In Vivo and In Vitro Aging Is Detrimental to Mouse Spermatogonial Stem Cell Function

Abstract

The development of techniques to maintain the spermatogonial stem cell (SSC) in vivo and in vitro for extended periods essentially allows for the indefinite continuation of an individual germline. Recent evidence indicates that the aging of male reproductive function is due to failure of the SSC niche. SSCs are routinely cultured for 6 mo, and no apparent effect of culture over this period has been observed. To determine the effects of SSC aging, we utilized an in vitro culture system, followed by quantitative transplantation experiments. After culture for 6 mo, SSCs that had been aged in vivo for 1500 days had a slower proliferation rate than SSCs that were aged in vivo to 8 or 300 days. Examination of methylation patterns revealed no apparent difference in DNA methylation between SSCs that were aged 8, 300, or 1500 days before culture. Long-term culture periods resulted in a loss of stem cell potential without an obvious change in the visual appearance of the culture. DNA microarray analysis of in vivo- and in vitro-aged SSCs identified the differential expression of several genes important for SSC function, including B-cell CLL/lymphoma 6, member B (Bcl6b), Lim homeobox protein 1 (Lhx1), and thymus cell antigen 1, theta (Thy1). Collectively, these data indicate that, although both in vitro and in vivo aging are detrimental to SSC function, in vitro aging results in greater loss of function, potentially due to a decrease in core SSC self-renewal gene expression and an increase in germ cell differentiation gene expression.

In vivo and in vitro aging of spermatogonial stem cells (SSC) results in decreased SSC function due to differential expression of genes involved in the self-renewal vs. differentiation fate decisions.

INTRODUCTION

Spermatogonial stem cells (SSCs) serve as the foundation of spermatogenesis by both committing to differentiate into functional sperm as well as replicating themselves in a process of self-renewal. SSCs reside within the SSC niche deep within the seminiferous epithelium of the testis, and allow males to produce sperm their entire lives. Should self-renewal of the SSC fail, production of sperm by the testis will ultimately cease. Additionally, should errors in SSC differentiation occur, the production of functional sperm may also be hindered. As the average age of reproductively active human populations has increased, considerable concern has been placed on the effect of aging on the human gamete. Aged populations of human males produce decreased levels of testosterone [1] and fewer motile sperm in ejaculates [2]. Evidence also indicates that at least one genetic disorder, Apert syndrome, is due to a mutation of the paternal germline [3]. The SSC self-renewal mechanisms in mice and rats are tightly controlled and regulated by Sertoli cells present in the SSC niche. Specifically, the Sertoli cells secrete growth factors, such as Glial cell line-derived neurotrophic factor GDNF, which support SSC self-renewal [4–6]. Recently, age of SSCs and the niches in which they reside were examined. In vivo retransplantation experiments suggest that infertility in old male mice results from the failure of the SSC niche, and that SSC self-renewal is capable of continuing normally for several years past the normal life span of the animal [7].

Recently, techniques for the long-term in vitro maintenance of SSCs [6, 8, 9], as well as for cryopreservation [10], have been developed. The utility of these techniques are many fold, and provide for the preservation of an individual male's germline. Preservation may be necessary for a variety of reasons, including species continuity, perpetuation of valuable livestock, or recovery of the germline following chemotherapy in humans. Currently reported culture techniques indicate that the SSC can be maintained indefinitely in vitro; however, these reports only evaluated SSC function for several months to 2 yr [6, 11]. Additionally, the SSCs used were isolated from very young pup donors.

Because of the dynamics of human reproduction and the potential utilization of in vitro culture techniques to maintain human SSCs in vitro indefinitely, it is important to examine the effects of extreme age and extensive long-term culture on SSC function. Because of the lack of culture and efficient quantitative transplantation systems for human SSCs, we evaluated the effects of age on mouse SSCs. The objective of the current work was to evaluate the effects of long-term culture (6 mo and greater) and extreme SSC age (1500 days and greater) on the parameters of SSC function using a variety of analyses, including, SSC transplantation, methylation analysis, and oligonucleotide microarray analysis.

MATERIALS AND METHODS

Donor Mice and SSC Isolation

Donor testis cells were isolated from mice that express the green fluorescent protein (GFP) transgene under the control of the chicken β-actin promoter/cytomegalovirus enhancer (stock no. 003291; The Jackson Laboratory). Germ cells were isolated from 8-day-old and 10-mo-old donors using magnetic-activated cell sorting (MACS) isolation of THY1-positive cells, as previously described [12, 13]. The third treatment group consisted of approximately 1500-day-old SSCs that were isolated from the 10th recipient of a serial transplantation (ST) experiment in which SSCs generally were serially transplanted approximately every 3 mo into young testes. The final recipients were killed approximately 10 and 15 mo after transplantation (Fig. 1). These data were previously reported [7], and indicate that the infertility in old males resulted primarily from a failure of the SSC niche. Because of the limited number of SSCs in these recipient animals, THY1 MACS isolation could not be preformed. To isolate SSCs from the 10-mo-old serially transplanted donors, GFP-positive colonies were dissected from the donor testes. These seminiferous tubules with GFP colonies were digested with trypsin EDTA or subjected to a two-step enzymatic digestion, as previously described [14, 15], in order to isolate testis cells. All materials, unless otherwise stated, were purchased from Sigma. The Animal Care and Use Committee of the University of Pennsylvania approved all experimental procedures in accordance with The Guide for Care and Use of Laboratory Animals of the National Academy of Sciences.

FIG. 1.

Timeline for the development of SSC cultures utilized to evaluate the effects of aging on SSC function. A) Timeline for ST-aged culture 1. B) Timeline for ST-aged culture 2. C) Timeline for aged cultures. D) Timeline for young cultures. Timelines are not to scale. “Tp” indicates transplant number during the ST experiment; “X” indicates time points when reported methylation samples were acquired; “#” indicates time points at which samples were acquired for microarray analysis. d, day; m, month.

SSC Culture

Culture of isolated germ cells was conducted as previously described [12]. Because the germ cells for the third experiment group (1500 day old) were not MACS selected for culture, special care had to be taken to ensure that somatic cells did not overgrow the germ cells. Initially, the cultures were subcultured using standard enzymatic protocols; however, to prevent somatic cell overgrowth in later subcultures, germ cells, which do not tightly adhere to the underlying feeder layer, were removed using gentle pipetting, which removed the germ cells from the feeder while leaving the testis somatic cells adhered [16]. After somatic contamination was eliminated (within 3 wk of culture establishment), all 1500-day-old donor germ cell cultures were subcultured the same as other treatments using enzymatic methods and evaluated for GFP weekly, as previously described [12]. Germ cell samples were also periodically obtained using gentle pipetting to remove the germ cells from the feeder cells for future DNA methylation and oligonucleotide microarray analysis, or by enzymatic digestion for transplantation analyses [15].

SSC Transplantation

Germ cells were transplanted at specific times during the experiment to evaluate the number of SSCs and their proliferation rates within the cultures, as previously described [15]. Analysis of donor cell colonization of recipient testes and SSC quantification by counting the number of fluorescent colonies were performed using fluorescence microscopy (Fig. 2). Transplantation of SSCs into W mice that are congenitally infertile and lack endogenous spermatogenesis did not generate offspring, likely because of inadequate donor cell-derived spermatogenesis. Therefore, to generate donor-derived offspring for DNA methylation analysis, intracytoplasmic sperm injection (ICSI) was performed using sperm from the donor-derived colonies, as previously described [17]. The equation utilized to determine colonies per 10⁵ cells cultured for all transplantation experiments is as follows:

FIG. 2.

Effects of donor age on SSC fold change in culture after 6 mo in culture. A) Photomicrograph of GFP colonies in a recipient testis transplanted with ST-aged SSCs. Bar = 100 μm. B) Average fold change after 6 mo of culture in SSC cultures established from young, aged, and ST-aged SSCs. Points with different letters are significantly (P < 0.05) different at 42 days. Error bars indicate SEM; n = 2–3 per point.

SSC Methylation Analysis

DNA was extracted from all samples with phenol-chloroform, as previously described [18]. Bisulfite mutagenesis of DNA was carried out in agarose beads, as previously described [18, 19]. Methylation analyses evaluated the methylation of H19/Igf2 and Meg3/Dlk1 as indicators for genes that are known to be regulated by DNA methylation. H19/Igf2 and Meg3/Dlk1 were chosen because their methylation occurs during germ cell maturation, and they rapidly loose methylation if physiologic insults occur.

Methylation analysis was done using a combined bisulfite restriction analysis (COBRA) assay. A 423-bp region of the sodium bisulfite-converted H19 imprinting control region (ICR) (GenBank accession no. U19619) was amplified using nested PCR, as previously described [20]. First-round PCRs contained 2 μl of bisulfite-mutagenized DNA, 0.5 μM of each primer, GE pure-Taq ready-to-go PCR beads in a final volume of 25 μl; 1 μl of amplified product was used for a second-round PCR following the same conditions. First-round primers: BMsp2t1 5′GAGTATTTAGGAGGTATAAGAATT3′ and BHha1t3 5′ATCAAAAACTAACATAAACCCCT3′. Second-round primers: Bmsp2t2c 5′GTAAGGAGATTATGTTTATTTTTGG3′ and BHha1t4ct 5′CTAACCTCATAAAACCCATAACTAT3′. Both rounds of PCR were performed in the following conditions: denature at 94°C for 2 min; 40 cycles of denature at 94°C for 30 sec, anneal at 55°C for 30 sec, extend at 72°C for 1 min, with a ramping time between denaturing and annealing steps at 0.5°C/sec. Amplified product (3 μl) was cut with HinfI, which will cut only nonconverted (methylated) sequence to produce 200- and 210-bp fragments. The resulting products were analyzed on a 1% agarose gel.

A 483-bp region of sodium bisulfite-converted IG-DMR (GenBank accession no. AJ320506.1) was amplified using nested PCR, as previously described [21]. First-round PCRs contained 2 μl of bisulfite-mutagenized DNA, 0.5 μM of each primer, GE pure-Taq ready-to-go PCR beads in a final volume of 25 μl. Amplified product (1 μl) was used for a second-round PCR following the same conditions. First-round primers: IGDMRF1 5′TTAAGGTATTTTTTATTGATAAAATAATGTAGTTT3′ and IGDMRR1 5′CCTACTCTATAATACCCTATATAATTATACCAT AA3′. Second-round primers: IGMDR2FG 5′TTAGGAGTTAAGGAAAAGAAAGAAA TAGTATAGT3′ and IGDMR2RG 5′TATACACAAAAATATATCTATATAACACCATACAA3′. Both rounds of PCR were performed in the following conditions: five cycles of denature at 94°C for 1 min, anneal at 50°C for 2 min, extend at 72°C for 3 min; 30 cycles of denture at 94°C for 30 sec, anneal at 50°C for 2 min, extend at 72°C for 1.5 min. Amplified product (3 μl) was cut with HinfI, which will cut only nonconverted (methylated) sequences to produce 62-, 231-, and 190-bp fragments.

A determination of the purity of isolated germ cells for the methylation analysis was required due to the use of somatic feeder cells within the culture system. Feeder cells utilized in these experiments contained the NEO gene used for plasmid selection during the production of the initial cell line. The presence of the NEO gene in the feeder cells and its absence in germ cells allowed us to determine, with standard curves, the concentration of germ cell DNA in any DNA isolated from a germ cell culture using quantitative real time RT-PCR. Only samples that contained fewer than 4% NEO contamination were used for methylation analysis.

Oligonucleotide Microarray Processing and Analysis

Cells were isolated from cultures using gentle pipetting, frozen in Trizol, and submitted to the Penn Microarray Facility (University of Pennsylvania School of Medicine) for RNA extraction and transcript profiling. Microarray analysis was conducted in duplicate for the ST-aged and in triplicate for the aged and young treatment groups, respectively. RNA was extracted with Trizol and purified using the Qiagen RNeasy kit; total RNA yields ranged from 7 to 16 μg per sample with A260/280 of 2.08–2.17. RNA integrity was determined on an Agilent Bioanalyzer RNA Nano Labchip, and RIN values ranged from 9.7 to 10.0. Transcript profiling was conducted as described in the Affymetrix GeneChip Expression Analysis Technical Manual (www.affymetrix.com; Affymetrix Inc., Santa Clara, CA). Briefly, 100 ng of total RNA was converted to first-strand cDNA using reverse transcriptase primed by poly(T) and random oligomers that incorporated the T7 promoter sequence. Second-strand cDNA synthesis was followed by in vitro transcription with T7 RNA polymerase for linear amplification of each transcript, and the resulting cRNA was converted to cDNA, fragmented, assessed by Bioanalyzer, and biotinylated by terminal transferase end labeling. Labeled cDNA was added to Affymetrix hybridization cocktails, heated at 99°C for 5 min, and hybridized for 16 h at 45°C to Mouse Gene 1.0ST Arrays (Affymetrix Inc.). The microarrays were then washed at low (6× SSPE) and high (100 mM MES, 0.1 M NaCl) stringency, and stained with streptavidin-phycoerythrin. Fluorescence was amplified by adding biotinylated anti-streptavidin and an additional aliquot of streptavidin-phycoerythrin stain. A confocal scanner was used to collect fluorescence signal after excitation at 570 nm.

Affymetrix Command Console was used to quantify hybridization to probes. Affymetrix probe level data (.cel files) were imported into Partek Genomics Suite (v6.4; Partek Inc., St. Louis, MO), where RMA was applied to normalize and summarize the probe-level data to yield log2-transformed signal intensities for each probe set (transcript).

In order to generate lists of genes that were significantly different between treatment groups, the transformed data were analyzed by applying a one-way ANOVA across the conditions, along with pair-wise contrasts. The P values resulting from the ANOVA and each of the contrasts were corrected for false discovery rate using the Benjamini-Hochberg step-up method as implemented in Partek. For each of the contrasts, fold change was also calculated.

Quantitative Real-Time RT-PCR

Quantitative real-time PCR was utilized to validate the microarray data. After RNA isolation, samples were reverse transcribed using oligodT priming and SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA). Primer sequences for Bcl6b and Lhx1 were previously reported [12]. Stra8 primers were F (5′CCACCTGTGGCAGACTCTCT3′) and R (5′TCCTCTGGATTTTCTGAGTTGCA3′). Neo primers were F (5′ TGAATGAACTGCAGGACGAG 3′) and R (5′ AGTGACAACGTCGAGCACAG 3′). Expression levels of specific genes were assayed using SYBR green (Applied Biosystems, Foster City, CA) and an ABI 7500 sequence detection system (Applied Biosystems). Relative gene expression was determined by normalizing gene-of-interest expression levels to that of Rps2 using the formula:

Statistical Analysis

All experiments were run in at least duplicate or triplicate using independently established cell cultures. For determination of differences between colony numbers, ANOVA was performed using SPSS 15 (SPSS, Chicago, IL). Univariate ANOVA was conducted when comparing data sets, and if data sets contained multiple points, differences were determined using the LSD post hoc test. A t-test was used to determine significance for culture SSC concentration. All data are presented as the mean ± SEM, as numeric values or error bars. Differences were considered to be significant when P ≤ 0.05.

RESULTS

Influence of In Vivo Aging on SSC Function and DNA Methylation Pattern

To determine the influence of SSC age at the time of culture initiation on SSC function, SSCs were isolated from 8-day-old pups, 10-mo-old adults, and 10-mo-old adults that were the final recipients of an SSC ST experiment [7], and cultured for 6–8 mo. The results of the ST experiment indicate that, when SSCs were consecutively transplanted at 3-mo intervals into young males, the SSCs were able to produce continued spermatogenesis for more than 3 yr. Isolation of SSCs from these individual treatment groups resulted in SSC cultures that were initiated when the SSCs were 8 (“young”; n = 3), 300 (“aged”; n = 3), and ∼1500 (“ST-aged”; n = 2) days of age. After 6 mo of culture, individual SSC cultures were assayed for SSC content over a 2-mo period using the SSC transplantation technique. The SSC transplantation technique is the only definitive way to evaluate the SSC content of any cell population, especially with SSC culture systems, due to the presence of differentiating daughter cells within each culture. Because of variation in the percentage of SSCs in individual cultures, the data were evaluated based on fold change from the initial transplant point (6 mo after culture was initiated). Furthermore, evaluation of fold change from the initial transplantation point allowed us to evaluate the proliferation of SSCs within the culture dish, regardless of any effect of population drift (the ratio of SSC to differentiating daughter cells) in the culture. After 42 days in culture, all three donor groups had an increase in SSCs (Fig. 2) and total cells (Supplemental Table S1; all Supplemental Data are available at www.biolreprod.org) within the culture. However, even after 14 days, there was an apparent difference in the rate of SSC proliferation between the three donor ages, with the ST-aged donor cells having a considerably lower proliferation rate (young = 15.16-fold increase; aged = 9.68-fold increase; ST-aged = 3.47-fold increase). This pattern was continued over the entire 42-day period, such that the young and aged donors exhibited a significantly higher number of SSCs compared with the ST-aged donors (young = 539.92-fold increase; aged = 553.24-fold increase; ST-aged = 66.70-fold increase). Although both SSC and total germ cell expansion rates were slower in the ST-aged culture compared with the aged and young cultures, examination of the ratio of proliferation rates between SSCs and total cells in the ST-aged, aged, and young cultures indicate that, in the ST-aged culture, SSC proliferation was faster than total cell proliferation, whereas, in the aged and young cultures, total cell proliferation was faster than SSC proliferation (Supplemental Table S1). However, the SSC concentration in the ST-aged cultures, expressed as colonies per 10⁵ cells injected, was not significantly different than in the aged and young cultures, respectively (ST-aged = 100.89 ± 11.36; aged = 71.98 ± 8.33; young 74.57 ± 15.21). Collectively, these data indicate that the in vivo ST-aged SSCs have a diminished capacity for SSC proliferation after in vitro culture.

To identify possible deficiencies of the aged stem cells, we analyzed DNA methylation of various samples from the different cultures. Specific samples were chosen for evaluation based on the purity of isolation, determined using the PCR-based NEO analysis. As a representation of DNA methylation of the euchromatic compartment of the genome, we assessed DNA methylation at ICRs, because the parental-specific DNA methylation in these regions is known to be susceptible to environmental stress resulting from various perturbations, such as embryo culture [18, 22]. Differential methylation of ICRs, which regulate the imprinting of genes in cis, is established during gametogenesis and maintained throughout embyrogenesis. We analyzed the H19 ICR and the IG-DMR, which are regions that are methylated in the male germline (Fig. 3). Using a COBRA assay, we were able to determine the methylation status of these regions. We first subjected DNA to bisulfite mutagenesis, which converts unmethylated cytosines to thymines, while methylated cytosines are protected from this conversion. This process allows the maintenance of restriction sites that are unique to methylated sequences. By PCR amplification of the sodium bisulfite-mutagenized DNA and subsequent digestion with restriction enzymes unique to the methylated sequence, we were able to observe the methylation status of these paternally methylated ICRs. The experimental samples were compared to control adult liver and somatic pup tissue. In order to evaluate effects of donor age on methylation, we compared young, ST-aged, and aged donor cultures after 11, 16, and 11 mo in culture, respectively. This analysis confirmed ∼50% methylation of H19/Igf2 and Meg3/Dlk1 ICRs, corresponding to the paternal allele, in somatic tissues (adult liver and pup tissue; Fig. 3, C and D, lanes 1 and 2), as well as full methylation of these sites in the male germline. No difference in methylation pattern was observed between young, ST-aged, and aged donor cultures (Fig. 3, C and D, lanes 7–9).

FIG. 3.

Maintenance of DNA methylation at imprinted loci H19/Igf2 and Meg3/Dlk1in somatic and germ line cells. Maternal and paternal alleles of the H19/Igf2 (A) and Meg3/Dlk1 (B) loci are illustrated with their corresponding ICRs, denoted as ICR and IG-DMR, respectively. The ICRs are designated as methylated (closed circle) or unmethylated (open circle). Primer binding sites are indicated with a short line below the locus. Bisulfite-mutagenized DNA was digested with Hinf1 and resolved on an agarose gel, yielding fragments of 200 and 210 bp for the H19 ICR (C) and 62, 190, and 231 bp for IG-DMR (D) if the DNA was methylated. Unmethylated DNA appears undigested, and no abnormal DNA methylation was observed. Lane 1, adult liver; lane 2, control Day 0 pup somatic tissue; lane 3, ICSI-derived Day 0 pup from donor sperm from SSCs that was cultured for 7 mo prior to transplantation and maintained in the recipient mouse for 6 mo before sperm isolation; lane 4, young (Y) donor cultured for 5.5 mo; lane 5, young (Y) donor cultured for 11 mo; lane 6, young (Y) donor cultured for 13 mo; lane 7, young (Y) donor cultured for 11 mo; lane 8, ST-aged (ST-A) donor cultured for 16 mo; lane 9, aged (A) donor cultured for 11 mo.

Influence of In Vitro Aging on SSC Function and DNA Methylation Pattern

To determine the influence of culture period on SSC function, SSCs were isolated from young 8-day-old pups and cultured for 14–18 mo. After short-term (7–10 wk) and long-term (14–18 mo) culture, individual SSC cultures (n = 3) were assayed for SSC content using the SSC transplantation technique. The same cultures were evaluated at both the short- and long-term time points. After short-term culture, cultures were able to generate 47.9 (±5.8 SEM) donor colonies per 10⁵ cells transplanted into recipient mice. In contrast, after long-term culture, these same donor cultures generated significantly fewer (4.2 ± 4.2 [SEM]) donor colonies per 10⁵ cells transplanted into recipient mice (Fig. 4).

FIG. 4.

Effects of long-term culture on SSC function. Average number of colonies formed per 10⁵ cells injected from young 8-day-old donor cells that had been cultured for 7–10 wk or 14–18 mo. Error bars represent SEM. Difference between 7–10 wk and 14–18 mo cultures was significantly different (P < 0.05).

To identify possible deficiencies of the cultured stem cells, we analyzed DNA methylation of samples from the cultures described above. In order to evaluate effects of donor age on methylation, we compared young 8-day-old donor cultures that had been maintained for 5.5, 11, and 13 mo (Fig. 3, lanes 4, 5, and 6 respectively). No difference in DNA methylation patterns of the H19/Igf2 and Meg3/Dlk1 ICRs were observed between young cultures that had been maintained for 5.5, 11, or 13 mo.

Influence of SSC Aging, Transplantation, and ICSI on DNA Methylation Patterns in Offspring

Although in vitro and in vivo aging of the SSCs did not result in abnormal SSC methylation patterns, we wanted to determine whether the combination of SSC aging followed by transplantation and ICSI might alter DNA methylation patterns in offspring. To answer this question, we generated two pups using ICSI with sperm isolated from W pups that were transplanted with aged donor cells that had been cultured for ∼7 mo, and evaluated their DNA methylation patterns as described above. No difference in methylation patterns of the H19/Igf2 and Meg3/Dlk1 ICRs were observed between a naturally sired control pup (Fig. 3, lane 2) or a pup that was generated by ICSI with sperm from SSCs that was cultured for 7 mo prior to transplantation (in vitro aged) and maintained in the recipient mouse for 6 mo before sperm isolation (in vivo aged) (Fig. 3, lane 3).

Influence of SSC Age and Culture Period on Gene Expression

Transplantation experiments demonstrated that: 1) young donor SSCs cultured for short-term (7–10 wk) had significantly more SSC activity than young donor SSCs cultured for long-term (14–18 mo), and 2) the proliferation rate was decreased in ST-aged donor SSCs compared with young or aged donor SSCs after 6 mo of culture. To determine the effect of SSC aging on gene expression in these groups, we used oligonucleotide microarray analysis of DNA from short-term (7–10 wk) cultured SSCs from young donors, long-term (14–18 mo) cultured SSCs from young donors, and long-term (23–25 mo) cultured SSCs from ST-aged donors that did not generate spermatogenic colonies after SSC transplantation analysis (data not shown). Initially, we evaluated and compared the expression of genes reported to be important for SSC self-renewal, as SSC markers, or for SSC differentiation (Table 1). Few major differences were observed between the two long-term culture groups, regardless of donor SSC age (Table 1, column 3). In contrast, many differences were observed when comparing the long-term culture groups with the short-term culture (Table 1, columns 1 and 2). We observed significant decreases in expression of core SSC self-renewal genes, Bcl6b and Lhx1, in the long-term culture groups compared with the short-term culture. Additionally, there were decreases in the expression of the SSC marker, Thy1, in the long-term culture groups. Interestingly, this loss in SSC gene expression in the long-term culture groups was paired with an increase in expression of genes (Kit and Stra8) that have been demonstrated to be important for SSC differentiation. Expression of Bcl6b, Lhx1, and Stra8 was validated using quantitative RT-PCR (Supplemental Table S2). Thus, based on these data, it appears that in vitro aging of SSCs, regardless of donor age, results in loss of stem cell properties both functionally, based on transplantation experiments, and genetically, based on a decrease in core SSC self-renewal gene expression and an increase in germ cell differentiation gene expression.

TABLE 1.

Expression of genes that have been reported to be important for SSC self-renewal, as SSC markers, or for SSC differentiation.

In addition to expression of genes previously described as being important for SSC function, we also examined the differential expression of genes previously unreported to be expressed by SSCs within our SSC cultures. As observed with the previously identified SSC genes, few large differences were observed between the ST-aged and young donor cultures maintained long term (Supplemental Table S3). In contrast, larger differences were observed when comparing the young short-term culture to the young long-term culture (Table 2), and the ST-aged long-term culture (Supplemental Table S4). Interestingly several common gene expression differences were observed in these two comparisons, including down-regulation of Gzmc, Gzmd, Tex 19.1, and Magea1.

TABLE 2.

Top five significantly (P < 0.05) up- and down-regulated genes expressed in young donor cells cultured for 14–18 months compared to young donor cells cultured for 7–10 weeks.

DISCUSSION

The negative effects of cellular aging have been implicated in various pathologies, including cancer, infertility, and genetic mutations in offspring. The spermatogonial stem cell is the foundation of spermatogenesis, and thus the production of functional sperm in the adult male. Loss of SSC function and genetic stability as a male ages could result in infertility or the production of offspring with genetic mutations. Indeed, it has been postulated that aging of the male results in increased instances of paternally driven disorders.

Little information exists involving the influence of age on the function of the spermatogonial stem cell itself. Male mice begin to have declining levels of fertility between the age of 12 and 24 mo [7]. Recently, it was demonstrated, using an experimental design consisting of the consecutive ST of SSCs into young males every 3 mo, that the decline in fertility between 12 and 24 mo is due to a failure of the SSC niche, and not the SSC [7]. However, this work did not rule out other potential effects of age on the SSC. When SSCs were isolated from 24-mo-old males and transplanted into young recipients, they generated smaller colonies than SSCs isolated from 12-mo-old males, indicating that there may be age-dependent effects on the SSC under some circumstances [45]. The objective of the present study was to utilize a combination of ST and the SSC culture system in order to age SSCs in normal and artificial niches to further characterize SSC aging.

Initially, we evaluated the effect of in vivo aging using a combination of SSC culture and transplantation. The SSC transplantation technique is the only definitive way to evaluate the SSC content of a cell population, especially due to the presence of both SSCs and their differentiating daughters within the SSC culture system. Furthermore, evaluation of fold change from the initial transplantation points allows for evaluation of the proliferation of SSCs within the culture dish, regardless of any population drift (the ratio of SSC to differentiating daughter cells) in the culture. After 6 mo of culture, SSCs that were isolated from 10-mo-old recipients of serial transplanted SSCs (1500 days old; ST-aged) had nearly a 10-fold decrease in proliferation over the 42-day period compared with SSCs that were isolated from 8-day-old (young) donors or 10-mo-old (aged) donors. Furthermore, the ratio of SSCs to non-SSC germ cells was not different between the treatment groups. We next evaluated the influence of in vitro aging on SSC function by comparing the colonization ability of young donor SSCs cultured short-term for 7–10 wk to the same young donor SSC culture long-term for 14–18 mo. We observed a nearly 10-fold decrease in SSC function in the aged cultures. Together, these data indicate that the extreme in vivo aging of the ST-aged SSC (1500 days) and in vitro aging of the young donor SSC had a negative influence on the function of the SSC.

To determine potential underlying causes of the deficiencies of aged SSCs, we evaluated DNA methylation patterns and gene expression in various samples. Genomic imprinting is an epigenetic process resulting in the parental-specific monoallelic expression of a subset of mammalian genes. Parent-of-origin expression depends, at least in part, on DNA methylation marks differentially established during gametogenesis [20]. Methylation analyses evaluated the methylation of H19/Igf2 and Meg3/Dlk1 as indicators for genes that are known to be regulated by DNA methylation. H19/Igf2 and Meg3/Dlk1 were chosen because their methylation occurs during germ cell maturation, and they rapidly lose methylation if physiologic insults occur. Thus, changes in the methylation patterns of H19/Igf2 and Meg3/Dlk1 would likely mirror changes that were occurring on a more global genomic scale. H19/Igf2 and Dlk1/Meg3 are examples of imprinted loci that are paternally methylated, and thus methylated in male germ cells. More specifically, regulation of the imprinted genes H19 (maternally expressed) and Igf2 (paternally expressed) depends on DNA methylation at the ICR located between these genes. The insulator protein, CTCF (CCCTC-binding factor), binds the hypomethylated maternal ICR, insulating Igf2 from shared enhancers downstream of H19, allowing maternal H19 expression. On the paternal allele, hypermethylation at the ICR blocks CTCF binding, allowing paternal Igf2 expression. The genes Dlk1 (paternally expressed) and Meg3 (maternally expressed) are separated by a germline ICR known as the IG-DMR. This region is methylated on the paternal allele, although the precise role that this essential element plays in imprinting of the locus remains unclear [46]. We observed no aberrant methylation patterns in any germline samples evaluated, indicating that the negative effects of in vivo and in vitro aging are not due to a loss of DNA methylation at paternally methylated ICRs. The lack of methylation changes we observed corroborates previous work that indicates that the epigenetic imprint of SSCs is exceptionally stable [11] in mice with a DBA background. Additionally, we also saw no methylation differences at these loci in pups that were generated through ICSI using sperm isolated from W mice transplanted with SSCs from donor SSC cultures. It would be of interest to evaluate the methylation pattern of offspring from the ST-aged SSC population, but, due to the observed deficiencies in the ST-aged SSCs, we were unable to generate offspring. Nevertheless, the methylation pattern of the ST-aged SSCs was not different from other SSC groups; thus, we believe that the inability to generate pups from the ST-aged SSCs was not due to abnormal methylation in the SSC itself.

Examination of gene expression of in vitro- and in vivo-aged SSCs revealed unique patterns that may direct future research to identify underlying causes of age-related loss of function in the SSC. SSCs that were aged in vitro had diminished expression of genes important for SSC self-renewal, such as Bcl6b and Lhx1 [12], and increased expression of genes implicated in SSC differentiation, such as Stra8 [42] and Kit [39]. This indicates that, as an SSC ages, the differentiation vs. self-renewal fate decision may shift from emphasizing self-renewal in a younger SSC to differentiation in the aged SSC, and culture of SSCs may shift the ratio of germ cells toward the differentiating state. However, when evaluated, the percentage of SSCs in the ST-aged cultures was not significantly different (colonies per 10⁵ cells injected: ST-aged = 100.89 ± 11.36; aged = 71.98 ± 8.33; young = 74.57 ± 15.21). This indicates that the observed difference in the shift in gene expression was not simply due to population drift in the cultures toward fewer SSCs, but rather an intrinsic change in the expression of self-renewal vs. differentiation genes within the SSCs themselves. In addition to characterizing expression of known genes, we observed differential expression of several genes that have not been characterized in the SSC. Included in this list are two genes, Tex19.1 and Magea1, which are down-regulated in long-term cultures of young donor SSCs compared with short-term cultures of the same donor cells. Tex19.1 is expressed in pluripotent stem cells and the germline, and has been implicated in the maintenance of stem cell self-renewal [47], whereas Magea1 has been implicated in germ cell tumors [48]. It is possible that both of these genes have additional roles in SSC function. Furthermore, examination of these uniquely expressed genes could be used to differentiate among cultures that are better candidates for stem cell transplantation.

In conclusion, these data demonstrate that both in vivo and in vitro aging negatively influence the function of the spermatogonial stem cell. Loss of SSC function during in vivo aging may play a role in some instances of infertility in the aged male. Additionally, loss of SSC function during in vitro aging is of great importance due to the potential utilization of SSC culture for the preservation and amplification of the male germline for species preservation or during chemotherapy treatments. The underlying causes of this loss of function due to aging are still unclear, but appear to be unrelated to loss of epigenetic stability. A more likely cause is a shift towards increased differentiation rather than self-renewal as the SSC ages. Finally, we have identified several novel genes that may play specific roles in the SSC fate decision and, ultimately, SSC aging. Although human and mouse SSCs share many similarities, the fact that human SSCs cannot be maintained in culture systems identical to the mouse system indicate that some differences in human and mouse SSC function exist. Nevertheless, these data demonstrate age-dependent defects in a mammalian SSC, in addition to previous data implicating aging of the SSC niche in infertility, further emphasizing the necessity of exploring the influence of aging on the male germline as techniques to manipulate the human SSC are further developed.