Genetic Changes of Wnt Pathway Genes are Common Events in Metaplastic Carcinomas of the Breast

Abstract

Purpose

Metaplastic carcinomas are distinct invasive breast carcinomas with aberrant non-glandular differentiation, which may be spindle, squamous, or chondroid. The limited effective treatments result from the lack of knowledge of its molecular etiology. Given the role of the Wnt pathway in cell fate and in the development of breast cancer, we hypothesized that defects in this pathway may contribute to the development of metaplastic carcinomas.

Design

In 36 primary metaplastic carcinomas we comprehensively determined the prevalence of and mechanism underlying β-catenin and Wnt pathway deregulation using immunohistochemistry (IHC) for β-catenin expression and localization, and mutational analysis for CTNNB1 (encoding β-catenin), APC, WISP3, AXIN1, and AXIN2 genes. By IHC, normal β-catenin was seen as membrane staining, and it was aberrant when > 5% of tumor cells had nuclear or cytoplasmic accumulation or reduced membrane staining.

Results

By IHC aberrant β-catenin was present in 33 of 36 (92%) cases, revealing deregulation of the Wnt pathway. CTNNB1 missense mutations were detected in 7 of 27 (25.9 %) tumors available for mutation analyses. All mutations affected the NH2-terminal domain of β-catenin, presumably rendering the mutant protein resistant to degradation. Two of 27 tumors (7.4 %) had mutations of APC, and 5 (18.5 %) carried a frame shift mutation of WISP3. No AXIN1 or AXIN2 mutations were found.

Conclusions

Activation of the Wnt signaling pathway is common in this specific subtype of breast carcinoma. The discovery of CTNNB1, APC, and WISP3 mutations may result in new treatments for patients with metaplastic carcinomas of the breast.

Introduction

Metaplastic mammary carcinomas are a histologically heterogeneous and unique group of tumors defined by the presence of a glandular and a non-glandular component (1–3). The non-glandular component results most of the times from mesenchymal differentiation, including cells with spindle, osseous, or cartilaginous features. Metaplastic carcinomas are almost invariably negative for hormone receptors, and do not exhibit HER-2/neu over expression. Despite advances in the molecular mechanisms that underlie the development of invasive carcinomas of the breast, the molecular events leading to metaplastic carcinomas remain unknown. As a consequence, there are currently no effective chemotherapeutic treatment options for patients with metaplastic carcinomas, and with the exception of the rare low grade pure spindle cell carcinoma, these tumors have a guarded prognosis.

The Wnt signaling pathway has long been implicated in mammary gland development and carcinogenesis. Activation of the Wnt pathway in breast cells results in cell fate determination and in an epithelial to mesenchymal transition leading to invasion and metastasis. β-catenin is a critical regulatory gene of the Wnt signaling pathway. When the Wnt signaling pathway is activated, β-catenin translocates from the membrane and accumulates in the nucleus where it interacts with members of the LEF/TCF family of transcriptional activators as a critical intermediate in signal transduction pathways. Serine and threonine phosphorylation regulate its stability, targeting it to degradation through an APC-mediated proteosomal pathway (4). A body of data support a role for β-catenin as an oncogene whose deregulation or mutational activation can lead to cancer (5).

Unlike colorectal carcinoma, hepatocellular carcinoma, and other tumors that have a high frequency of mutations of the β-catenin, APC, and other critical Wnt pathway genes, mutations are very rare to non-existent in breast cancer (6).

In an effort to begin to understand the molecular pathogenesis of this special type of breast cancer we hypothesized that defects in the Wnt signaling pathway genes and proteins are responsible for altered differentiation program characteristic of metaplastic carcinomas of the breast. For this, we collected 36 primary metaplastic carcinomas and carried out a comprehensive molecular analysis of several genes encoding proteins known to function in the Wnt signaling pathway. We found that β-catenin protein is aberrantly expressed in nearly all metaplastic carcinomas. β-catenin deregulation was attributable in a group of cases to mutation of the CTNNB1 gene itself and less frequently to inactivating mutations in the APC gene, or the Wnt-1 induced secreted protein 3 gene (WISP3). Our findings provide the first evidence for Wnt pathway defects in metaplastic carcinomas of the breast, and pave the way to explore urgently needed therapeutic interventions for patients with this unique and aggressive form of breast cancer.

Materials and Methods

Tumor samples

A total of 36 metaplastic carcinomas were analyzed. All slides were obtained with IRB approval from the Surgical Pathology files at the University of Michigan. Hematoxylin and Eosin (H&E) stained slides of formalin fixed, paraffin-embedded tumors were analyzed by light microscopy independently and blindly by two pathologists (MJH and CGK), and a median of 5 slides were reviewed for each case. All metaplastic carcinomas were classified according to published accepted criteria used in clinical practice (2, 3). They were classified by the architectural pattern and the presence of epithelial and or heterologous elements. The metaplastic carcinomas were graded on the basis of the sarcomatoid component as grade 1 (low), grade 2 (intermediate), or grade 3 (high) following described criteria (7). In all cases, the diagnosis of metaplastic carcinoma was confirmed by positive cytokeratin staining including a cytokeratin cocktail (AE1/AE3, CAM5.2) and/or a high molecular weight cytokeratin stain (34βE12). Clinical and pathological features including tumor stage (I–IV), tumor size, lymph node metastasis, and distant metastasis were available for the cases.

DNA Preparation

Twenty seven metaplastic carcinomas had blocks available for mutation analyses. Primary tumor tissues were manually microdissected prior to nucleic acid extraction to ensure that each tumor sample contained at least 70% tumor cells by an experienced pathologist in the study (DT). Several areas of the tumors were microdissected. H&E stained sections of all tumor tissues were used as dissection guides. Each area of interest (e.g. glandular, spindle, cartilaginous, squamous, osseous) was identified by two pathologists (CGK and MJH) and one to two-1 mm diameter punches of these areas were obtained from the corresponding FFPE block. Genomic DNA was isolated following the manufacturers using commercially available Nucleon® DNA extraction and purification kit (Amersham Life sciences, Chalfont, UK).

Polymerase Chain Reaction and Sequencing

The PCR primers, amplicon size, and annealing temperatures used for each reaction are specified in Table 1. CTNNB1 exon 3 was amplified from genomic tumor DNA using a forward primer located at the 5′ portion of the exon and the reverse primer at the 3′ end of the exon. Several tumor samples with known CTNNB1 mutations (a kind gift of Drs. Cho and Fearon, University of Michigan) were amplified and sequenced in parallel as positive controls. PCR for APC exon 15 was performed using genomic DNA as previously described (8). AXIN1 and AXIN2 mutations were investigated as described by Webster et al. (9) and Wu et al (10). PCR for WISP3 was performed on exon 4 encoding a domain associated with cell attachment as described by Thorstensen et al (11). All PCR reactions were carried out in a final volume of 50μl using Platinum PCR supermix (Invitrogen, Carlsbad, Ca) and 200 nM primers. After an initial denaturation and Taq DNA polymerase activation at 95°C for 10 min, templates were amplified for 35 cycles (94°C, 1 minute, annealing temperature for 1 minute, followed by chain extension at 72°C for 2 minutes), followed by a 10 min extension at 72°C. PCR products were visualized on 2% agarose gels and purified using a Wizard SV PCR clean-up kit (Promega, Madison, WI). Amplicons were sequenced directly in both directions within the University of Michigan Medical Center DNA sequencing core using an ABI 377 DNA sequencer (ABI, Foster City, CA). Chromatograms were downloaded directly to CodonCode Aligner software (v1.6.3, Dedham, MA) and the sequence compared to reference sequence downloaded from NCBI. All presumptive mutations were re-amplified and re-sequenced from the original tumor DNA.

Table 1.

Primer sequences and annealing temperatures for PCR

Gene	Ref. Seq	Exon	Function	Forward Primer	Reverse Primer	Annealing Temperature °C
WISP3	NM_003880	4	Cell attachment domain.	GATAGAGTGATAAATTAGACCATCGGCT	CATTGGTCACCCTGTTAGATATTCC	55
CTNNB1	NM_001904	3	GSK3b regulatory domain	ATGGAACCAGACAGAAAAGCGGC	GCTACTTGTTCTTGAGTGAAG	58
APC	NM_000038	15a	b-Catenin regulatory domain	CAGACTTATTGTGTAGAAGA	CTCCTGAAGAAAATTCAACA	52
APC		15b	b-Catenin regulatory domain	AGGGTTCTAGTTTATCTTCA	TCTGCTTGGTGGCATGGTTT	52
APC		15c	b-Catenin regulatory domain	GGCATTATAAGCCCCAGTGA	TGGCTCATCGAGGCTCAGAG	52
APC		15d	b-Catenin regulatory domain	ACTCCAGATGGATTTTCTTG	GGCTGGCTTTTTTGCTTTAC	52
AXIN1	NM_003502	2a	APC binding	CGTCATCGTGAGTCTTGTCT	TCAGCCCACTTCAAGTATGG	55
AXIN1		2b	APC binding	AAGGTGAGACTTCGACGG	ATAGTGGCCTGGATTTCGGT	55
AXIN1		2c	APC binding	AACAATGGCATCGTGTCCCG	TGTCTCCAGGAGCAGCTTCT	55
AXIN1		2d	APC binding	CCTGCCGACCTTAAATGAAG	GGACATCCGGTGTGGGTTAA	55
AXIN1		3	GSK3b binding	ACAGGTGGAGATGTTGGTC	ACACATTGCTGTCCTCAAGG	55
AXIN1		4	GSK3b binding	ATCACCTGTGTGCACGTGT	ACTGGCCACTTGCAGATG	55
AXIN1		5	GSK3b binding	AGCACACGCTTTCCCTTCA	CCCATGAAGAAGCATCAGGAC	55
AXIN1		6a	b-Catenin binding	TGGGTCAGGCCTGATGCTTTT	ACTGGCATCTTGGCCACGT	55
AXIN1		6b	b-Catenin binding	AGCATCCTGGACGAGCACGT	TGCAGAAGGCCAGAACCT	55
AXIN2	NM_004655	7	DSH Binding	CAAAGCACAAAAAAGGCCTAC	GATTCCTGTCCCTCTGCTGAC	60

Immunohistochemical Analysis of β-catenin

Immunohistochemical analyses were carried out at the University of Michigan Histology and Immunohistochemistry Core. Five μm sections of formalin-fixed, paraffin-embedded tissues were mounted on plus slides, de-paraffinized in xylene, and then rehydrated into distilled H₂0 through graded alcohols. Antigen retrieval was enhanced by microwaving the slides in citrate buffer (pH 6.0; Biogenex, San Ramon, CA) for 10 min. Endogenous peroxidase activity was quenched by incubation with 6% hydrogen peroxide in methanol, and then the sections were post-fixed in 10% buffered formalin, washed, and blocked with 1.5% normal horse serum for 1 h. Sections were then incubated with a mouse monoclonal anti-β-catenin antibody (cat# 610154; BD Biosciences, San Jose, CA) at a dilution of 1:400 for 30 min at 4°C. Slides were washed in PBS and then incubated with a biotinylated horse anti-mouse secondary antibody for 30 min at room temperature. Antigen-antibody complexes were detected with the avidin-biotin peroxidase method using 3,3′-diaminobenzidine as a chromogenic substrate (Vectastain ABC kit; Vector Laboratories, Burlingame, CA). Immunostained sections were lightly counterstained with hematoxylin and then examined by light microscopy. Immunostaining was assessed following previously published methods (10) as normal when β-catenin was seen as crisp membrane staining, or aberrant when greater than 5% of tumor cells had nuclear or cytoplasmic accumulation, or reduced or absent membrane staining.

Results

Histopathologic and Clinical features

All patients were female, with a median age of 60 years old (range 33–89 years old). Of the 36 metaplastic carcinomas, 28 tumors had spindle and/or squamous areas, 6 had chondroid differentiation, and 2 had osseous differentiation (Figure 1). Table 2 summarizes the clinical and histological features of the metaplastic carcinomas. Of the cases with available staging information, 4 tumors were stage I, 12 stage II (9 IIA, and 3 IIB), 1 stage III, and 5 stage IV. When present, distant metastases were seen in the lung parenchyma, pleura, brain, and vertebrae. Of the 36 metaplastic carcinomas, none had histological grade 1, 11 (30.6 %) had grade 2, 22 (61.1 %) were grade 3, and in three we were unable to assess the histological grade. The grade 2 spindle cell metaplastic carcinomas were characterized by elongated cells with minimal to moderate cytologic atypia and rare or no mitoses. In contrast, the grade 3 spindle cell carcinomas exhibited pleomorphism, hyperchromasia, increased cellularity, and numerous atypical mitoses. The neoplastic cells in both grades 2 and 3 spindle cell carcinomas infiltrated adjacent mammary and adipose tissue and were interrupted by dense collagen bands. One of the metaplastic carcinomas with squamous cell differentiation also demonstrated spindle cell metaplasia; the other consisted entirely of squamous elements. Those tumors with chondroid and osseous differentiation exhibited the range of cytologic and architectural features seen in chondrosarcomas and osteosarcomas. These included cartilage and bone formation and a range of cytologic atypia, cellularity, and mitotic activity.

Figure 1. Immunohistochemical staining of β-catenin in metaplastic carcinomas of the breast, and representative mutations on CTNNB1, APC, and WISP3 genes.

A, metaplastic carcinoma with glandular and spindle cell differentiation; B, same tumor showing accumulation of β-catenin in a region of the tumor with spindle cell differentiation (arrow). Note the membrane associated β-catenin immunoreactivity in the epithelial component; C, metaplastic carcinoma with chondroid differentiation; D, this tumor shows prominent nuclear and cytoplasmic immunoreactivity for β-catenin in the vast majority of neoplastic cells; E, metaplastic carcinoma with glandular elements and highly atypical spindle cells; F, note the membranous expression β-catenin protein in the glandular elements (bottom right) in stark contrast to the nearly absent β-catenin expression in the malignant spindle cells; G, metaplastic carcinoma with squamous differentiation; H, this tumor shows membrane-associated localization of β-catenin immunoreactivity without detectable nuclear immunoreactivity; I, representative examples of CTNNB1, WISP3, and APC gene mutations found in these tumors. For the APC mutation, the G to A results in a stop codon. All pictures are 400x magnification.

Table 2.

Summary of clinical and pathological information of the patients with Metaplastic carcinoma

Parameter	Value
No. of patients	36
Median age, years (range)	60 (36–87)
Pathological Stage, n (%)
I/II	16 (44.4)
III/IV	6 (16.7)
Unknown	14 (38.9)
Median Tumor size (cm, range)	3.5 (0.5–10.5)
Lymph nodes, n (%)
Negative	16 (44.4)
Positive	10 (27.8 )
Unknown	10 (27.8)
Site of distant metastasis (n)
Lung and pleura	3
Vertebrae	1
Brain	1
Predominant metaplastic component, n (%)
Spindle	12 (33.3)
Squamous	16 (44.4)
Chondroid	6 (16.7)
Osseous	2 (5.6)
Histological Grade
1	0
2	11 (30.6 %)
3	22 (61.1 %)
β-catenin
Normal	3 (8.3)
Aberrant	33 (91.7)

Aberrant localization of β-Catenin in Primary Metaplastic Carcinomas of the Breast

Aberrant β-catenin protein expression was found in 33 of 36 (91.7%) metaplastic carcinomas (Tables 2 and 3, and Figure 1). The remaining 3 (8.3%) tumors had normal β-catenin protein expression characterized by crisp membrane staining. Primary tumors with aberrant nuclear and cytoplasmic accumulation of β-catenin frequently showed reduced or absent membrane staining. Similar to previously noted results in tissues and cell lines (10), aberrant β-catenin accumulation was typically noted in many, but not all, neoplastic cells within a given tumor.

Table 3.

Summary of β-catenin immunodetection and sequence analysis of Wnt pathway genes in Metaplastic carcinomas of the breast

			β-catenin IH (a)			CTNNB1 mutation			APC mutation			WISP3 mutation			Histologic component harboring the mutation
Case	Age	Grade	N	C	M	Nucleotide	Amino acid	Codon	Nucleotide	Amino acid	Codon	Nucleotide	Amino acid	Codon
1	46	2	pos	pos	neg				A-T	K-Stop	1317	del G	Frameshift	1141	spindle (APC) and glandular (WISP3)
2	52	2	neg	pos	neg
3	70	3	pos	pos	neg	TCT-TGT	Ser-Cys	33							spindle
4	67	2	pos	neg	neg	TCT-TAT	Ser-Tyr	37	A-T	K-Stop	1317				spindle (APC) and glandular (CTNNB1 )
5	71	2	pos	pos	neg
6	58	3	pos	pos	neg	ACA-AGA	Thr-Arg	42							glandular
7	87	2	pos	pos	neg	TCT-TGT	Ser-Cys	33							spindle
8	48	3	pos	pos	neg
9	50	3	pos	pos	neg
10	71	3	pos	pos	neg							del G	Frameshift	1141	squamous and glandular
11	40	3	pos	pos	weak
12	58	3	neg	neg	weak	ACA-AGA	Thr-Arg	42							glandular
13	33	3	neg	neg	weak
14	72	3	neg	neg	pos
15	35	3	neg	pos	pos
16	50	3	pos	pos	weak
17	50	3	pos	pos	pos
18	42	3	neg	pos	pos							del G	Frameshift	1141	chondroid
19	60	3	neg	neg	weak							del G	Frameshift	1141	glandular
20	67	3	neg	pos	weak
21	36	2	pos	pos	neg
22	48	2	neg	pos	red
23	40	3	pos	pos	weak
24	75	3	neg	pos	neg
25	89	2	neg	yes	weak	TCT-TGT	Ser-Cys	33				del G	Frameshift	1141	squamous
26	NA	3	neg	neg	neg	TCT-ACT	Ser-Thr	33
27	54	3	pos	neg	neg

CTNNB1, APC, AXIN1, AXIN2, and WISP3 Mutational Analyses

Table 3 shows in detail the sequence analysis of Wnt pathway genes in the 27 cases of metaplastic carcinoma with available tissue. Somatic missense mutations in CTNNB1 sequences encoding the NH2 –terminal portion of β-catenin were identified in 7 of 27 (25.9%) tumors available for mutation analyses. CTNNB1 mutations affected serine or immediately adjacent residues in the presumptive GSK3β regulatory motif at the β-catenin NH₂ terminus. Three mutations were found at codon 33 (TCT-TGT: Ser - Cys, two cases; and TCT-ACT: Ser - Thr, 1 case). We found one mutation at codon 37 (TCT-TAT: Ser - Tyr), and in one case at codon 42 (ACA-AGA: Thr - Arg) (Table 3 and Figure 1). CTNNB1 mutations were more frequent in the mesenchymal cells when compared to the epithelial cells. Of the seven metaplastic carcinomas with CTNNB1 mutations, 3 had mutations only in the spindle cell component, one in the osteosarcomatous component, and one in a glandular component.

Two metaplastic carcinomas had mutations within exon 15 at codon 1317 of the APC gene. This area, located at the C-terminal portion of the APC gene is responsible for CTNNB1 regulation (8) (12). Both mutations found resulted in the conversion of an arginine residue to a stop codon (A to T: Lysine to stop, Figure 1), which leads to a truncated protein without CTNNB1 regulatory activity. These two APC mutations were found in the mesenchymal appearing, spindle cell areas of the tumors.

Identical frame shift mutations of the Wnt-1 induced secreted protein 3 (WISP3) gene were found in 5 of 27 (18.5%) metaplastic carcinomas. All mutations led to a deletion of a guanine at codon 1141 resulting in a truncated protein known to cause human disease (13, 14). In contrast to CTNNB1 and APC mutations, which were more common in the mesenchymal components of the metaplastic carcinomas, WISP3 mutations were more frequent in the epithelial cells. Thus, one metaplastic carcinoma (Table 3, Case 10) harbored two WISP3 mutations in both squamous and glandular areas. The remaining four tumors had mutations in the glandular (2 cases), squamous (1 case), and chondroid areas (1 case). No AXIN1 or AXIN2 gene mutations were found in our study. Supplementary Table 1 shows the mutations found when different tumor areas were analyzed.

Discussion

Hyperactivation of the canonical Wnt/β-catenin pathway, caused by mutations insuch components as β-catenin and APC, is one of the most frequent signaling abnormalities in several human cancers including colorectal carcinomas (15), melanomas (16), hepatoblastomas (17), medulloblastomas (18), prostatic carcinomas (19), uterine and ovarian endometrioid adenocarcinomas (10, 20–22). In breast cancer, however, evidence of comparable mutations is surprisingly lacking (23). In contrast, there is strong evidence, based on immunohistochemical analyses, that the Wnt/β-catenin pathway is activated (23–25). Importantly, aberrant β-catenin expression in breast cancer is associated with poor clinical outcome (23–26). Metaplastic carcinomas have never been analyzed for Wnt pathway gene mutations.

Because breast carcinoma arises from glandular epithelium, it usually exhibits the features of an adenocarcinoma. However, in some cases, part or all of the neoplastic cells differentiate into a nonglandular growth pattern by a process termed metaplasia, which signifies the change of one cell type into another. This characterizes the special type of breast carcinoma termed metaplastic carcinoma. We hypothesized that the phenotypic changes of metaplastic carcinomas in the breast are likely the result of alterations of genes involved in cell fate and differentiation.

The Wnt gene family plays roles in the development of the mammary gland and in breast cancer (23, 27). The consequences of Wnt signaling are often concerned with cell fate determination in several organs, including the mammary gland. Interestingly, in animals whose endogenous β-catenin gene was mutated, the predominant effect in the mammary gland was squamous metaplasia, suggesting that high levels of β-catenin can result in a switch form alveolar to epidermal cell types (28). Furthermore, Wnt pathway activation has been shown to play a central role in the process of epithelial to mesenchymal transition (EMT) during development and in breast cancer, whereby glandular epithelial cells undergo a genotypic and phenotypic switch from an epithelial cell to an elongated spindle cell (29, 30). In cancer, there is strong evidence showing that the dynamic process of EMT is important in tumor invasion and metastasis (31–33).

We have pursued our studies on the investigation of the relevance and mechanism of deregulation of Wnt signaling pathway components in 36 histologically verified primary metaplastic carcinomas of the breast. This is, in fact, a substantial number of primary tumors of this particular histological subtype of breast cancer, because only 1–5% of breast cancers are metaplastic (3, 34). Evidence of Wnt pathway activation was found in nearly all the primary metaplastic carcinomas. Forty-one percent of the metaplastic carcinomas carried mutations on genes critical in the canonical Wnt pathway, with 3 tumors containing mutations in two different genes. We identified CTNNB1 exon 3 mutations in 26% of tumors. Mutations inactivating the APC gene and truncating mutations of the WISP3 gene were observed in 7.4% and in 18.6% of metaplastic carcinomas, respectively. This is the first study to identify mutations of the CTNNB1, APC, and WISP3 genes in primary breast carcinomas. Our data provide mechanistic evidence for the observed deregulation and accumulation of β-catenin in this specific subtype of breast cancer.

A number of studies have shown that mutations of the CTNNB1 and APC genes lead to increased levels of β-catenin and promote tumor development (15). Significantly less is know about WISP3. WISP3 is a secreted cysteine rich protein that belongs to the CCN family of growth factors that mediate epithelial and stromal cross-talks (35–40). WISP3 is also named CCN6. Our laboratory as well as other investigators have demonstrated that deregulation of this protein family can lead to cancer (41–43). Specifically, our group has previously found that WISP3 is down-regulated in the most lethal form of locally advanced breast cancer, inflammatory breast cancer (IBC) and in a group of high stage non-IBC tumors (44). WISP3 inhibits tumor cell motility and invasion in vitro and inhibits tumor growth in vivo (42, 45–47). WISP3 mutations have been found in progressive pseudorheumatoid dysplasia (13, 14) and in colorectal carcinomas (11). The presence of WISP3 mutations in metaplastic carcinomas of the breast is intriguing in light of our previous data showing that stable small interfering RNA knockdown of WISP3 messenger RNA and protein in human mammary epithelial cells (HMEs) causes an EMT and triggers motility and invasion with marked inhibition of E-cadherin (47). The effects of WISP3 inhibition on β-catenin expression and function warrant further investigation.

To date, mammary fibromatosis is the only breast tumor in which CTNNB1 and APC mutations are common pathogenetic events (48, 49). These are rare benign tumors with the capacity for local infiltration and recurrence after surgical excision. Abraham et al (49) found CTNNB1 and APC mutations in 79% of mammary fibromatosis studied. Interestingly, despite the epithelial nature of metaplastic carcinomas and the mesenchymal origin of fibromatosis, they share some histological features. They both contain elongated tumor cells that form sweeping and interlacing fascicles and infiltrate the adjacent breast parenchyma. This observation together with the crucial role of the Wnt pathway in cell differentiation and in the process of epithelial to mesenchymal transition suggest that mutations of CTNNB1 and APC genes may contribute to the specific phenotypic spindle cell morphology and pattern of tissue infiltration which characterizes these tumors.

We found that 3 metaplastic carcinomas containing CTNNB1 (2 cases) and WISP3 mutations (1 case) had no nuclear or cytoplasmic accumulation of β-catenin protein, but rather a decrease in its membrane expression. Even though detection of β-catenin protein in the nucleus and/or cytoplasm is a hallmark of active Wnt signaling (10), reduced or absent membranous β-catenin has also been implicated in Wnt pathway deregulation (26). This idea is further supported by several studies showing that decreased β-catenin membrane expression is associated with poor prognostic factors in breast cancer (26, 52).

In the present study, mutations of CTNNB1, APC, and WISP3 genes were identified in 41% of metaplastic carcinomas whereas aberrant β-catenin protein was detected in nearly all the metaplastic carcinomas analyzed. There are several potential explanations for these results. It is possible that the stabilization of β-catenin results from deregulation of other signaling pathways that can regulate β-catenin such as those activated by loss of PTEN, activation of the EGFR family, and by p53 function, which have been shown to be altered in breast cancer (4, 27). Another possible explanation for the aberrant β-catenin protein expression in the absence of identified mutations of CTNNB1, APC, and WISP3 genes is that there may be mutations in other portions of these genes that result in proteins with yet undescribed functions, or mutations of other components of the Wnt signaling pathway including Wnt receptors.

In summary, we have shown that β-catenin deregulation is a common feature of metaplastic carcinomas of the breast, and discovered that in 41% of cases the mechanisms for deregulating β-catenin include specific mutations of CTNNB1 gene itself and mutational inactivation of APC or WISP3 genes. Up to date, this is the only type of breast cancer with frequent Wnt pathway gene mutations. Furthermore, our data provide a mechanistic explanation for the aberrant non-glandular differentiation characteristic of metaplastic carcinomas and identifies a pathway that may be the basis of targeted treatment for this form of breast cancer.