Skip to main content
Journal of Cachexia, Sarcopenia and Muscle logoLink to Journal of Cachexia, Sarcopenia and Muscle
. 2011 Feb 24;2(1):57–62. doi: 10.1007/s13539-011-0018-6

Sirtuin 1 in skeletal muscle of cachectic tumour-bearing rats: a role in impaired regeneration?

Míriam Toledo 1, Sílvia Busquets 1,2,✉, Elisabet Ametller 1, Francisco J López-Soriano 1,2, Josep M Argilés 1,2
PMCID: PMC3063873  PMID: 21475674

Abstract

Background:

In advanced malignant disease, cachexia and muscle wasting appear to be among the most common manifestations. This phenomenon is partially related with a decreased muscle regeneration capacity, as previously described in our laboratory.

Methods and results:

Rats bearing the Yoshida AH-130 ascites hepatoma were used in the experiments. The animals experienced a marked weight loss with decreases in skeletal muscle weights (13% gastrocnemius, 18% extensor digitorum longus, and 12% tibialis muscles). Muscle gene expression was measured using real-time polymerase chain reaction. Skeletal muscle from cachectic tumour-bearing rats is associated with a decreased expression of genes involved in regeneration such as Pax-7 (39%), myogenin (24%), and MyoD (17%). mRNA levels of Sirt1 increased (91%) in cachectic skeletal muscle. The Sirt1 gene has been shown to be associated with changes in muscle myoblast differentiation. Treatment of the tumour-bearing animals with formoterol—a beta2-agonist—normalizes the expression of genes involved in regeneration (i.e., increase of Pax7 (139%)), at the same time as it does with that of Sirt1 (42% decrease).

Conclusions:

It is suggested that the lack of muscle regeneration observed during muscle wasting in tumour-bearing animals is linked to the action of Sirt-1, possibly via PGC-1α. These factors may constitute possible targets of pharmacological treatment against muscle loss, thus potentially contributing to the understanding and mitigation of muscle atrophy associated with disease.

Keywords: Cachexia, Sirt1, Muscle wasting, PGC1-alpha

Introduction

In advanced malignant diseases, cachexia appears to be one of the most common systemic manifestations. The presence of cachexia always implies a poor prognosis, having a great impact on the patients' quality of life and survival [1]. Several important molecular mechanisms have been shown to be involved in the increased muscle catabolism observed in cancer-induced cachexia, such as greater ubiquitin–proteasome-dependent proteolysis, apoptosis, and activation of uncoupling proteins [2–5]. Interaction of these mechanisms leads to muscle mass loss by promoting protein and DNA breakdown and energy inefficiency.

The sirtuin family of proteins possesses NAD+-dependent deacetylase activity and/or ADP ribosyltransferase activity. The seven mammalian sirtuins (Sirt1–7) are localized differentially within the cell and have a variety of functions [6]. Sirt1 is the most extensively studied member of the family and regulates diverse biological processes ranging from cell proliferation, differentiation, apoptosis, and metabolism [7]. Sirt3—a sirtuin present in the mitochondria [8] which seems to be able to control thermogenesis—has been linked to longevity in men, and aberrant expression of this sirtuin correlates with node-positive breast cancer in clinical biopsies from women [9], suggesting that Sirt3 serves as an important diagnostic and therapeutic target in human health/aging and disease, affecting men and women in unique ways. Both Sirt1 and 3 seem to be regulated both by diet [10, 11] and exercise [10].

β2-Adrenergic agonists are potent muscle growth promoters in many animal species [12, 13], resulting in skeletal muscle hypertrophy [14–17]. Formoterol is one of these compounds with important anti-cachectic effects in animal models. The mechanism of action of this drug is based on its ability to prevent muscle wasting by inhibiting proteolysis in skeletal muscle. Thus, this β2-agonist is able to decrease the activation of the ubiquitin-dependent proteolytic system, the main mechanism activated in muscle-wasting conditions [18]. Interestingly, in addition to its anti-proteolytic effects, formoterol also decreases muscle apoptosis in muscle-wasting animals [18].

After an injury within the muscle, there is an effective restoration of its structure and function [19]. This is possible due to existence of a population of mononuclear-acquired myogenic precursors, known as satellite cells [20]. These cells in adult muscle are in quiescent phase [21]. With the appropriate environmental signals, there is an activation of them and they become precursors for the formation of new muscles during growth or to repair muscle after an injury [22]. β2-Adrenergic agonists increase the ability of skeletal muscle repair after injury [23–29].

Bearing all this in mind, the objective of the present investigation was to measure the levels of Sirt1 and 3 gene expression in skeletal muscle of cachectic tumour-bearing animals and to relate them with the alterations found in skeletal muscle during cachexia. In addition, the effects of formoterol treatment (a highly effective anabolic treatment for cancer cachexia [18]) on sirtuin content were studied.

Material and methods

Animals

Male Wistar rats (Interfauna, Barcelona, Spain) of 5 weeks of age were used in the different experiments. The animals were maintained at 22 ± 2°C with a regular light–dark cycle (light on from 08:00 a.m. to 08:00 p.m.) and had free access to food and water. The food intake was measured daily. All animal manipulations were made in accordance with the European Community guidelines for the use of laboratory animals.

Tumour inoculation and formoterol treatment

Rats were divided into two groups, namely controls (n = 14) and tumour hosts (n = 14). The latter received an intraperitoneal (i.p.) inoculum of 108 AH-130 Yoshida ascites hepatoma cells obtained from exponential tumours [30]. Both groups were further divided into treated (n = 7) and untreated (n = 7), the former one being administered a daily subcutaneous dose of formoterol (0.3 mg/kg body weight, dissolved in physiological solution) and the latter one the corresponding volume of solvent. On day 7 after tumour transplantation, the animals were weighed and anesthetized with an i.p. injection of ketamine/xylazine mixture (3:1; Imalgene® and Rompun®, respectively). The tumour was harvested from the peritoneal cavity and its volume and cell content evaluated. Tissues were rapidly excised, weighed, and frozen in liquid nitrogen.

RNA isolation

Total RNA from gastrocnemius muscle was extracted by TriPureTM kit (Roche, Barcelona, Spain), a commercial modification of the acid guanidinium isothiocyanate/phenol/chloroform method [31].

Real-time polymerase chain reaction

First-strand cDNA was synthesized from total RNA with oligo dT15 primers and random primers pdN6 by using a cDNA synthesis kit (Transcriptor Reverse Transcriptase, Roche, Barcelona, Spain). Analysis of mRNA levels for Sirt1, Sirt3, Pax7, MyoD, myogenin, and 18S was performed with primers designed to detect these products: Sirt1: UP—AGCTGGGGTTTCTGTTTCCTGTGG, DO—TCGAACATGGCTTGAGGATCTGGGA; Sirt3: UP—CGGCTTTGGATGTGGAGGACAC, DO—CCTG GGGATCTGAAGTCTGGGATAC; Pax7: UP—GGAAAACCAGTGTGCCATCT, DO—CC TTGTCTTTGGCACCATTT; MyoD: UP—CGACTGCTTTCTTCACCACA, DO—CTCAACCCAAGCCTGAAGAG; myogenin: UP—GTCTTTTCCGACCTGATGGA, DO—GTCCCCAGTCCCTTCTCTTC, and 18S: UP—CGCAGAATTCCCACTCCCGACCC, DO—CCCAAGCTCCAACTACGAGC. To avoid the detection of possible contamination by genomic DNA, primers were designed in different exons. The real-time polymerase chain reaction was performed using a commercial kit (LightCyclerTM 480 SYBR Green I Master, Roche, Barcelona, Spain). The relative amount of all mRNA was calculated using comparative C T method. 18S mRNA was used as the invariant control for all studies.

Protein content

Protein concentration was determined according to the method of bicinchoninic acid (Pierce, Spain) and was expressed in milligrams of protein per gram of gastrocnemius muscle.

Western blot

Gastrocnemius muscle was homogenized in 10 mmol/L 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid (pH 7.5), 10 mmol/L MgCl2, 5 mmol/L KCl, 0.1 mmol/L EDTA, 0.1% Triton X-100, 1 mmol/L dithiothreitol (DTT) and 5 μL/mL of buffer of a protease inhibitor cocktail (Sigma, Spain). Tissue homogenates were then centrifuged at 7,000 rpm for 5 min at 4°C, and the supernatants were collected. Protein concentrations were determined according to the method of bicinchoninic acid (Pierce, Spain). Equal amounts of protein (50 or 100 μg) were heat-denatured in sample loading buffer (50 mmol/L Tris–HCl (pH 6.8), 100 mmol/L DTT, 2% sodium dodecyl sulfate (SDS), 0.1% bromophenol blue, 10% glycerol), resolved by SDS–polyacrylamide gel electrophoresis (10% polyacrylamide, 0.1% SDS) and transferred to Immobilon membranes (Immobilon polyvinylidene difluoride, Millipore). The filters were blocked with 5% phosphate-buffered saline with non-fat dry milk and then incubated with polyclonal antibody anti-cyclin D1 (Santa Cruz Biotechnology). Polyclonal antibody anti-GAPDH (Sigma, Spain) was used as the invariant control. Goat anti-rabbit horseradish peroxidase conjugate (Bio-Rad) was used as secondary antibody. The membrane-bound immune complexes were detected by an enhanced chemiluminescence system (EZ-ECL, Amersham Biosciences).

Statistical analysis

Statistical analysis of the data was performed by means of one- and two-way analysis of variance (ANOVA).

Results

As can be seen in Table 1, the implantation of the Yoshida AH-130 ascites hepatoma caused important decreases in the weight of gastrocnemius (13%), extensor digitorum longus (18%), and tibialis muscles (12%). These changes were accompanied by significant decrease in protein content (Table 1). Formoterol treatment was able to significantly increase muscle weight and protein content (Table 1). These data agree with previous results from our own laboratory [18].

Table 1.

Muscle weights and protein content in rats bearing the Yoshida AH-130 ascites hepatoma

C C + F TB TB + F ANOVA
A B
Food intake 106 ± 2 112 ± 3 78 ± 4 83 ± 2 0.0000 NS
Tumour content – – 3,648 ± 150 3,750 ± 180 NS
Muscle weights
 Gastrocnemius 637 ± 20 710 ± 23 553 ± 11 627 ± 10 0.0000 0.0001
 Tibialis 214 ± 6 238 ± 4 188 ± 3 206 ± 5 0.0000 0.0001
 Soleus 44 ± 1 48 ± 1 42 ± 1 45 ± 2 NS 0.0291
 EDL 51 ± 2 58 ± 1 42 ± 2 47 ± 1 0.0000 0.0007
GSN
 Protein content 212 ± 10 290 ± 20 173 ± 20 271 ± 20 0.1570 0.0004

Results are mean ± standard error of the mean for seven animals

Food intake is expressed in grams per 100 g initial body weight and refers to the ingestion during the period of the experiment prior to sacrifice which took place 7 days after tumour inoculation

Tissue weights are expressed as milligrams per 100 g of initial body weight

Tumour cell content is expressed in millions of cells. The protein content is expressed in milligrams of protein per gram GSN

Statistical significance of the results by two-way ANOVA

EDL extensor digitorum longus, C control animals, T tumour-bearing rats, F formoterol-treated animals, GSN gastrocnemius, ANOVA analysis of variance, NS non-significant differences, A tumour effect, B treatment effect

Figure 1 shows the Sirt1 and 3 mRNA content in skeletal muscle. As can be seen, tumour burden resulted in a significant increase in Sirt1 gene expression (91%) in gastrocnemius muscles, in relation with the non-tumour-bearing control animals. Interestingly, administration of formoterol results in a decrease in the levels of Sirt1 mRNA in the tumour-bearing animals without affecting the levels found in the control rats (Fig. 1). Conversely, no changes were observed in the mRNA levels of Sirt3 in any of the experimental groups studied (Fig. 1).

Fig. 1.

Fig. 1

Sirtuin 1 and 3 mRNA content in gastrocnemius muscles from tumour-bearing rats. Results are mean ± standard error of the mean for seven animals. The results of gene expression are expressed as a percentage of controls (arbitrary units). C control animals, T tumour-bearing rats, F formoterol-treated animals. Statistical significance of the results by one-way ANOVA, between groups (p < 0.001), and statistically significant difference by post hoc Duncan test. Different superscripts indicate significant differences between groups

Since Sirt1 has been associated with changes in muscle myoblast differentiation [32, 33], we decided to investigate the levels of differentiation markers in skeletal muscle from tumour-bearing rats. As can be seen in Table 2, tumour-bearing rats showed decreased mRNA content for Pax7 (39%), myogenin (24%), and MyoD (17%). Formoterol treatment increased Pax7 gene expression (139%) while reducing that of myogenin (53%) and decreased the protein levels of cyclin D (38%).

Table 2.

Pax7, myogenin, and MyoD mRNA content in skeletal muscle of rats bearing the Yoshida AH-130 ascites hepatoma

C C + F TB TB + F ANOVA
A B
mRNA
 Pax7 100 ± 10 137 ± 16 62 ± 11 143 ± 19 NS 0.0252
 MyoD 100 ± 5 97 ± 12 82 ± 5 79 ± 8 0.0456 NS
 Myogenin 100 ± 6 89 ± 14 75 ± 9 48 ± 5 0.0322 0.0432
Protein
 Cyclin D 100 ± 7 58 ± 13 76 ± 6 50 ± 5 0.0467 0.0187

For more details, see the “Material and methods” section

Results are mean ± standard error of the mean for seven animals

The results of gene expression are expressed as a percentage of controls. Statistical significance of the results by two-way ANOVA

C control animals, T tumour-bearing rats, F formoterol-treated animals, NS non-significant differences, A tumour effect, B treatment effect

Discussion

This is the first report on Sirt1 gene expression in skeletal muscle in catabolic conditions. Caloric restriction has been reported to increase Sirt1 content in skeletal muscle [11]; this could be relevant since tumour-bearing rats suffer from anorexia (Table 1). Formoterol does not affect food intake (Table 1); therefore, the increase in Sirt1 in muscle is not likely to have been triggered by caloric restriction in this experimental model. Other factors of inflammatory origin may be involved. From this point of view, TNF-α—a cytokine which is elevated in the tumour model chosen and that has been involucrated in muscle wasting [34–36]—has been shown to be responsible for increasing Sirt1 in vascular smooth muscle cells [37]. However, during sarcopenia, an increase in Sirt1 satellite cell content has been described [38]. Conversely, no changes were observed in the mRNA levels of Sirt3 in any of the experimental groups studied. This observation is in contrast with that of Alamdari et al. [39], showing an upregulation of Sirt3 in skeletal muscle during sepsis, a catabolic condition also characterized by intense muscle wasting.

Since Sirt1 has been associated with changes in muscle myoblast differentiation [32, 33], we decided to investigate the levels of differentiation markers in skeletal muscle from tumour-bearing rats. Different molecules involved in the process of muscle regeneration and in the regulation of satellite cells, such as Pax7, MyoD, and myogenin [20], are known (Fig. 2). In adult skeletal muscle, Pax7 is expressed in the majority of quiescent satellite cells. These cells, when activated, co-express Pax7 and MyoD [25, 40, 41]. When they proliferate, the levels of Pax7 decrease and other molecules involved in differentiation (such as myogenin) increase their expression. There is a part of the proliferating population that maintains the levels of Pax7, but not of MyoD, which returns to their state of quiescence [40–42]. The mRNA content decrease in tumour-bearing animals for Pax7, myogenin, and MyoD suggests a decrease in the rate of myoblast differentiation. Indeed Pax7 is a marker of satellite cell differentiation [29]. Interestingly, formoterol treatment increased Pax7 gene expression and increased myogenin gene expression, this clearly indicating that the beta agonist is able to activate satellite cell differentiation (Fig. 2). This is supported by the decrease in the protein levels of cyclin D—a marker of cell proliferation.

Fig. 2.

Fig. 2

Hypothetical involvement of Sirt1 in muscle wasting. Formoterol treatment is able to partially block not only the changes in protein and amino acid (AA) metabolism but also in apoptosis and muscle regeneration, possibly via Sirt1. BCAA branched chain amino acids

Sirt1 controls the transcription of the peroxisome proliferator-activated receptor (PPAR)-gamma co-activator 1alpha (PGC-1α) in skeletal muscle [43] (Fig. 2). In fact, tumour burden resulted in significant increases in PGC-1α in cachectic muscles [44]. Interestingly, formoterol treatment significantly decreased the levels of the co-activator both in control and tumour-bearing animals [44]. The results presented here indicate that the lack of muscle regeneration associated with muscle wasting during cancer [29] is likely to be associated with changes in Sirt1 content in skeletal muscle. This opens a new perspective in understanding muscle wasting associated with cancer cachexia and may lead to new approaches in the design of therapeutic strategies. In addition, Sirt1 may play a key modulatory role in animal fat deposition—it promotes fat mobilization by repressing PPAR-gamma [32] and muscle development, therefore contributing to the inter-organic metabolic cross-talk, as previously reported by our group [45].

Acknowledgments

This work was supported by a grant from the Ministerio de Ciencia y Tecnología (SAF-02284-2008). All authors of this manuscript comply with the guidelines of ethical authorship and publishing in the Journal of Cachexia, Sarcopenia and Muscle [46].

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

References

  • 1.Harvey KB, Bothe A, Jr, Blackburn GL. Nutritional assessment and patient outcome during oncological therapy. Cancer. 1979;43:2065–2069. doi: 10.1002/1097-0142(197905)43:5+<2065::AID-CNCR2820430714>3.0.CO;2-1. [DOI] [PubMed] [Google Scholar]
  • 2.Argiles JM, Alvarez B, Lopez-Soriano FJ. The metabolic basis of cancer cachexia. Med Res Rev. 1997;17:477–498. doi: 10.1002/(SICI)1098-1128(199709)17:5<477::AID-MED3>3.0.CO;2-R. [DOI] [PubMed] [Google Scholar]
  • 3.Argiles JM, Lopez-Soriano FJ. The ubiquitin-dependent proteolytic pathway in skeletal muscle: its role in pathological states. Trends Pharmacol Sci. 1996;17:223–226. doi: 10.1016/0165-6147(96)10021-3. [DOI] [PubMed] [Google Scholar]
  • 4.Sanchis D, et al. Skeletal muscle UCP2 and UCP3 gene expression in a rat cancer cachexia model. FEBS Lett. 1998;436:415–418. doi: 10.1016/S0014-5793(98)01178-8. [DOI] [PubMed] [Google Scholar]
  • 5.van Royen M, et al. DNA fragmentation occurs in skeletal muscle during tumor growth: a link with cancer cachexia? Biochem Biophys Res Commun. 2000;270:533–537. doi: 10.1006/bbrc.2000.2462. [DOI] [PubMed] [Google Scholar]
  • 6.Michishita E, et al. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins. Mol Biol Cell. 2005;16:4623–4635. doi: 10.1091/mbc.E05-01-0033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Haigis MC, Guarente LP. Mammalian sirtuins—emerging roles in physiology, aging, and calorie restriction. Genes Dev. 2006;20:2913–2921. doi: 10.1101/gad.1467506. [DOI] [PubMed] [Google Scholar]
  • 8.Shi T, et al. SIRT3, a mitochondrial sirtuin deacetylase, regulates mitochondrial function and thermogenesis in brown adipocytes. J Biol Chem. 2005;280:13560–13567. doi: 10.1074/jbc.M414670200. [DOI] [PubMed] [Google Scholar]
  • 9.Ashraf N, et al. Altered sirtuin expression is associated with node-positive breast cancer. Br J Cancer. 2006;95:1056–1061. doi: 10.1038/sj.bjc.6603384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Palacios OM, et al. Diet and exercise signals regulate SIRT3 and activate AMPK and PGC-1alpha in skeletal muscle. Aging (Albany NY) 2009;1:771–783. doi: 10.18632/aging.100075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chen D, et al. Tissue-specific regulation of SIRT1 by calorie restriction. Genes Dev. 2008;22:1753–1757. doi: 10.1101/gad.1650608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stock MJ, Rothwell NJ. Effects of β-adrenergic agonists on metabolism and body composition. In: Buttery PJ, Hayes NB, Lindsay DB, editors. Control and manipulation of animal growth. London: Butterworths; 1985. pp. 249–257. [Google Scholar]
  • 13.Kim YS, Sainz RD. beta-Adrenergic agonists and hypertrophy of skeletal muscles. Life Sci. 1992;50:397–407. doi: 10.1016/0024-3205(92)90374-X. [DOI] [PubMed] [Google Scholar]
  • 14.Agbenyega ET, Wareham AC. Effect of clenbuterol on skeletal muscle atrophy in mice induced by the glucocorticoid dexamethasone. Comp Biochem Physiol Comp Physiol. 1992;102:141–145. doi: 10.1016/0300-9629(92)90026-M. [DOI] [PubMed] [Google Scholar]
  • 15.Rajab P, et al. Skeletal muscle myosin heavy chain isoforms and energy metabolism after clenbuterol treatment in the rat. Am J Physiol Regul Integr Comp Physiol. 2000;279:R1076–R1081. doi: 10.1152/ajpregu.2000.279.3.R1076. [DOI] [PubMed] [Google Scholar]
  • 16.Hinkle RT, et al. Skeletal muscle hypertrophy and anti-atrophy effects of clenbuterol are mediated by the beta2-adrenergic receptor. Muscle Nerve. 2002;25:729–734. doi: 10.1002/mus.10092. [DOI] [PubMed] [Google Scholar]
  • 17.Wineski LE, et al. Muscle-specific effects of hindlimb suspension and clenbuterol in mature male rats. Cells Tissues Organs. 2002;171:188–198. doi: 10.1159/000063712. [DOI] [PubMed] [Google Scholar]
  • 18.Busquets S, et al. Anticachectic effects of formoterol: a drug for potential treatment of muscle wasting. Cancer Res. 2004;64:6725–6731. doi: 10.1158/0008-5472.CAN-04-0425. [DOI] [PubMed] [Google Scholar]
  • 19.Luz MA, Marques MJ, Santo Neto H. Impaired regeneration of dystrophin-deficient muscle fibers is caused by exhaustion of myogenic cells. Braz J Med Biol Res. 2002;35:691–695. doi: 10.1590/S0100-879X2002000600009. [DOI] [PubMed] [Google Scholar]
  • 20.Seale P, et al. Pax7 is required for the specification of myogenic satellite cells. Cell. 2000;102:777–786. doi: 10.1016/S0092-8674(00)00066-0. [DOI] [PubMed] [Google Scholar]
  • 21.Schultz E, Gibson MC, Champion T. Satellite cells are mitotically quiescent in mature mouse muscle: an EM and radioautographic study. J Exp Zool. 1978;206:451–456. doi: 10.1002/jez.1402060314. [DOI] [PubMed] [Google Scholar]
  • 22.Schultz E, McCormick KM. Skeletal muscle satellite cells. Rev Physiol Biochem Pharmacol. 1994;123:213–257. doi: 10.1007/BFb0030904. [DOI] [PubMed] [Google Scholar]
  • 23.Ryall JG, et al. Intramuscular beta2-agonist administration enhances early regeneration and functional repair in rat skeletal muscle after myotoxic injury. J Appl Physiol. 2008;105:165–172. doi: 10.1152/japplphysiol.00317.2007. [DOI] [PubMed] [Google Scholar]
  • 24.Roberts P, McGeachie JK. The enhancement of revascularisation of skeletal muscle transplants using the beta 2-agonist isoprenaline. J Anat. 1994;184:309–318. [PMC free article] [PubMed] [Google Scholar]
  • 25.Grounds MD, Yablonka-Reuveni Z. Molecular and cell biology of skeletal muscle regeneration. Mol Cell Biol Hum Dis Ser. 1993;3:210–256. doi: 10.1007/978-94-011-1528-5_9. [DOI] [PubMed] [Google Scholar]
  • 26.Roberts P, McGeachie JK. The effects of clenbuterol on satellite cell activation and the regeneration of skeletal muscle: an autoradiographic and morphometric study of whole muscle transplants in mice. J Anat. 1992;180:57–65. [PMC free article] [PubMed] [Google Scholar]
  • 27.Lynch GS, Schertzer JD, Ryall JG. Anabolic agents for improving muscle regeneration and function after injury. Clin Exp Pharmacol Physiol. 2008;35:852–858. doi: 10.1111/j.1440-1681.2008.04955.x. [DOI] [PubMed] [Google Scholar]
  • 28.Ryall JG, Church JE, Lynch GS. Novel role for beta-adrenergic signalling in skeletal muscle growth, development and regeneration. Clin Exp Pharmacol Physiol. 2010;37:397–401. doi: 10.1111/j.1440-1681.2009.05312.x. [DOI] [PubMed] [Google Scholar]
  • 29.Ametller E, et al. Formoterol may activate rat muscle regeneration during cancer cachexia. Insciences Journal. 2011;1:1–17. [Google Scholar]
  • 30.Tessitore L, et al. Cancer cachexia, malnutrition, and tissue protein turnover in experimental animals. Arch Biochem Biophys. 1993;306:52–58. doi: 10.1006/abbi.1993.1479. [DOI] [PubMed] [Google Scholar]
  • 31.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1016/0003-2697(87)90021-2. [DOI] [PubMed] [Google Scholar]
  • 32.Bai L, Pang WJ, Yang GS. Sirt1: a novel adipocyte and myocyte regulatory factor. Yi Chuan. 2006;28:1462–1466. doi: 10.1360/yc-006-1462. [DOI] [PubMed] [Google Scholar]
  • 33.Fulco M, et al. Glucose restriction inhibits skeletal myoblast differentiation by activating SIRT1 through AMPK-mediated regulation of Nampt. Dev Cell. 2008;14:661–673. doi: 10.1016/j.devcel.2008.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Costelli P, et al. Tumor necrosis factor-alpha mediates changes in tissue protein turnover in a rat cancer cachexia model. J Clin Invest. 1993;92:2783–2789. doi: 10.1172/JCI116897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Garcia-Martinez C, et al. Ubiquitin gene expression in skeletal muscle is increased by tumour necrosis factor-alpha. Biochem Biophys Res Commun. 1994;201:682–686. doi: 10.1006/bbrc.1994.1754. [DOI] [PubMed] [Google Scholar]
  • 36.Carbo N, et al. Anti-tumour necrosis factor-alpha treatment interferes with changes in lipid metabolism in a tumour cachexia model. Clin Sci (Lond) 1994;87:349–355. doi: 10.1042/cs0870349. [DOI] [PubMed] [Google Scholar]
  • 37.Zhang HN, et al. Involvement of the p65/RelA subunit of NF-kappaB in TNF-alpha-induced SIRT1 expression in vascular smooth muscle cells. Biochem Biophys Res Commun. 2010;397:569–575. doi: 10.1016/j.bbrc.2010.05.160. [DOI] [PubMed] [Google Scholar]
  • 38.Machida S, Booth FW. Increased nuclear proteins in muscle satellite cells in aged animals as compared to young growing animals. Exp Gerontol. 2004;39:1521–1525. doi: 10.1016/j.exger.2004.08.009. [DOI] [PubMed] [Google Scholar]
  • 39.Alamdari N, et al. Sepsis and glucocorticoids upregulate p300 and downregulate HDAC6 expression and activity in skeletal muscle. Am J Physiol Regul Integr Comp Physiol. 2010;299:R509–R520. doi: 10.1152/ajpregu.00858.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zammit PS, et al. Muscle satellite cells adopt divergent fates: a mechanism for self-renewal? J Cell Biol. 2004;166:347–357. doi: 10.1083/jcb.200312007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yablonka-Reuveni Z, Rivera AJ. Temporal expression of regulatory and structural muscle proteins during myogenesis of satellite cells on isolated adult rat fibers. Dev Biol. 1994;164:588–603. doi: 10.1006/dbio.1994.1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nagata Y, et al. Sphingomyelin levels in the plasma membrane correlate with the activation state of muscle satellite cells. J Histochem Cytochem. 2006;54:375–384. doi: 10.1369/jhc.5A6675.2006. [DOI] [PubMed] [Google Scholar]
  • 43.Amat R, et al. SIRT1 controls the transcription of the peroxisome proliferator-activated receptor-gamma Co-activator-1alpha (PGC-1alpha) gene in skeletal muscle through the PGC-1alpha autoregulatory loop and interaction with MyoD. J Biol Chem. 2009;284:21872–21880. doi: 10.1074/jbc.M109.022749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Fuster G, et al. Are peroxisome proliferator-activated receptors involved in skeletal muscle wasting during experimental cancer cachexia? Role of beta2-adrenergic agonists. Cancer Res. 2007;67:6512–6519. doi: 10.1158/0008-5472.CAN-07-0231. [DOI] [PubMed] [Google Scholar]
  • 45.Argiles JM, et al. Cross-talk between skeletal muscle and adipose tissue: a link with obesity? Med Res Rev. 2005;25:49–65. doi: 10.1002/med.20010. [DOI] [PubMed] [Google Scholar]
  • 46.von Haehling S, et al. Ethical guidelines for authorship and publishing in the Journal of Cachexia Sarcopenia and Muscle. J. Cachexia Sarcopenia Muscle. 2010;1:7–8. doi: 10.1007/s13539-010-0003-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Cachexia, Sarcopenia and Muscle are provided here courtesy of Wiley

RESOURCES