One-step reverse-transcription loop-mediated isothermal amplification for detection of infectious bursal disease virus

Abstract

A fast, sensitive, and specific reverse-transcription (RT) loop-mediated isothermal amplification (RT-LAMP) assay was developed that involved a single tube and a 1-step reaction for detecting infectious bursal disease virus (IBDV). Four specific primers were used for amplification of the VP2 gene of IBDV. The amplified LAMP products were detected by DNA electrophoresis and by direct observation with the naked eye in the presence of SYBR Green I. The sensitivity of RT-LAMP was determined to be 0.01 fg of IBDV viral RNA. This assay for IBDV is more sensitive than the conventional RT-polymerase chain reaction assay, which has a detection limit of 1 ng. The LAMP assay was also assessed for specificity and was found to precisely discriminate between positive and negative test samples. This newly established LAMP assay, combined with RT, is a practical diagnostic tool because IBDV-infected and uninfected clinical samples collected from an experimental farm could be discriminated. Full verification of a sample’s IBDV status was obtained within 40 min of extraction of the viral RNA, which could then be directly added to the RT-LAMP reaction mixture.

Introduction

Loop-mediated isothermal amplification (LAMP) is a novel method that can rapidly amplify a specific nucleic acid with high specificity under isothermal conditions with the use of 4 to 6 specifically designed primers (1). This amplification occurs by autocycling strand displacement DNA synthesis, which is catalyzed by Bst DNA polymerase. The LAMP reaction process has no denaturation step, which is different from conventional polymerase chain reaction (PCR), and DNA amplification occurs by means of the strand displacement activity of the Bst DNA polymerase (1,2). So far, the LAMP method has been applied to the detection of various microbes and pathogens in environmental, food, and clinical samples, including protozoa, bacteria, and viruses (3–10). Moreover, several uses of LAMP for pathogen detection have been commercialized into LAMP kits (11). When detecting the RNA genome of a pathogen such as an RNA virus, LAMP has been merged with reverse transcription (RT) into RT-LAMP to allow nucleic acid amplification (12). For example, for medical purposes, RT-LAMP has been used in minimal residual disease (MRD) monitoring of the WT1 mRNA expression level (13).

Infectious bursal disease virus (IBDV) is an important veterinary pathogen that infects young chickens. It belongs to the genus Birnavirus of the family Birnaviridae and contains 2 segments of double-stranded RNA genome, designated A and B (14). Epidemiologic studies have shown that almost all 2- to 8-week-old chicks are susceptible to IBDV infection. The virus infects the lymphoid cells in the bursa of Fabricius. Young chickens show various clinical signs of infection, including whitish and watery diarrhea, anorexia, depression, trembling, ruffled feathers, and severe prostration (15). Generally speaking, the mortality rate ranges from 1% to 50% across various outbreaks. In broilers, infection may result in up to 50% morbidity, but the mortality rate is seldom greater than 3% in flocks aged 3 to 6 wk. In addition to death, IBDV also often causes immunosuppression due to destruction of lymphoid tissue. This makes the birds more susceptible to other pathogens, which can result in various secondary infections (15).

There are several conventional methods that can be used to diagnose IBDV infection, including agar gel precipitation (AGP), virus neutralization (VN), enzyme-linked immunosorbent assay (ELISA), dot blot hybridization assay, indirect immunofluorescence (IIF), and electron microscopy (16–21). In addition, RT-PCR, real-time RT-PCR, and RT-PCR with analysis of the PCR product by restriction endonuclease or restriction fragment length polymorphism have been commonly used as molecular diagnostic methods of detecting IBDV (22–26). Among these methods, RT-PCR is the most convenient, because it allows the testing of a large number of samples. However, the traditional RT-PCR method requires a relatively well-equipped laboratory with well-trained staff and involves multiple reaction steps in order to amplify the nucleic acid. Furthermore, the sensitivity of the method can be affected by the fact that template RNA is limited. Therefore, there is a need for an alternative assay that is more efficient, has greater sensitivity and specificity, and will be more economical when used for the diagnosis of IBDV infection.

Recently, the use of RT-LAMP for detection of the IBDV RNA genome has been reported (27). Moloney murine leukemia virus reverse transcriptase (M-MLV RTase) and Bst DNA polymerase were used in a 2-stage reaction that needed at least 70 min. This process was not very efficient and involved tedious processing. None the less, it had a sensitivity limit of 4.78 fg, which is about 100 times better than RT-PCR detection of IBDV.

This article describes an improved RT-LAMP assay method to detect the IBDV genome. The approach is characterized by high sensitivity, high specificity, and a very rapid procedure and is catalyzed by avian myeloblastosis virus (AMV) RTase and Bst DNA polymerase; the reaction involves a single step in a single tube. This newly established RT-LAMP should be a very valuable and applicable tool for the detection of IBDV infection.

Materials and methods

RNA extraction

Total viral RNA genomes were extracted from 100 μL of homogenized bursa tissue infected with IBDV P3009 with use of the Axyprep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, Union City, California, USA) according to the manufacturer’s protocol. The RNA was eluted from the column in a final volume of 50 μL of elution buffer and stored at −20°C until required. In addition, 21 clinical samples, 6 infected with IBDV and 15 uninfected, were obtained from an experimental broiler farm; RNA extraction was done in the same way.

Primer design

Four specific RT-LAMP primers (F3, B3, FIP, and BIP) for IBDV detection were designed according to the sequence of the VP2 gene of IBDV P3009 (GenBank accession no. AF109154) with the use of Primer Explorer V3 software (Eiken Chemical, Tokyo, Japan) (10). The sequences of the primers are shown in Table I.

Table I.

Oligonucleotide primers used for a 1-step reverse-transcription loop-mediated isothermal amplification assay developed to amplify the VP2 gene^a of Infectious bursal disease virus

Name	Type	Length	Genome position	Sequence (5′→3′)
F3	Forward outer	20-mer	999–1018	AGCAGTGACAATCCATGGTG
B3	Reverse outer	18-mer	1169–1186	TCATGGCTCCTGGGTCAA
FIP	Forward inner (F1c-TTTT-F2)	45-mer (F1C, 22-mer; F2, 19-mer)	F1C, 1075–1096; F2, 1035–1053	CGACCGTAACGACGGATCCTGTT; TTTCCTCCGTCCCGTCACACTA
BIP	Reverse inner (B1C-TTTT-B2)	44-mer (B1C, 20-mer; B2, 19-mer)	B1C, 1097–1116; B2, 1148–1166	CCGGGGTGAGCAACTTCGAGTTTT; CGGCCGTATTCTGTAACCA

^aGenBank accession no. AF109154.

Reaction conditions

The RT-LAMP reaction was carried out in a total volume of 25 μL at 60°C for 40 min. The reaction mixture contained 12.5 μL of 2× LAMP reaction buffer (10), 8 U of Bst DNA polymerase (New England Biolabs, Frankfurt, Germany), 10 U of AMV RTase (Invitrogen), 10 μM of each of the F3 and B3 primers, 10 μM of each of the FIP and BIP primers, 10 μM of 2 M betaine, and 2 μL of the viral RNA.

Detection of the RT-LAMP product

The RT-LAMP product was detected by DNA electrophoresis or SYBR Green I staining according to a protocol described previously (10).

Assay sensitivity and specificity

The sensitivity of the LAMP assay was evaluated with the use of different amounts of viral RNA extracted from bursa tissue. The specificity of the assay for IBDV detection was tested by comparing the results for IBDV RNA with those for the VP2 complementary DNA (cDNA) of chicken anemia virus (CAV) and the H6 gene of the avian influenza virus (AIV) H6N1. These 2 additional virus templates had been previously created in our laboratory.

Polymerase chain reaction for IBDV detection

Reverse-transcription PCR was performed in 1 tube containing RTase and Taq DNA polymerase. The RT-PCR reaction was carried out in a total volume of 25 μL. The reaction mixture contained 1× ThermoPol Reaction Buffer (New England BioLabs), 0.4 mM of deoxynucleotide triphosphates, 5 pmol each of the F3 and B3 primers, 4 U of Taq DNA polymerase (New England BioLabs), 25 U of Reverse-iT RTase Blend (Abgene, Thermo Fisher Scientific, Cambridge, England), and 5 μL of RNA template; the mixture was made up to 25 μL with diethylpyrocarbonate-treated water. The RT-PCR conditions were as described elsewhere (28).

Western blot analysis

Bursa samples containing IBDV VP2 protein were resolved on polyacrylamide slab gels and then were Western-blotted with the use of polyclonal antibodies against VP2 (28). Membranes were incubated with alkaline phosphatase chromogen (5-bromo-4-chloro-3-indolyl phosphate and nitroblue tetrazolium chloride) for color development.

Results

Specific detection of the IBDV genome

With use of the 4 LAMP primers and the IBDV VP2 cDNA as a template, the LAMP reaction was performed in a single tube. As illustrated in Figure 1A, a typical LAMP pattern with visually distinct DNA ladder-like fragments was observed by DNA 1.6% agarose gel electrophoresis. With use of the VP2 gene of CAV and the H6 gene of AIV, no LAMP products were generated (Figure 1A). The LAMP products were also detected by SYBR Green I staining: Figure 1B shows strong fluorescence under ultraviolet excitation for IBDV and only slight background fluorescence for the negative controls. These results suggest that this newly established LAMP assay with specifically designed primers is highly specific and convenient for detecting the IBDV complementary genome.

Figure 1.

Specificity of the loop-mediated isothermal amplification (LAMP) assay for detecting infectious bursal disease virus (IBDV). The templates were IBDV VP2 complementary DNA (cDNA), the VP2 gene of chicken anemia virus (CAV), and the H6 gene of avian influenza virus (AIV) H6N1. Only for IBDV were LAMP products visualized with (A) 1.6% agarose gel electrophoresis and (B) staining with SYBR Green I and ultraviolet excitation. Lane C — negative control.

Sensitive detection of the IBDV genome

Having established that the LAMP assay could be used to detect the IBDV complementary genome, it was necessary to establish whether this approach could be expanded to detect the double-stranded RNA viral genome of IBDV. To do this, RT was required to form cDNA from the viral RNA genome before the LAMP assay was performed. As illustrated in lane 3 of Figure 2A, the combined RT-LAMP reaction, performed in a single tube in 1 step, resulted in a typical LAMP pattern with DNA agarose gel electrophoresis when viral RNA extracted from IBDV-infected bursa tissue was added to the RT-LAMP reaction. In this case, the negative sample (mock infection) gave no LAMP product. Moreover, IBDV-RT-LAMP did not amplify the RNA extracted from bursa tissue not infected with IBDV (lane 2 of Figure 2A) or the RNA extracted from liver tissue infected with CAV or AIV (not shown). In terms of the amplification limit, when the RT-LAMP was performed with a 10-fold dilution series of viral RNA from 1 ng to 0.001 fg, the IBDV viral RNA could be detected from 1 ng to 0.01 fg; indicating that the RT-LAMP sensitivity is proximally at 0.01 fg of viral RNA (Figure 2B, upper panel). However, there was no product that was detected after DNA electrophoresis when < 1 ng of IBDV viral RNA was added in the RT-PCR assay (Figure 2B, lower panel).

Figure 2.

Sensitivity of the reverse transcription (RT)-LAMP assay for detecting IBDV in bursa tissue from chickens. A — The RT-LAMP primers were used with genomic RNA for the diagnosis of IBDV infection in a 1-step RT-LAMP reaction. Lane M — 100 base pair DNA ladder marker; lane 1 — RT-LAMP reaction mixture containing no template; lane 2 — RT-LAMP reaction mixture containing no reverse transcriptase; lane 3 — extracted IBDV viral RNA added to the RT-LAMP reaction; lane 4 — IBDV VP2 cDNA added to the RT-LAMP reaction. B — The RT-LAMP assay and RT-polymerase chain reaction (PCR) were performed after the addition of various amounts of viral RNA. Upper panel — RT-LAMP pattern; lower panel — RT-PCR pattern. Lanes 1 to 10 — 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 0.1 fg, 0.01 fg, and 0.001 fg of IBDV total RNA, respectively. Lane NC — negative control.

Application of the RT-LAMP as a diagnostic technique

Figure 3 shows the results of using the 1-step RT-LAMP to evaluate 21 clinical bursa specimens from broiler chickens, 6 infected and 15 not infected with IBDV. All 6 of the infected samples were positive, and all 15 of the uninfected samples were negative by RT-LAMP. These results completely agreed with those of conventional Western blotting.

Figure 3.

Results of assays to detect IBDV RNA in bursa tissue from 21 broiler chickens (6 infected with IBDV and 15 not infected), for which 1 ng of extracted viral genomic RNA was used for each RT-LAMP and RT-PCR assay. The RNA patterns were analyzed with the use of agarose electrophoresis gel. The samples were also analyzed by Western blotting (WB) with the use of antibody against the IBDV VP2 protein. Lane NC — negative control for the RT-LAMP and RT-PCR assays.

Discussion

In this work, a 1-step RT-LAMP method for detecting the IBDV RNA genome was developed. The 1-step approach involves combining the LAMP method with the use of AMV RTase, which enables specific detection of IBDV infection in broiler chickens with the optimized condition of 60°C and a reaction time as short as 40 min. The assay can be performed with the use of avian RTase and Bst DNA polymerase at the same time in a water bath tank under isothermal conditions. The initial RT reaction uses AMV RTase rather than M-MLV RTase because of the former enzyme’s broad range of reaction temperatures (42°C to 60°C), which allows the reaction to be carried out with AMV RTase and Bst DNA polymerase at the same time. The simplicity of this approach, together with its speed, will allow this assay to be applied to the detection of IBDV during infection screening or routine evaluation of vaccination efficacy. Since the temperature chosen was 60°C, there is no need for preheating, as in conventional RT-PCR. Overall, RT-LAMP is easier to carry out and saves time compared with RT-PCR.

The RT-LAMP product had the characteristic ladder-like pattern with gel electrophoresis. This is specific because the reaction produces a mixture of stem-loop structured DNA products of various lengths. The sensitivity of 1-step RT-LAMP was established as 0.01 fg of viral RNA with the use of specifically designed RT-LAMP primers. This contrasts with the much poorer sensitivity with RT-PCR of at least 1 ng of viral RNA. Thus, the sensitivity of the RT-LAMP assay for IBDV detection is about 10⁸ times greater than that of the RT-PCR assay. With the molecular weight of the IBDV genome being 4.7 MDa (29), this means that the detection limits for the RT-LAMP and RT-PCR assays are approximately 1 and 10⁸ copies of the IBDV genome, respectively. In addition, there was complete agreement of the RT-LAMP results with the Western blot assay results, which indicates that the 1-step RT-LAMP method is both highly sensitive and accurate.

Conventional RT-PCR is currently the “gold standard” method for IBDV detection, but the need for both the thermocycling system and an elaborate method of detecting the product after amplification is a disadvantage. Product detection using the RT-LAMP method is easier than that with RT-PCR and can be done by either using a fluorescence staining reagent such as SYBR Green I, as was done in this study, or by just observing the turbidity (11). Therefore, a well-equipped laboratory, well-trained staff, and multiple reaction steps are not needed, which makes the RT-LAMP assay more suitable to large-scale field investigations.

Xu et al (27) also used an RT-LAMP method to detect IBDV. Their method required 1.5 h and a 2-step heating process for detection of the virus. Compared with this earlier study, the sensitivity of our assay is 100 times greater, as well as being much faster and a 1-step process. The primers used by Xu et al targeted the VP3 gene of IBDV, whereas our assay targets the VP2 gene. In addition, in order to optimize the primers, we focused on low free energy criteria. We suggest that the low free energy of the primers used in our assay allowed us to achieve greater sensitivity.

In conclusion, the IBDV diagnostic method using 1-step RT-LAMP described here has the potential to become a valuable diagnostic system and could be made into a simple-to-use diagnostic kit. This is the first report to demonstrate the application of an improved and 1-step RT-LAMP assay in the field diagnosis of IBDV. In the future, the RT-LAMP assay for IBDV detection could be developed into a portable minilaboratory system for the on-site detection of IBDV infection among farm-bred young chickens.