malo, Pinellis 214, Pinellis 417, Fuerte and NASJAX, had the L993F mutation. Two additional amino acid changes, E434K and C764R, were found in all five of these strains. Further, each of five resistant individuals possessed only K434 and R764. An additional amino acid change, G330A, was detected in strains Malo and Fuerte, but not in Pinellis 214, Pinellis 417 or NASJAX. To determine if these amino acid changes were associated with knockdown resistance to pyrethroids, we determined sequences in the corresponding regions of the first five knocked-down individuals of all five strains and a susceptible strain, Orlando. The sequences from all susceptible individuals contained E434, C764 and G330, identical to those in the para sequence of the susceptible CSMA strain. The fact that the two amino acid changes (E434K and C764R) were detected only in the resistant individuals, but not in any susceptible individuals of any tested strain, strongly implicates 100% linkage of the two new mutations with the L993F mutation and their involvement in the knockdown resistance. However, susceptible individuals (the first five knocked-down) of the Malo and Fuerte strains also contained the G330 to A330 change, indicating that this change is not associated with kdr and more likely reflects neutral polymorphism between populations.

We then sequenced the remaining coding region of para from the five kdr individuals of the Malo strain, which exhibited the highest level of resistance. Compared with ParaCSMA, we found two additional amino acid changes, D58G and P1880L, in the Malo strain. However, we did not detect these two changes in the first five knocked-down individuals of Malo, the susceptible strain, Orlando, the first five and last five knocked-down individuals of Pinellis 417 (a high level of knockdown resistance) and Aves (a modest level of knockdown resistance) strains. All had D and P at the corresponding positions, like ParaCSMA. It is possible that the D58G and P1880L mutations detected in Malo are associated with the very high level of kdr in this strain. This needs to be tested in the future.

The D58G and P1880L mutations are located at the nitrogen and carbon termini, respectively. The E434K and C764R mutations are located in the first linker connecting domains I and II. E434K is situated close to the beginning of the linker region, whereas C764R is near the end of the linker (Fig. 1). The amino acid substitutions are quite drastic, especially from a negatively charged glutamic acid (E) to a positively charged lysine (K), from a cysteine (C) with a sulfhydryl group (highly reactive) to a positively charged arginine (R). Comparison of the deduced amino acid sequences of various sodium channel proteins in the regions where the four novel mutations reside reveals several intriguing features (Fig. 2). First, K434 detected in kdr cockroaches was found in all known sodium channel proteins of vertebrates. In contrast, E434 is conserved among insect Para and the squid sodium channel proteins (Fig. 2). It is known that mammals are more tolerant of pyrethroid insecticides compared with insects, often by several orders of magnitude (Elliott, 1976). More recently, Warmke et al. (1997) showed that rat brain type IIA sodium channel α-subunit was 100 times less sensitive to pyrethroids than the wild-type Para sodium channel. Our results, in the context of these findings, reveal a potential site in sodium channel proteins that may be involved in the selective toxicity of pyrethroid insecticides between mammals and insects. Secondly, C764 is conserved among all known sodium channel proteins, suggesting a potential role of C764 in sodium channel function. Furthermore, the D58G mutation is located at the nitrogen terminus. All insect Para proteins have an aspartic acid (D) at the corresponding position, while the rest of the channels in Fig. 2 (including ones not shown, see Goldin, 1995) all possess a glutamic acid (E), a conserved amino acid substitution, except for SNS which has a glycine (G) at this position. SNS belongs to a group of sodium channel proteins (Nav1.8) that are tetrodotoxin-resistant expressed primarily in small-diameter sensory neurons of the dorsal root ganglion and trigeminal ganglion (Goldin, 1999). It would be interesting to test the sensitivity of SNS channels to pyrethroid insecticides.

Fig. 1.

Fig. 1

kdr-associated mutations in the German cockroach Para sodium channel. The schematic diagram of the Para sodium channel indicates four homologous domains (I–IV), each with six transmembrane segments (S1–6). L993F was previously identified in a kdr strain (Ectiban-R) (Dong, 1997). Four additional mutations (D58G, E433K, C764R and P1880L, identified in this study) are associated with high levels of resistance.

Fig. 2.

Fig. 2

Alignment of amino acid sequences of regions where kdr-associated para mutations reside among sodium channel α-subunits from various species and tissues. Sequence alignment was carried out with the entire amino acid sequences of ParaCSMA and other sodium channel α-subunits using the Clustal method (DNASTAR). D58, E433, C764 and P1880 in ParaCSMA (wild-type Para) and the corresponding amino acid residues in other sodium channel sequences are boxed. Indicated above each box is the amino acid substitution found in the kdr cockroach Para. The first three sequences are insect Para protein sequences (accession numbers): cockroach ParaCSMA (U73583; Dong, 1997), Drosophila Para (M24285; Loughney et al., 1989) and house fly Vssc1 (U38813; Ingles et al., 1996). GFLN1 is from the giant axon of the squid Loligo opalescens (L19979; Rosenthal and Gilly, 1993); Eel is from Electrophorus electricus (M22252; Noda and Numa, 1987); Nas is from rabbit Schwann cell (U35238; Belcher et al., 1995); PN1 is from rat peripheral neurons (U79568; Toledo-Aral et al., 1997); NaNG is from dog nodose ganglion neurons (U60590; Chen et al., 1997); Rat IIA is from rat brain (X 61149; Auld et al., 1988); rH1 is from rat cardiac muscle (M27902; Rogart et al., 1989); µ1 is from rat skeletal muscle (M26643; Trimmer et al., 1989); HBA is from human brain (M94055; Ahmed et al., 1992); SNS is from rat sensory neurons (X92184; Akopian et al., 1996).

So far, the four additional kdr-associated mutations appear to coexist with the L993F mutation and have been found only in highly resistant strains. We sequenced para cDNA from a strain (Swine) that lacks the L993F mutation and exhibits only a modest level of kdr (Table 2). However, none of the additional mutations were detected in the Swine strain. These mutations also were not found in a kdr strain (Aves) that contained the L993F mutation (Valles et al., 2000) and exhibited only a moderate level of resistance (Table 2). It is important to note that Ectiban-R was selected from a DDT-resistant strain obtained in the late 1960s and the L993 to F993 mutation could be the result of DDT selection. We suspect that the four novel kdr-associated para gene mutations in the recently field-collected cockroach strains may have resulted from intensive pyrethroid applications since the 1970s. These mutations, together with the pre-existing L993F mutation, may be responsible for the high level of kdr resistance to pyrethroids in the German cockroach. They could be the counterparts of the second mutation (M to T in the linker connecting IIS4 and IIS5) in the super-kdr house fly. We are currently analyzing the mutant Para channels expressed in Xenopus oocytes to examine channel properties and sensitivity to pyrethroid insecticides. These novel mutations may directly or indirectly alter pyrethroid binding affinity. Alternatively, they may modify channel gating kinetics in a manner that counteracts the action of pyrethroids. Pyrethroids slow the kinetics of both activation and inactivation gates, resulting in prolonged opening of individual sodium channels (Narahashi, 1988). Pyrethroids also cause a shift of the channel activation and inactivation in the hyperpolarizing direction. Thus, a shift of the voltage dependence of activation or inactivation to more depolarizing membrane potentials could counteract (antagonize) the action of pyrethroids. It has been shown that voltage dependences of activation and inactivation were shifted significantly in the depolarization direction in the primary neurons isolated from a pyrethroid-resistant Heliothis virescens strain carrying the valine to methionine mutation in IS6 (Lee et al., 1999). Characterization of these novel mutations in an in vivo expression system, such as the Xenopus oocyte system, will significantly improve our understanding of the molecular basis of the kdr mechanism and the molecular interaction between pyrethroid insecticides and sodium channels.

Acknowledgements

The authors thank Drs Noah Koller and Jianguo Tan for critical review of the manuscript. The work was supported by grants from NSF (IBN 9696092 and IBN 98-08156) and NIH (08-R1GM57440A).

References

  1. Ahmed CM, Ware DH, Lee SC, Patten CD, Ferrer-Montiel AV, Schinder AF, McPherson JD, Wagner-McPherson CB, Wasmuth JJ, Evans GA, Montal M. Primary structure, chromosomal localization, and functional expression of a voltage-gated sodium channel from human brain. Proc. Natl. Acad. Sci. USA. 1992;89:8200–8224. doi: 10.1073/pnas.89.17.8220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akopian AN, Sivilotti L, Wood J. A tetrodotoxin-resistant voltage-gated sodium channel expressed by sensory neurons. Nature. 1996;379:257–262. doi: 10.1038/379257a0. [DOI] [PubMed] [Google Scholar]
  3. Auld VJ, Goldin AL, Krafte DS, Marshall J, Dunn MJ, Catterall WA, Lester HA, Davidson N, Dunn RJ. A rat brain Na+ channel α-subunit with novel gating properties. Neuron. 1988;1:449–461. doi: 10.1016/0896-6273(88)90176-6. [DOI] [PubMed] [Google Scholar]
  4. Belcher SM, Zerillo CA, Levinson R, Ritchie JM, Howe JR. Cloning of a sodium channel α-subunit from rabbit Schwann cells. Proc. Natl. Acad. Sci., USA. 1995;92:11034–11038. doi: 10.1073/pnas.92.24.11034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen J, Ikeda SR, Lang W, Isales CM, Wei X. Molecular cloning of a putative tetrodotoxin-resistant sodium channel from dog nodose ganglion neurons. Gene. 1997;202:7–14. doi: 10.1016/s0378-1119(97)00433-2. [DOI] [PubMed] [Google Scholar]
  6. Dong K. A single amino acid change in the Para sodium channel protein is associated with knockdown-resistance (kdr) to pyrethroid insecticides in German cockroach. Insect Biochem. Mol. Biol. 1997;27:93–100. doi: 10.1016/s0965-1748(96)00082-3. [DOI] [PubMed] [Google Scholar]
  7. Dong K, Valles SM, Scharf ME, Zeichner B, Bennett GW. Knockdown resistance (kdr) mutation in pyrethroid-resistant German cockroaches. Pestic. Biochem. Physiol. 1998;60:195–204. [Google Scholar]
  8. Elliott M. Properties and applications of pyrethroids. Environ. Health Perspectives. 1976;14:3–13. doi: 10.1289/ehp.76141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Feng G, Deak P, Chopra M, Hall LM. Cloning and functional analysis of TipE, a novel membrane protein that enhances Drosophila Para sodium channel function. Cell. 1995;82:1001–1011. doi: 10.1016/0092-8674(95)90279-1. [DOI] [PubMed] [Google Scholar]
  10. Goldin AL. Voltage-gated sodium channels. In: North RA, editor. Ligand- and Voltage-Gated Ion Channels. Ann Arbor, MI: CRC Press; 1995. pp. 73–101. [Google Scholar]
  11. Goldin AL. Diversity of mammalian voltage-gated sodium channels. In: Rudy B, Seeburg P, editors. Molecular and Functional Diversity of Ion Channels and Receptors. vol. 868. New York: New York Academy of Sciences; 1999. pp. 38–50. [DOI] [PubMed] [Google Scholar]
  12. Ingles PJ, Adams PM, Knipple DC, Soderlund DM. Characterization of voltage-sensitive sodium channel gene coding sequences from insecticide-susceptible and knockdown-resistant house fly strains. Insect Biochem. Mol. Biol. 1996;26:319–326. doi: 10.1016/0965-1748(95)00093-3. [DOI] [PubMed] [Google Scholar]
  13. Jamroz RC, Guerrero FD, Kammlah DM, Kunz SE. Role of the kdr and super-kdr sodium channel mutations in pyrethroid resistance: correlation of allelic frequency to resistance level in wild and laboratory populations of horn flies (Haematobia irritans) Insect Biochem. Mol. Biol. 1998;28:1031–1037. doi: 10.1016/s0965-1748(98)00094-0. [DOI] [PubMed] [Google Scholar]
  14. Koehler PG, Patterson RS. A comparison of insecticide susceptibility in seven nonresistant strains of the German cockroach, Blattella germanica (Dictyoptera: Blattellidae) J. Med. Entomol. 1986;23:298–299. [Google Scholar]
  15. Lee D, Park Y, Brown TM, Adams ME. Altered properties of neuronal sodium channels associated with genetic resistance to pyrethroids. Mol. Pharmacol. 1999;55:584–593. [PubMed] [Google Scholar]
  16. Loughney K, Kreber R, Ganetzky B. Molecular analysis of the para locus, a sodium channel gene in Drosophila. Cell. 1989;58:1143–1154. doi: 10.1016/0092-8674(89)90512-6. [DOI] [PubMed] [Google Scholar]
  17. Martinez-Torres D, Chandre F, Williamson MS, Darriet F, Berge JB, Devonshire AL, Guillet P, Pasteur N, Pauron D. Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae s.s. Insect Mol. Biol. 1998;7(2):179–184. doi: 10.1046/j.1365-2583.1998.72062.x. [DOI] [PubMed] [Google Scholar]
  18. Martinez-Torres D, Foster SP, Field LM, Devonshire AL, Williamson MS. A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae. Insect Mol. Biol. 1999;8(3):339–346. doi: 10.1046/j.1365-2583.1999.83121.x. [DOI] [PubMed] [Google Scholar]
  19. Miyazaki M, Ohyama K, Dunlap DY, Matsumura F. Cloning and sequencing of the para-type sodium channel gene from susceptible and kdr-resistant German cockroaches (Blattella germanica) and house fly (Musca domestica) Mol. Gen. Genet. 1996;252:61–68. [PubMed] [Google Scholar]
  20. Mutero A, Pralavorio M, Bride JM, Fournier D. Resistance-associated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci., USA. 1994;91:5922–5926. doi: 10.1073/pnas.91.13.5922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Narahashi T. Molecular and cellular approaches to neurotoxicology: past, present and future. In: Lunt GG, editor. Neurotox ’88: Molecular Basis of Drug and Pesticide Action. New York: Elsevier; 1988. pp. 563–582. [Google Scholar]
  22. Noda M, Numa S. Structure and function of sodium channel. J. Recept. Res. 1987;7:467–497. doi: 10.3109/10799898709054998. [DOI] [PubMed] [Google Scholar]
  23. Park Y, Taylor MF. A novel mutation L1029H in sodium channel hscp associated with pyrethroid resistance for Heliothis virescens (Lepidoptera: Noctuidae) Insect Biochem. Mol. Biol. 1997;27:9–13. doi: 10.1016/s0965-1748(96)00077-x. [DOI] [PubMed] [Google Scholar]
  24. Park Y, Taylor MF, Feyereisen R. A valine 421 to methionine mutation in IS6 of the hscp voltage-gated sodium channel associated with pyrethroid resistance in Heliothis virescens (Lepidoptera: Noctuidae) Biochem. Biophys. Res. Commun. 1997;239:688–691. doi: 10.1006/bbrc.1997.7511. [DOI] [PubMed] [Google Scholar]
  25. Rogart RB, Cribbs LL, Muglia LK, Kephart DD, Kaiser MW. Molecular cloning of a putative tetrodotoxin-resistant rat heart Na+ channel isoform. Proc. Natl. Acad. Sci., USA. 1989;86:8170–8174. doi: 10.1073/pnas.86.20.8170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Rosenthal JJ, Gilly WF. Amino acid sequence of a putative sodium channel expressed in the giant axon of the squid Loligo opalescens. Proc. Natl. Acad. Sci., USA. 1993;90:10026–10030. doi: 10.1073/pnas.90.21.10026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Scott JG, Cochran DG, Siegfried BD. Insecticide toxicity, synergism and ressitance in germna cockroach (Dictyoptera: Blattellidae) J. Econ. Ent. 1990;83:1698–1703. doi: 10.1093/jee/83.5.1698. [DOI] [PubMed] [Google Scholar]
  28. Smith TJ, Lee SH, Ingles PJ, Knipple DC, Soderlund DM. The L1014F point mutation in the house fly Vssc1 sodium channel confers knockdown resistance to pyrethroids. Insect Biochem. Mol. Biol. 1997;27:807–812. doi: 10.1016/s0965-1748(97)00065-9. [DOI] [PubMed] [Google Scholar]
  29. Soderlund DM, Bloomquist JR. Molecular mechanisms of insecticide resistance. In: Roush RT, Tabashnik BE, editors. Pesticide Resistance in Arthropods. New York: Chapman and Hall; 1990. pp. 58–96. [Google Scholar]
  30. Trimmer JS, Cooperman SS, Tomiko SA, Zhou J, Crean SM, Boyle MB, Kallen RG, Sheng Z, Barchi RL, Sigworth FJ, Goodman RH, Agnew WS, Mandel G. Primary structure and functional expression of a mammalian skeletal muscle sodium channel. Neuron. 1989;3:233–249. doi: 10.1016/0896-6273(89)90113-x. [DOI] [PubMed] [Google Scholar]
  31. Toledo-Aral JJ, Mose BL, He ZJ, Koszowski AG, Whisenand T, Levinson SR, Wolf JJ, Silos-Santiago I, Halegoua S, Mandel G. Identification of PN1, a predominant voltage-dependent sodium channel expressed principally in peripheral neurons. Proc. Natl. Acad. Sci. USA. 1997;94(4):1527–1532. doi: 10.1073/pnas.94.4.1527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Valles SM. Toxicological and biochemical studies with field populations of German cockroach, Blattella germanica. Pestic. Biochem. Physiol. 1998;62:190–200. [Google Scholar]
  33. Valles SM, Dong K, Brenner RJ. Mechanisms responsible for cypermethrin resistance in a strain of German cockroach. Blattella germanica. Pestic. Biochem. Physiol. 2000;66:195–205. [Google Scholar]
  34. Warmke JW, Reenen RAG, Wang P, Qian S, Arena JP, Wang J, Wunderler D, Liu K, Kaczorowski GJ, Van der Plong LHT, Ganetzky B, Cohen CJ. Functional expression of Drosophila para sodium channels: Modulation by the membrane protein TipE and toxin pharmacology. J. Gen. Physiol. 1997;110:119–133. doi: 10.1085/jgp.110.2.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Williamson MS, Martinez-Torres D, Hick CA, Devonshire AL. Identification of mutations in the housefly para-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides. Mol. Gen. Genet. 1996;252:51–60. doi: 10.1007/BF02173204. [DOI] [PubMed] [Google Scholar]

RESOURCES