Skip to main content
PMC home page
Journal of Clinical Oncology logoLink to Journal of Clinical Oncology
. 2010 Dec 28;29(6):698–703. doi: 10.1200/JCO.2010.31.5192

WT1 Mutation and 11P15 Loss of Heterozygosity Predict Relapse in Very Low-Risk Wilms Tumors Treated With Surgery Alone: A Children's Oncology Group Study

Elizabeth J Perlman 1,✉, Paul E Grundy 1, James R Anderson 1, Lawrence J Jennings 1, Daniel M Green 1, Jeffrey S Dome 1, Robert C Shamberger 1, E Cristy Ruteshouser 1, Vicki Huff 1
PMCID: PMC3056654  PMID: 21189373

Abstract

Purpose

Children's Oncology Group defines very low-risk Wilms tumors (VLRWT) as stage I favorable histology Wilms tumors weighing less than 550 g in children younger than 24 months of age. VLRWTs may be treated with nephrectomy alone. However, 10% to 15% of VLRWTs relapse without chemotherapy. Previous studies suggest that VLRWTs with low WT1 expression and/or 11p15 loss of heterozygosity (LOH) may have increased risk of relapse. The current study validates these findings within prospectively identified children with VLRWT who did not receive adjuvant chemotherapy.

Patients and Methods

Fifty-six VLRWTs (10 relapses) were analyzed for mutation of WT1, CTNNB1, and WTX; for 11p15 LOH using microsatellite analysis; and for H19DMR and KvDMR1 methylation.

Results

11p15 LOH was identified in 19 (41%) of 46 evaluable VLRWTs and was significantly associated with relapse (P < .001); 16 of 19 were isodisomic for 11p15. WT1 mutation was identified in nine (20%) of 45 evaluable VLRWTs and was significantly associated with relapse (P = .004); all nine cases also had 11p15 LOH. All evaluable tumors showing LOH by microsatellite analysis also showed LOH by methylation analysis. Retention of the normal imprinting pattern was identified in 24 of 42 evaluable tumors, and none relapsed. Loss of imprinting at 11p15 was identified in one of 42 tumors.

Conclusion

WT1 mutation and 11p15 LOH are associated with relapse in patients with VLRWTs who do not receive chemotherapy. These may provide meaningful biomarkers to stratify patients for reduced chemotherapy in the future. VLRWTs show a different incidence of WT1 mutation and 11p15 imprinting patterns than has been reported in Wilms tumors of all ages.

INTRODUCTION

Within the current Children's Oncology Group (COG) Favorable Histology Wilms Tumor (FHWT) protocols, a subset of patients has been defined as very low-risk Wilms tumor (VLRWT). This subset includes patients younger than 24 months of age with stage I FHWTs weighing less than 550 g. If eligible for this protocol, patients are treated with nephrectomy alone, without adjuvant chemotherapy. This approach is supported by the prospective evaluation of children with VLRWTs within the National Wilms Tumor Study-5 (NWTS-5). From 1995 to 1998, 75 children with VLRWT were treated with nephrectomy alone; eight patients experienced recurrence, and three developed metachronous contralateral tumors, resulting in a 2-year disease-free survival estimate of 86.5%.1 As a result of pre-established stopping rules, this therapeutic arm was closed in 1998, and patients previously registered were recalled and given the option of receiving chemotherapy late in their course. From 1998 to 2002, 111 children with VLRWT continued to be registered on NWTS-5 but were treated with vincristine and dactinomycin. The long-term follow-up of children with VLRWT registered on NWTS-5 who did not receive adjuvant chemotherapy was recently compared with that of the patients who received adjuvant chemotherapy. Both groups showed an equivalent overall survival as a result of the higher than expected salvage rate in the chemotherapy- naive patients.2

The previously mentioned studies indicate that approximately 10% to 15% of patients with VLRWT will experience relapse without chemotherapy. The ability to identify subsets of patients with VLRWTs who may have different risks of recurrence would enable further refinement of the criteria for selection of those children who may not benefit from chemotherapy. Genetic markers may allow for broadening of the somewhat arbitrary clinical criteria used to define candidates for nephrectomy only. Toward this end, patterns of global gene expression were recently reported for VLRWT.3 One subset was characterized by low expression of WT1, a gene located on 11p13 that is inactivated in up to 20% of Wilms tumors.4 This subset contained three of the six total relapses. Further, all evaluable patients with VLRWT who experienced relapse in this study had loss of heterozygosity (LOH) for 11p, a finding that is associated with WT1 mutation.4–7 These data suggest that children with VLRWT whose tumors show WT1 mutation and/or 11p LOH may have an increased risk of relapse. The goal of the current study is to validate these findings within a group of prospectively identified children with VLRWT who did not receive adjuvant chemotherapy.

PATIENTS AND METHODS

Clinical Samples

Seventy-seven children younger than 24 months of age at diagnosis with stage I FHWT less than 550 g were initially treated with nephrectomy only on the NWTS-5 protocol. Of these, 53 children did not receive subsequent chemotherapy when the trial closed and therefore met our selection criteria. Also included were two patients with VLRWT who did not receive chemotherapy, but were not eligible because of late registration only. Lastly, NWTS-5 was searched for children who fully met the criteria for VLRWT but who received adjuvant chemotherapy and experienced relapse. All such patients were included because of the presumption that metastasis would have occurred had chemotherapy not been given. This results in a total of 56 patients within the current analysis. Nine tumors were also included in the prior gene expression analysis study.3 Institutional review board approval and informed consent for all patients were obtained. Specimens were obtained from the initial nephrectomy specimen, snap-frozen and stored at −80°C at the National Wilms Tumor Study Group Biology Reference Laboratory.8 A frozen section of each confirmed the presence of ≥ 80% viable tumor. Diagnosis and local stage were determined by central pathology review.

Loss of Heterozygosity

Samples were analyzed prospectively from 1995 to 2002 using polymerase chain reaction (PCR) for loci on 11p15 as previously described.8 Polymorphic loci INS, TH, and D11S1984 were evaluated initially. If these were noninformative, D11S922 and D11S2362 were also assessed. Loss of heterozygosity (LOH) was considered to be present if one of the two alleles in the constitutional DNA was absent or definitely reduced in the tumor DNA as determined by visual inspection of the ethidium stained gel by two individuals independently without knowledge of outcome. In cases in which only one locus was informative, the assay was repeated to ensure reproducibility.

11p15 Copy Number Analysis

Samples with LOH or presumed constitutional homozygosity for 11p15 were analyzed for 11p15 copy number using multiplex ligation-dependent probe amplification to assess for uniparental isodisomy (two identical copies of 11p15). Four probe sets were synthesized to loci on 11p15, and eight control probes were used for internal normalization. The probe sequences are provided in Appendix Table A1 (online only). Two normal control samples whose DNAs were prepared in the same manner as the test samples were likewise analyzed. After internal normalization, the test samples were normalized to the control samples to yield a ratio of relative copy number. Ratios less than 0.75 were interpreted as loss, and those greater than 1.35 were interpreted as gain.

Methylation Analysis at 11p15

Analysis of the extent of methylation of two differentially methylated regions (DMRs) on chromosome 11p15 was performed as previously described.9 The paternally methylated H19 DMR (aberrantly methylated in many Wilms tumors) and the maternally methylated KvDMR1 (whose methylation is independent of H19) both contain specific restriction sites recognized by methylation-sensitive enzyme HpaII and by MspI, which cuts irrespective of methylation. DNA was extracted using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Santa Clarita, CA) following the manufacturer's protocol and was digested with either RsaI, RsaI plus HpaII, or RsaI plus MspI followed by quantitative PCR using primers described in Appendix Table A1 with the AB Power SYBR Green Kit (Applied Biosystems, Foster City, CA) following the manufacturer's protocol. Percent methylation was determined at each locus by comparing the quantity of amplified product after RsaI and HpaII digestion with the quantity of amplified product after cutting with RsaI alone. The RsaI and MspI digest was used to control for complete digestion. The cycle at which an arbitrary threshold level of fluorescence (the Ct value) was reached was determined. Retention of imprinting is demonstrated by 30% to 70% methylation of both H19 and KvDMR1; loss of imprinting is demonstrated by 80% to 100% methylation of H19 and 30% to 70% methylation of KvDMR1; loss of heterozygosity is demonstrated by 80% to 100% methylation of H19 and 0% to 20% methylation of KvDMR1.

Mutation Analysis

Tumor DNAs were assessed for WT1 point mutations and small insertions/deletions by sequence analysis of PCR products from all 10 exons, including flanking intronic sequence. Quantitative real-time PCR was performed to identify deletions encompassing one or more exons. Eight amplicons were used for this analysis: promoter/exon 1, exon 2/3, exon 4, exon 5, exon 6, exon 7, exon 8/9, and exon 10 (Appendix Table A1). Tumor DNA was amplified in duplicate using SYBR Green PCR Master Mix (Applied Biosystems) with amplicons from WT1 as well as two reference amplicons10: the intron 13–exon 14 region of NDST1 (N-deacetylase/N-sulfotransferase, located at 5q33.1) and the intron 4–exon 5 region of FAH (fumarylacetoacetate hydrolase, located at 15q25.1). These reference amplicons were used because chromosomes 5 and 15 are rarely amplified or deleted in Wilms tumors11,12 and both are unique, single-copy genes. Tumor DNAs were analyzed for point mutations in CTNNB1 as previously described.13 The WTX locus was assessed for deletions by quantitative real-time PCR as described.10 Additionally, regions of WTX where functional mutations were previously observed were sequenced.10

RESULTS

Among the 56 patients assessed, 10 patients experienced relapse. This included seven patients with pulmonary metastasis detected 96, 140, 154, 164, 182, 202, and 303 days after diagnosis. Three patients developed local recurrence within the operative bed at 94, 133, and 383 days after diagnosis. The average follow-up for those patients who did not experience relapse was 2,733 days (range, 676 to 3,976 days).

LOH Analysis

11p15 LOH analysis was performed on 49 tumors using microsatellite analysis, and the data are provided in Tables 1 and 2. Of note, three tumors (patients 1 through 3) demonstrated constitutional homozygosity for all five loci sampled. Although these are technically noninformative using this method, this is most consistent with uniparental disomy, a recognized event in patients with Wilms tumor. Excluding the patients with constitutional homozygosity, the overall rate of LOH in VLRWTs was 16 (35%) of 46, compared with an overall published prevalence within FHWT of 33%.8 LOH for 11p was significantly associated with relapse in VLRWTs (P = .001, sensitivity 85.7%, specificity 74.4%, positive predictive value 37.5%, negative predictive value 96.7%).

Table 1.

Mutation and LOH Analysis

Relapse 11p15 LOH Microsatellite
 WT1 Mutation
 11p15 LOH Methylation
LOH H ROH ND Mutation No Mutation ND LOH LOI ROI ND
Relapse, n = 10 6 2 1 1 5 3 2 8 0 0 2
    Lung, n = 7 4 2 1 0 4 2 1 6 0 0 1
    OR bed, n = 3 2 0 0 1 1 1 1 2 0 0 1
No relapse, n = 46 10 1 29 6 4 33 9 9 1 24 11
Total, n = 56 16 3 30 7 9 36 11 17 1 24 13
Open in a new tab

Abbreviations: LOH, loss of heterozygosity; H, constitutional homozygosity for all five loci; ROH, retention of heterozygosity; LOI, loss of imprinting; ROI, retention of imprinting; ND, not done; OR, operative.

Table 2.

Clinical, Pathologic, and Genetic Data

Patient Relapse 11P LOH Summary 11p15 Copy No. 11p15 Methylation Mutation Summary Interpretation Histology % Muscle Nephrogenic Rests
1 Lung H 2 copies LOH WT1, Bcat Constitutional 11p15 isodisomy; homozygous WT1 mutation Mixed 5 Multiple ILNR
2 None H 2 copies LOH WT1, Bcat Constitutional 11p15 isodisomy; homozygous WT1 mutation Mixed 70 Multiple ILNR
3 Lung H 2 copies LOH None Constitutional 11p15 isodisomy Mixed 1 ILNR
4 Lung LOH 2 copies LOH WT1, Bcat Isodisomy for 11p15; homozygous WT1 deletion Mixed 60 Multiple ILNR
5 Lung LOH 2 copies LOH WT1 Isodisomy for 11p15; homozygous WT1 mutation Mixed 0 Multiple ILNR
6 None LOH 2 copies ND WT1, Bcat Isodisomy for 11p15; homozygous WT1 mutation Mixed 50 Multiple ILNR
7 OR bed LOH 2 copies LOH None Isodisomy for 11p15 in tumor Mixed 0 Multiple ILNR
8 Lung LOH 3 copies LOH* None Three copies of 11p15, two isodisomic Mixed 0 Multiple ILNR
9 None LOH 2 copies LOH None Isodisomy for 11p15 in tumor Epithelial 0 Multiple PLNR
10 None LOH 2 copies LOH None Isodisomy for 11p15 in tumor Blastemal 0 Multiple PLNR
11 None LOH 2 copies LOH None Isodisomy for 11p15 in tumor Blastemal 0 Multiple PLNR
12 None LOH 2 copies LOH WTX Isodisomy for 11p15 in tumor Mixed 0 ILNR plus PLNR
13 None LOH 2 copies LOH Bcat Isodisomy for 11p15 in tumor Mixed 1 None
14 None LOH 2 copies ND WTX Isodisomy for 11p15 in tumor Mixed 0 One ILNR
15 None LOH 2 copies LOH WTX Isodisomy for 11p15 in tumor Mixed 0 ILNR plus PLNR
16 Lung LOH 1 copy LOH WT1 het del Loss of 1 copy of 11p13-15 Mixed 0 Inconclusive
17 OR bed LOH 2 copies LOH WT1 het del Isodisomy for 11p15; heterozygous WT1 deletion Mixed 0 None
18 None LOH 1 copy LOH WT1 het del Loss of 1 copy of 11p13-15 Blastemal 0 Inconclusive
19 None LOH 1 copy LOH WT1 het del Loss of 1 copy of 11p13-15 Mixed 0 Multiple ILNR
20 None No LOH 2 copies ROI WTX Two copies of 11p13 and 11p15 Mixed 0 Multiple ILNR
21 None No LOH 2 copies ROI WTX Two copies of 11p13 and 11p15 Mixed 0 ILNR plus PLNR
22 Lung No LOH ND ND ND Mixed 0 None
23 OR bed ND ND ND ND Blastemal 0 Inconclusive
24 None No LOH ND LOI Neg Two copies of 11p13 and 11p15 Mixed 3 ILNR
25 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
26 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
27 None No LOH ND ND Neg Two copies of 11p13 and 11p15 EDT 0 Inconclusive
32 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
29 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
36 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
33 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 Inconclusive
40 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 ILNR
41 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
44 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
54 None ND ND ROI Neg Two copies of 11p13 and 11p15 EDT 0 None
35 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Epithelial 0 None
38 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Epithelial 0 None
45 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Epithelial 0 Inconclusive
28 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Blastemal 0 None
30 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 ILNR
31 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 None
34 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 Multiple ILNR
37 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 None
39 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 Inconclusive
42 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 None
43 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 None
46 None No LOH ND ROI Neg Two copies of 11p13 and 11p15 Mixed 0 None
50 None No LOH ND ND ND ND Epithelial 0 Inconclusive
48 None No LOH ND ND ND ND Epithelial 0 Multiple PLNR
47 None No LOH ND ND ND ND Mixed 0 Multiple ILNR plus PLNR
49 None No LOH ND ND ND ND Mixed 0 None
51 None ND ND ND ND ND Mixed 40 ILNR
52 None ND ND ND ND ND Mixed 0 Inconclusive
56 None ND ND ND ND ND Mixed 0 None
55 None ND ND ND ND ND EDT 0 None
53 None ND ND ND ND ND Blastemal 0 ILNR
Open in a new tab

Abbreviations: LOH, loss of heterozygosity; H, constitutional homozygosity for all 5 loci; OR, operative; ILNR, intralobular nephrogenic rests; ND, not done; LOI, loss of imprinting; ROI, retention of imprinting; PLNR, perilobular nephrogenic rests.

*

Seventy-seven percent H19DMR methylation, 35% KvDMR methylation, consistent with LOH in two of three copies.

WT1 Analysis

WT1 analysis was performed on 45 tumors for which sufficient frozen tumor sample was available, and the data are provided in Tables 1 and 2. Overall, WT1 abnormalities were identified in nine (20%) of 45 tumors. Homozygous WT1 mutations or deletions were identified in the tumors of five patients (Table 2). Mutations identified included truncating mutations in exon 1 (patients 1 and 5) and exon 7 (patient 6), deletion of exons 4 to 10 (patient 4), and a 3 base pair insertion 8nt 5′ of exon 6, the functional significance of which is not clear (patient 2, who did not experience relapse). Heterozygous deletion of the entire WT1 locus was identified in four patients (patients 16 through 19). Six of nine tumors with WT1 abnormalities were associated with intralobar nephrogenic rests, many multiple (Table 2). Of the nine tumors with WT1 abnormalities, all demonstrated either LOH or constitutional homozygosity at 11p15 (Table 2). WT1 abnormalities were significantly associated with relapse in VLRWTs (P = .004, sensitivity 62.5%, specificity 89.2%, positive predictive value 55.5%, negative predictive value 91.7%). Of note, elimination of tumor 2 from the analysis would increase the significance of the association.

CTNNB1 and WTX Mutation

All tumors were also evaluated for CTNNB1 and WTX mutations. Of 45 tumors analyzed, five from male patients were deleted for WTX (11%). None of these also showed mutation of WT1, and no tumors with WTX deletion relapsed (Table 2). Of 45 tumors analyzed for CTNNB1 mutation, five sustained missense mutations (11%) and two of five relapsed. CTNNB1 mutations identified included Ser45Tyr (patients 1, 4, and 13), Ser45Pro (patient 2), and Ser45Phe (patient 6). Four of these also carried WT1 mutations, including both patients with CTNNB1 mutations who experienced relapse (Table 2). The presence of CTNNB1 mutation was associated with skeletal muscle differentiation within the Wilms tumor, as previously described.14,15 Neither WTX nor CTNNB1 mutation was significantly associated with relapse.

11p15 Copy Number Analysis

All samples with LOH or presumed constitutional homozygosity for 11p15 were analyzed for 11p15 copy number to assess for uniparental isodisomy (copy number neutral 11p15 LOH; Table 2). Of these, all but three patients with 11p15 LOH contained at least two copies of 11p15, consistent with isodisomy. One tumor showed gain consistent with three copies of 11p15 (patient 8).

Of the four patients with heterozygous deletion of WT1, three also showed both copy number loss and LOH of 11p15, most consistent with loss of a chromosomal segment including both 11p13 and 11p15.

11p15 Methylation Analysis

To further confirm isodisomy and to investigate the potential role of 11p15 imprinting abnormalities in those tumors that lacked LOH, the 42 tumors with remaining available DNA underwent H19 DMR and KvDMR1 methylation analysis (Table 2). All 17 tested tumors showing LOH by microsatellite analysis displayed only a paternal methylation pattern, consistent with paternal isodisomy. Of the remaining 25 patients who lacked LOH, all but one demonstrated retention of imprinting by 11p15 methylation analysis, and none of these experienced relapse. A single tumor retained heterozygosity at the 11p15 microsatellite loci, but showed loss of imprinting at 11p15. LOH as determined by 11p15 methylation analysis was significantly associated with relapse in VLRWTs (P < .0001, sensitivity 100%, specificity 73.5%, positive predictive value 47%, negative predictive value 100%).

DISCUSSION

Treatment with vincristine and dactinomycin constitutes the chemotherapeutic backbone for patients with FHWT. However, this therapy may cause serious myelosuppression and hepatic toxicity, particularly in very young children. The evidence collected thus far suggests that children with VLRWT have an excellent prognosis when treated with nephrectomy only.1,16–18 However, the definition of VLRWT is in many ways arbitrary. The criteria include weight of the tumor (< 550 g), age of the patient (< 24 months), and stage of the tumor (stage I). Although the application of such criteria is straightforward, it is philosophically and intellectually challenging, particularly for those tumors that weigh 551 g or in patients 25 months of age, for example. This has led to efforts to define different subtypes within VLRWT on the basis of inherent tumor characteristics, with the hope of finding differences in outcome within these subtypes.

To accomplish this, a recent gene expression analysis of 39 VLRWTs was performed that identified three subsets with different risks of relapse (subset 1, zero of nine relapses; subset 2, three [23%] of 13 relapses; subset 3, three [17%] of 17 relapses).3 Subset 2 was characterized in part by low WT1 expression. These data suggest that inactivation of WT1 may be of prognostic significance in VLRWT patients undergoing nephrectomy only. Of note, patients with constitutional WT1 abnormalities who develop FHWT do not show differences in overall outcome when treated with standard chemotherapeutic protocols.19 The ability to evaluate outcome was limited in this previous study because it included both children who did and did not receive adjuvant chemotherapy.

In addition to WT1 mutation, 11p15 LOH was also highly associated with relapse in children with VLRWT in the previous study. 11p15 LOH has been consistently recognized to be important in the development of Wilms tumor. 11p15 LOH may result from 11p15 deletion, chromosome loss, or somatic recombination.20 Chromosome loss often results in duplication of the remaining chromosome 11, resulting in copy number neutral LOH. Additionally, loss of imprinting (LOI) for 11p15 occurs in 30% to 50% of sporadic Wilms tumors, with aberrant methylation of the maternal allele of H19 and biallelic expression of insulin-like growth factor 2.21,22 Both copy number neutral 11p15 LOH and 11p15 LOI are predicted to result in overexpression of insulin-like growth factor 2. During NWTS-5, 11p15 LOH was assessed for all tumors registered. 11p15 LOH has been shown to occur in 33% of all patients with FHWT and has not been associated with differences in outcome for patients treated with standard chemotherapy.23

The current study validates the significant association of both WT1 mutation and 11p15 LOH with relapse within a group of prospectively identified children with VLRWT who did not receive adjuvant chemotherapy. It further demonstrates that all patients with WT1 mutation or deletion also had 11p15 LOH and that 16 of 19 tumors with 11p15 LOH were isodisomic for 11p15 (copy number neutral LOH), either confined to the tumor (13 of 16 cases) or constitutional (three of three cases). Lastly, it demonstrates a low incidence of LOI of 11p15 in this group of young patients, present in only one of 43 analyzed tumors compared with the reported overall incidence in sporadic Wilms tumors of 30% to 50%.21 No tumor that retained the normal 11p15 imprinting pattern relapsed in this study. It should be noted that all epithelial tubular differentiated VLRWTs from the previous gene expression analysis and in the current study retained the normal 11p15 imprinting pattern and did not relapse. These findings suggest that Wilms tumors in patients younger than 2 years display an increased frequency of WT1 mutations, an increase in 11p15 uniparental isodisomy, and a rather dramatic decrease in frequency of LOI. These features are associated with differences in relapse-free survival.

Although WT1 mutation and 11p15 LOH and LOI are considered to represent two independent pathogenetic mechanisms for Wilms tumors, a large proportion of patients with WT1 mutation also show 11p15 LOH. Therefore, in such tumors, mutation of one WT1 allele is followed by loss of the second (wild-type) allele due to chromosomal mechanisms such as whole chromosome loss, deletion, or somatic recombination, which also result in 11p15 LOH. Therefore, in the current study, WT1 mutation and 11p15 LOH are likely not independent variables, and the underlying evaluation of each locus independently may be difficult. The observations that (1) three of 10 relapses occurred in patients who lacked WT1 mutation but demonstrated 11p15 LOH with uniparental isodisomy and (2) all patients with WT1 abnormalities demonstrated 11p15 LOH suggests that analysis of 11p15 LOH may provide a more meaningful clinical test if the goal is to maximize sensitivity.

The ability to identify patients with VLRWT who have an increased risk of relapse in the absence of chemotherapy offers the hope of broadening the currently arbitrary definition of children who may not benefit from chemotherapy by either expanding the age or tumor weight criterion, or both. It is not possible to test this directly using patients previously treated within NWTS-5 because all such patients received chemotherapy and few experienced relapse. However, the United Kingdom Childhood Cancer Study Group investigated 242 patients with stage I FHWT (not restricted by age or tumor weight) treated with vincristine alone.24 Excluding the development of a contralateral tumor, this group of patients had a risk of relapse (31 of 242; 13%) that was similar to that experienced by children with VLRWT in NWTS-5 who received no adjuvant chemotherapy (eight of 75; 11%). The United Kingdom Childhood Cancer Study Group study demonstrated no significant difference in relapse between patients younger than 2 years (93%) and those 2 to 4 years of age (87%). However, patients more than 4 years of age at diagnosis had a significantly worse outcome (71%; P < .001). Importantly, tumor weight in this study was not an independent predictor of relapse. These findings suggest that the criteria for VLRWT may be broadened to include a larger range of patient age (up to 4 years) and any tumor weight.

In summary, the current study shows an association between WT1 mutation and 11p15 LOH with relapse in a group of prospectively identified children with VLRWT who did not receive chemotherapy. This association may in part be due to inherent differences in pathogenesis of VLRWT. These findings must be validated in an independent group of prospectively identified patients with VLRWT before using any of these biomarkers to stratify patients for different therapeutic approaches.

Appendix

Table A1.

Primer and Probe Sequences

11p15 Copy Number Analysis (MLPA)
Left Hemiprobe Gene-Specific Sequence Right Hemiprobe Gene Specific-Sequence
B4GALNT4 (11p15.5) CTTCCTGGACGACGAGGACGAGG GGGAGCTGCTCGACAGCCTGGAG
B4GALNT4 (11p15.5) TGCAGGCAGGGCTGGAGGTGGA GCGGCTCCGACTGCGGAATTTCTA
BET1L (11p15.5) CCTGTGAGATCGTTCTGCATGGGTTCG GGGTGAGCGGGAGTCGGCATT
BET1L (11p15.5) CAGTGTGAGAGCCAGGGTTACCTACTCT GCCAAGTGAGGACAAACTGCTAGGCTGT
TP53 (17p13.1) TGCTTGCAATAGGTGTGCGTCAGAAGC ACCCAGGACTTCCATTTGCTTTGTCCCG
HTR7 (10q23.31) TTGGCTCCTTATCCTGCCTGACTTGAATGC CCGACTATTGACCTCTCTGCTTCATTCTGGC
RET (10q11.21) GGACAGGCTAGCTAGCTGTGTTAGAAGTAGCAA TGACAATGACCAAGGACTGCTACACCTCTGATT
RB1 (13q14.2) CAAACAAGGAAGAGAAATGAGGATCTCAGGACC TTGGTGGACACTGTGTACACCTCTGGATTCATT
TSC1 (9q34.13) GCAAGTGCAAAGGCCTTGAGCAAGAAAGAACCA GTATTCCTGTGTTTGGGAAGACTGGGACTAGAGC
PTEN (10q23.31) TGGATGTGCAGCAGCTTACATGTCTGAAGTTAC TTGAAGGCATCACTTTTAAGAAAGCTTACAGTTGGGC
SRY (Yp11.31) GTCCAGCTGTGCAAGAGAATATTCCCGCT CTCCGGAGAAGCTCTTCCTTCCTTTGCA
FMR1 (Xq27.3) CATTACAGAATACCTCCAGTGAAGGTAGTCGGCT GCGCACGGGTAAAGATCGTAACCAGAAGAAAGA
11p15 Methylation Analysis
Forward Reverse
H19 DMR GGCCCTAGTGTGAAACCCTTCTCG CAGGCGGTGAGACCGAAGGA
KvDMR1 CCCGCTGGGCCAATCT GAGTCTGGTTTTGATGCCACC
WT1 Sequencing
Forward Reverse
Exon 1-5′ AGCCAGAGCAGCAGGGAGTC AACGACCCGTAAGCCGAAGC
Exon 1-3′ CGCCGGTGCTGGACTTTG CGGTCAAAAGGGGTAGGAGA
Exon 2/3 CGTCTTCCTGCCGAAAGTC TAGAGTGGAGTCGAGGCGTCT
Exon 4 ATCCCTTCTGCTGTGTATGAA AAGGAGGAAAGCGTTCTA
Exon 5 TTGAGGGGCTTTTCACTG GTCCTAACTCCTGCATTG
Exon 6 GCATTTCCAAATGGCGACTG TCAGACCCAGGGGACGAGCA
Exon 7 CCCTCAAGACCTACGTGAATG AACCTGGGTCCTTAGCAGT
Exon 8 CCTAACAAGCTCCAGCGAAGT GAATCATGAAATCAACCCTAGCC
Exon 9 GGACTGGGGAAATCTAAG AATCCCTCTCATCACAAT
Exon 10 GGGTGCCTTGTGATGACTTC GGCCTGTGAGTCAACTAA
WT1 qPCR
Promoter TCCTCACTGGAAAGGGAAACTAAG TTTCGATCGGCTAGTAGTTGTTTACTT
Exon 2/3 CGCCCAGCTACGGTCAC ACTTGGTTCCGCTCGCTTAC
Exon 4 TATACCAAATGACATCCCAGCTTGAAT AGTTACTGTGGAAAGGCAATGGAA
Exon 5 GGCAGAGCAAGTGAGTGGACAA CCACCAAATGCTACCCTGATTAC
Exon 6 AAGCATTTCCAAATGGCGACTG AGGATGGGCGTTGTGTGGTTA
Exon 7 CTTACCCAGGCTGCAATAAGAGA GGAAAAGGAGCTCTTGAACCATGT
Exon 8/9 CCCAAGGTGAGAAACCATACCAG GCCAGCAATGAGAAGTGAACCTACA
Exon 10 GTGTCTCTGACTGGCAATTGTGT CATGTTGTGATGGCGGACTAA
Open in a new tab

Abbreviations: MLPA, multiplex ligation-dependent probe amplification; qPCR, quantitative real-time polymerase chain reaction.

Footnotes

Written on behalf of the Renal Tumor Committee of the Children's Oncology Group.

Supported by the National Childhood Cancer Foundation and the CureSearch Wilms Tumor Initiative; Grants No. UO1CA88131 (E.J.P.), U10CA42326 (D.M.G., E.J.P.), U10CA98543 (J.S.D., P.E.G., J.A., E.J.P.), CA34936 (V.H.), DK069599 (V.H.), CA16672 (The University of Texas MD Anderson Cancer Center Core Grant), and Chair's Grant No. U10 CA98543 of the Children's Oncology Group from the National Cancer Institute, National Institutes of Health, Bethesda, MD.

The content of this article is solely the responsibility of the authors and does not necessarily represent the official views of the National Cancer Institute or the National Institutes of Health. A complete listing of grant support for research conducted by the Children's Cancer Group (COG) and the Pediatric Oncology Group before initiation of the COG grant in 2003 is available online at http://www.childrensoncoogygroup.org/admin/grantinfo.htm.

Authors' disclosures of potential conflicts of interest and author contributions are found at the end of this article.

AUTHORS' DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

The authors indicated no potential conflicts of interest.

AUTHOR CONTRIBUTIONS

Conception and design: Elizabeth J. Perlman, Paul E. Grundy, Jeffrey S. Dome, Vicki Huff

Financial support: Elizabeth J. Perlman, Daniel M. Green

Administrative support: Elizabeth J. Perlman, Jeffrey S. Dome

Provision of study materials or patients: Jeffrey S. Dome, Daniel M. Green

Collection and assembly of data: Elizabeth J. Perlman, Paul E. Grundy, James R. Anderson, Lawrence J. Jennings, Robert C. Shamberger, E. Cristy Ruteshouser, Vicki Huff

Data analysis and interpretation: Elizabeth J. Perlman, James R. Anderson, Jeffrey S. Dome, Robert C. Shamberger, Vicki Huff

Manuscript writing: Elizabeth J. Perlman, Paul E. Grundy, James R. Anderson, Lawrence J. Jennings, Daniel M. Green, Jeffrey S. Dome, Robert C. Shamberger, Vicki Huff

Final approval of manuscript: Elizabeth J. Perlman, Paul E. Grundy, James R. Anderson, Lawrence J. Jennings, Daniel M. Green, Jeffrey S. Dome, Robert C. Shamberger, E. Cristy Ruteshouser, Vicki Huff

REFERENCES

  • 1.Green DM, Breslow NE, Beckwith JB, et al. Treatment with nephrectomy only for small, stage I/favorable histology Wilms' tumor: A report from the National Wilms Tumor Study Group. J Clin Oncol. 2001;19:3719–3724. doi: 10.1200/JCO.2001.19.17.3719. [DOI] [PubMed] [Google Scholar]
  • 2.Shamberger RC, Anderson J, Breslow N, et al. Long term outcomes of infants with very low risk Wilms tumor treated with surgery alone on National Wilms Tumor Study-5. Ann Surg. 2010;251:555–558. doi: 10.1097/SLA.0b013e3181c0e5d7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sredni S, Gadd S, Huang CC, et al. Subsets of very low risk Wilms tumors show distinctive gene expression, histologic, and clinical features. Clin Cancer Res. 2009;15:6800–6809. doi: 10.1158/1078-0432.CCR-09-0312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Huff V. Wilms tumor genetics. Am J Med Genet. 1998;79:260–267. doi: 10.1002/(sici)1096-8628(19981002)79:4<260::aid-ajmg6>3.0.co;2-q. [DOI] [PubMed] [Google Scholar]
  • 5.Gessler M, Konig A, Arden K, et al. Infrequent mutation of the WT1 gene in 77 Wilms' Tumors. Hum Mutat. 1994;3:212–222. doi: 10.1002/humu.1380030307. [DOI] [PubMed] [Google Scholar]
  • 6.Varanasi R, Bardeesy N, Ghahremani M, et al. Fine structure analysis of the WT1 gene in sporadic Wilms tumors. Proc Natl Acad Sci U S A. 1994;91:3554–3558. doi: 10.1073/pnas.91.9.3554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ruteshouser EC, Hendrickson BW, Colella S, et al. Genome-wide loss of heterozygosity analysis of WT1-wild-type and WT1-mutant Wilms tumors. Genes Chromosomes Cancer. 2005;43:172–180. doi: 10.1002/gcc.20169. [DOI] [PubMed] [Google Scholar]
  • 8.Grundy PE, Breslow NE, Li S, et al. Loss of heterozygosity for chromosomes 1p and 16q is an adverse prognostic factor in favorable-histology Wilms tumor: A report from the National Wilms Tumor Study Group. J Clin Oncol. 2005;23:7312–7321. doi: 10.1200/JCO.2005.01.2799. [DOI] [PubMed] [Google Scholar]
  • 9.Natrajan R, Little SE, Sodha N, et al. Analysis by array CGH of genomic changes associated with the progression or relapse of Wilms' tumour. J Pathol. 2007;211:52–59. doi: 10.1002/path.2087. [DOI] [PubMed] [Google Scholar]
  • 10.Ruteshouser EC, Robinson SM, Huff V. Wilms tumor genetics: Mutations in WT1, WTX, and CTNNB1 account for only about one-third of tumors. Genes Chromosomes Cancer. 2008;47:461–470. doi: 10.1002/gcc.20553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Getman ME, Houseal TW, Miller GA, et al. Comparative genomic hybridization and its application to Wilms' tumorigenesis. Cytogenet Cell Genet. 1998;82:284–290. doi: 10.1159/000015120. [DOI] [PubMed] [Google Scholar]
  • 12.Steenman M, Redeker B, de Meulemeester M, et al. Comparative genomic hybridization analysis of Wilms tumors. Cytogenet Cell Genet. 1997;77:296–303. doi: 10.1159/000134602. [DOI] [PubMed] [Google Scholar]
  • 13.Maiti S, Alam R, Amos CI, et al. Frequent association of beta-catenin and WT1 mutations in Wilms tumors. Cancer Res. 2000;60:6288–6292. [PubMed] [Google Scholar]
  • 14.Li CM, Kim CE, Margolin AA, et al. CTNNB1 mutations and overexpression of Wnt/beta-catenin target genes in WT1-mutant Wilms' tumors. Am J Pathol. 2004;165:1943–1953. doi: 10.1016/s0002-9440(10)63246-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fukuzawa R, Heathcott RW, Sano M, et al. Myogenesis in Wilms' tumors is associated with mutations of the WT1 gene and activation of Bcl-2 and the Wnt signaling pathway. Pediatr Dev Pathol. 2004;7:125–137. doi: 10.1007/s10024-003-3023-8. [DOI] [PubMed] [Google Scholar]
  • 16.Green DM, Jaffe N. The role of chemotherapy in the treatment of Wilms tumor. Cancer. 1979;44:52–57. doi: 10.1002/1097-0142(197907)44:1<52::aid-cncr2820440110>3.0.co;2-i. [DOI] [PubMed] [Google Scholar]
  • 17.Green DM, Breslow NE, Beckwith JB, et al. Treatment outcomes in patients less than 2 years of age with small, stage I, favorable-histology Wilms tumors: A report from the National Wilms Tumor Study. J Clin Oncol. 1993;11:91–95. doi: 10.1200/JCO.1993.11.1.91. [DOI] [PubMed] [Google Scholar]
  • 18.Folgueira MA, Carraro DM, Brentani H, et al. Gene expression profile associated with response to doxorubicin-based therapy in breast cancer. Clin Cancer Res. 2005;11:7434–7443. doi: 10.1158/1078-0432.CCR-04-0548. [DOI] [PubMed] [Google Scholar]
  • 19.Breslow NE, Norris R, Norkool PA, et al. Characteristics and outcomes of children with the Wilms tumor-Aniridia syndrome: A report from the National Wilms Tumor Study Group. J Clin Oncol. 2003;21:4579–4585. doi: 10.1200/JCO.2003.06.096. [DOI] [PubMed] [Google Scholar]
  • 20.Dao DD, Schroeder WT, Chao LY, et al. Genetic mechanisms of tumor-specific loss of 11p DNA sequences in Wilms tumor. Am J Hum Genet. 1987;41:202–217. [PMC free article] [PubMed] [Google Scholar]
  • 21.Fukuzawa R, Breslow NE, Morison IM, et al. Epigenetic differences between Wilms' tumours in white and east-Asian children. Lancet. 2004;363:446–451. doi: 10.1016/S0140-6736(04)15491-3. [DOI] [PubMed] [Google Scholar]
  • 22.Bjornsson HT, Brown LJ, Fallin MD, et al. Epigenetic specificity of loss of imprinting of the IGF2 gene in Wilms tumors. J Natl Cancer Inst. 2007;99:1270–1273. doi: 10.1093/jnci/djm069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Grundy PE, Telzerow PE, Breslow N, et al. Loss of heterozygosity for chromosomes 16q and 1p in Wilms' tumors predicts an adverse outcome. Cancer Res. 1994;54:2331–2333. [PubMed] [Google Scholar]
  • 24.Pritchard-Jones K, Kelsey A, Vujanic G, et al. Older age is an adverse prognostic factor in stage I, favorable histology Wilms' tumor treated with vincristine monochemotherapy: A study by the United Kingdom Children's Cancer Study Group, Wilm's Tumor Working Group. J Clin Oncol. 2003;21:3269–3275. doi: 10.1200/JCO.2003.01.062. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Oncology are provided here courtesy of American Society of Clinical Oncology

RESOURCES