Summary
The Dot/Icm type IV secretion system of L. pneumophila translocates numerous bacterial effectors into the host cell and is essential for bacterial proliferation within macrophages and protozoa. We have recently shown that L. pneumophila strain AA100/130b harbors 11 genes encoding eukaryotic-like ankyrin (Ank) proteins, a family of proteins involved in various essential eukaryotic cellular processes. In contrast to most Dot/Icm-exported substrates, which have little or no detectable role in intracellular proliferation, a mutation in ankB results in a severe growth defect in intracellular replication within human monocyte-derived macrophages (hMDMs), U937 macrophages, and Acanthamoeba polyphaga. Single cell analyses of co-infections of hMDMs have shown that the intracellular growth defect of the ankB mutant is totally rescued in-cis within communal phagosomes harboring the wild type strain. Interestingly, distinct from dot/icm structural mutants, the ankB mutant is also rescued in-trans within cells harboring the wild type strain in a different phagosome, indicating that AnkB is a transacting secreted effector. Using adenylate cyclase fusions to AnkB, we show that AnkB is translocated into the host cell via the Dot/Icm secretion system in an IcmSW-dependent manner, and that the last 3 C-terminal amino acid residues are essential for translocation. Distinct from the dot/icm structural mutants, the ankB mutant-containing phagosomes exclude late endosomal and lysosomal markers and their phagosomes are remodeled by the RER. We show that at the post exponential phase of growth, the LetA/S and PmrA/B two component systems confer a positive regulation on expression of the ankB gene, whereas RpoS, LetE, and RelA suppress its expression. Our data show that the eukaryotic-like AnkB protein is a Dot/Icm-exported effector that plays a major role in intracellular replication of L. pneumophila within macrophages and protozoa, and its expression is temporally controlled by regulators of the post-exponential phase of growth.
Keywords: Legionnaires’ disease, regulation, infection, trafficking, dot/icm
Introduction
The Gram-negative bacterium, Legionella pneumophila, is ubiquitous in aquatic environments in both biofilm and planktonic forms, and is able to survive and replicate within protozoa (Abu Kwaik, 1998; Abu Kwaik et al., 1998; Hilbi et al., 2007; Molmeret et al., 2005). At least 13 species of amoebae and 2 species of ciliated protozoa support intracellular replication of L. pneumophila (Fields, 1996). Protozoa are the primary natural hosts of L. pneumophila, and this interaction is considered to be at the crux of pathogenesis and ecology of L. pneumophila (Barbaree et al., 1986; Molmeret et al., 2005; Rowbotham, 1980). When water aerosol containing L. pneumophila is inhaled or contaminated water is aspirated, L. pneumophila infect alveolar macrophages and epithelial cells, causing a severe atypical pneumonia designated Legionnaire’s disease (Kaufmann et al., 1981; Winn, 1988). Once in the host cell, L. pneumophila evades the default endocytic pathway, and remodels its vacuole by the rough endoplasmic reticulum (RER) (Horwitz, 1983; Kagan and Roy, 2002). Evasion of the endocytic pathway is exhibited in the two evolutionarily distant hosts, protozoa and human cells, and is mediated by the Dot/Icm type IV secretion system (Segal and Shuman, 1999).
The Dot/Icm type IV secretion system is required for L. pneumophila to modulate various cellular processes and to maintain integrity of the Legionella-containing phagosome (LCP), and these modulations are believed to be mediated through numerous secreted effectors (Abu-Zant et al., 2007; Dorer et al., 2006; Marra et al., 1992; Molmeret et al., 2007; Vogel et al., 1998). A large number of Dot/Icm-exported substrates have been identified by a variety of techniques, but the role of most of these proteins in the intracellular infection is not yet known (Campodonico et al., 2005; Chien et al., 2004; Shohdy et al., 2005). Unlike mutations in the dot/icm genes encoding components of the structural secretion apparatus that result in a severe defect in intracellular growth, mutations in most of the characterized effectors have little or no detectable effect on intracellular growth (Campodonico et al., 2005; Chen et al., 2004; Luo and Isberg, 2004). A mutation in sidJ, which encodes a Dot/Icm-exported effector, results in only ~15 fold reduction in intracellular growth within macrophages (Liu and Luo, 2007). A mutant defective in the Dot/Icm substrate SdhA and its two paralogs is severely impaired in intracellular growth within macrophages, but the defect is modest within Dictyostelium discoideum (Laguna et al., 2006).
A biphasic developmental cycle associated with bacterial differentiation governs the life cycle of L. pneumophila (Faulkner and Garduno, 2002). Upon growth transition from the exponential (E) to the post-exponential (PE) phase, many virulence and transmission traits are regulated by regulatory cascades that include the stationary-phase sigma factor RpoS, the LetA/S Two Component System (TCS), the flagellar sigma factor FliA, and LetE (Bachman and Swanson, 2001; Bruggemann et al., 2006; Hales and Shuman, 1999; Hammer and Swanson, 1999; Hammer et al., 2002). The transmission phenotypes that are triggered upon growth transition at the PE phase include bacterial motility, evasion of the endocytic pathway, and intracellular growth (Hammer and Swanson, 1999).
The genome of L. pneumophila reflects its co-evolution with its eukaryotic hosts, as it codes for a high number of eukaryotic-like proteins, which are thought to interfere with host processes by mimicking eukaryotic protein functions (Cazalet et al., 2004; de Felipe et al., 2005; Steinert et al., 2007). Eleven genes encoding eukaryotic-like ankyrin repeats-containing proteins (Ank) are present in the clinical isolate of L. pneumophila strain AA100/130b (Habyarimana et al., 2008) and are common to the other clinical isolates Corby, Paris, Lens and Philadelphia-1 (Cazalet and Buchrieser, 2005; Cazalet et al., 2008; Glockner et al., 2007; Steinert et al., 2007). The ank genes have been suggested to be acquired through horizontal gene transfer (Cazalet et al., 2004; de Felipe et al., 2005; Glockner et al., 2007). No homologies are detected in genetic databases for any of the L. pneumophila ank genes (Cazalet and Buchrieser, 2005), indicating that they are novel. The ANK domain is the most common protein domain in the eukaryotic kingdom and is composed of a 33-residue motif (Amstutz et al., 2005; Howell et al., 2000; Kitazawa et al., 2005; Mosavi et al., 2002a; Mosavi et al., 2002b; Mosavi et al., 2004). The ANK domain mediates protein-protein interaction involved in various eukaryotic cellular processes such as cell motility, cell signaling, cell cycle, transcriptional regulation, and oncogenesis (Amstutz et al., 2005; Batchelor et al., 1998; Michel et al., 2001). In silico analysis of the ANK domain has revealed six non-conserved residues that determine the specific target protein with which an ankyrin protein interacts (Magliery and Regan, 2005). In addition to the absence of homologues to the Ank proteins of L. pneumophila (Habyarimana et al., 2008), no homologies are detected in genetic databases for the six specificity-determining residues for any of the L. pneumophila ANK domains (Habyarimana et al., 2008), suggesting that they may have unique targets in the host cell (Cazalet and Buchrieser, 2005). The ANK domains were first identified in the yeast cell cycle regulator, Swi6/Cdc10, and the Drosophila signaling protein, Notch (Howell et al., 2000; Kitazawa et al., 2005; Mosavi et al., 2004), but have been recently found in various microbial pathogens. The AnkA protein of the intracellular bacterium Anaplasma phagocytophilum is thought to be translocated by the type IV secretion system into the host cell, where it interacts with the host cell protein, SHP-1 (IJdo et al., 2007), and alters gene transcription (Park et al., 2004). Among human pathogens, L. pneumophila harbors the highest number of Ank proteins (Cazalet et al., 2004; de Felipe et al., 2005; Steinert et al., 2007).
Ten of the 11 ank genes in strain AA100 have been recently characterized (Habyarimana et al., 2008). Eight of the 10 Ank proteins are dispensable for intracellular proliferation, whereas the ankH and ankJ mutants of L. pneumophila exhibit a mild defect in robust intracellular proliferation in macrophages and protozoa (Habyarimana et al., 2008). The role of the 11th ank gene (ankB) in the intracellular infection is not known. In this study we show that despite its severe intracellular growth defect within human macrophages and A. polyphaga, the ankB mutant evades the endocytic pathway and remodels its phagosome into an ER-derived vacuole, similar to the parental strain. The intracellular growth defect of the ankB mutant is rescued in-cis within communal phagosomes harboring the wild type (WT) strain, and also in-trans within cells harboring the wild type strain in a different phagosome, indicating that AnkB is a trans-acting effector. Using adenylate cyclase fusions to AnkB, we show that AnkB is translocated into the host cell via the Dot/Icm secretion system in an IcmSW-dependent manner, and that the last 3 C-terminal amino acid residues are essential for translocation. Similar to other Dot/Icm effectors, expression of AnkB is triggered at the PE phase of growth and many PE phase regulators play roles in temporal regulation of ankB expression.
Results
The role of L. pneumophila AnkB in the intracellular infection of protozoa
The ankB gene (lpg2144, legAU13, lpl2072, lpp2082, lpc 1593) is a monocistronic gene that encodes a 172 amino acid hydrophilic protein that harbors two ANK domains and one N-terminus F-box domain, which is involved in eukaryotic protein ubiquitination (Fig. 1). To characterize the role of AnkB in the intracellular infection, we generated an isogenic ankB mutant of L. pneumophila strain AA100 by allelic exchange. The growth rate of the ankB mutant during in vitro BYE broth culture was similar to the wild type strain, and no difference in the length of the lag phase was observed (data not shown). Next, we assessed the role of AnkB in intracellular replication within A. polyphaga. Compared to the wild type strain, the ankB mutant had a defect in intracellular growth within A. polyphaga with ~400-fold fewer CFUs recovered at 48h post-infection (Fig. 2A). The defect was fully complemented by the wild type gene (Fig. 2A). As expected, the dotA mutant control did not replicate.
Fig. 1.

Genetic organization of ankB, the relevant protein domains, and the C-terminal amino acid sequence of the protein and the deletion mutants. The top illustration shows the organization of the ankB gene in the L. pneumophila chromosome, illustrating the upstream and downstream adjacent genes. The middle illustration represents the ankB gene with the corresponding domains (ankyrin and F-box), and location of the kanr insertion in the ankB mutant. The lower two illustrations represent the AnkB protein with the domain locations and the C terminal sequence of the deletion mutants.
Fig. 2. Intracellular growth kinetics within A. polyphaga.

(A) Intracellular growth kinetics of the wild type strain AA100, ankB mutant and its complemented strain in A. polyphaga. (B) Intracellular growth kinetics of the WT strain and ankB mutant both complemented with an ankB gene that had a deletion of the last 3 codons (ankB1–169). The infection was carried out in triplicate with an MOI of 10 for 1 h, followed by 1 h of gentamicin treatment to kill extracellular bacteria. The infected monolayers were lysed at different time intervals and plated onto agar plates for colony enumeration. The experiment was done 3 times, and the data are representative of one independent experiment. Error bars represent standard deviations, but some were too small to appear in the figure.
The role of AnkB in the intracellular infection of human macrophages
We determined the role of ankB in intracellular proliferation in human monocyte derived macrophages (hMDMs) and the U937 macrophage cell line. As expected, the wild type strain AA100 grew normally in both cells, whereas the dotA mutant control did not grow. In both macrophage types, the ankB mutant showed a severe growth defect with ~2000-fold fewer CFUs recovered at 48h post infection, compared to the wild type strain (Fig. 3). There was no change in the CFUs of the ankB mutant at 72h from that at 48h, while the WT strain CFUs started to decline due to loss of viability of the released bacteria into the tissue culture medium after lysis of the host cell. Complementation of the ankB mutant with the respective wild type gene on a plasmid fully restored the wild type phenotype (Fig. 3). The minor differences in the growth kinetics of the ankB mutant within macrophages and amoeba suggest minor differences in the temporal requirement of AnkB by L. pneumophila to proliferate robustly within the two evolutionarily distant hosts.
Fig. 3. Defect in intracellular growth of the ankB mutant within macrophages.

Intracellular growth of the ankB mutant in hMDMs (A) and U937 cells (B). (C) Intracellular growth of the wild type strain AA100 and the ankB mutant both complemented with an ankB allele that had a deletion of the last 3 codons (ankB1–169). The infection was carried out in triplicate with an MOI of 10 for 1 h, followed by 1 h of gentamicin treatment to kill extracellular bacteria. The infected monolayers were lysed at different time intervals and plated onto agar plates for colony enumeration. The experiment was done 3 times, and the data are representative of one independent experiment. Error bars represent standard deviations, but some were too small to appear in the figure.
The transposon insertion in the ankB mutant is located at 330 bp from the start of the 516 bp ORF. To exclude the possibility that the insertion in ankB results in expression of a truncated AnkB protein with potential deleterious effects on the host cell, we utilized two approaches. First, we complemented both the wild type strain AA100 and the ankB mutant with an ankB gene that had a deletion of the last 3 codons (ankB1–169). This truncated AnkB was expressed similarly to the full length AnkB (see below) but did not affect the growth of the wild type strain and did not complement the growth defect of the ankB mutant in either A. polyphaga or U937 cells (Fig. 2B and Fig. 3C). Second, RealTime qRT-PCR using primers to amplify the first 300bp of ankB upstream of the kan insertion showed no detectable mRNA in the ankB insertion mutant compared to the wild type strain at both the E and PE phases (data not shown). Therefore, the defect of the ankB insertion mutant in intracellular proliferation is due to the lack of expression of AnkB and is fully complemented by the wild type ankB.
To determine whether the ankB mutant growth defect was due to a defect in a subset of the bacterial population or to a balanced bacterial division and death, we performed single cell analysis by confocal microscopy (Fig. 4). At 2 hours after infection, approximately 90% of the cells infected with the different strains harbored one organism (Fig. 4A). After 10 hours of infection, approximately 75% of the cells harboring the wild type strain contained 6 to 15 bacteria. In contrast, the ankB mutant showed no detectable replication, similar to the dotA mutant (Fig. 4B). Thus, the growth defect of the ankB mutant was homogenous, and was not due to a balanced bacterial division and death.
Fig. 4. Single cell analysis of replicative phagosomes.

After 2 and 10h post-infection of hMDMs, 100 infected cells were analyzed by laser scanning confocal microscopy for formation of replicative phagosomes. L. pneumophila was stained by a polyclonal anti L. pneumophila antibody and Alexa Fluor 555-conjugated anti-rabbit IgG. Representative quantitation of the number of bacteria/cell at 2 (A) and 10 hours (B) is shown. The dotA mutant was used as negative control. Infected cells from multiple cover slips were examined in each experiment. The results are representative of three independent experiments performed in triplicate. Error bars represent standard deviations. The difference between the WT strain and the ankB mutant was statistically significant (Student t-test, p<0.1).
Intracellular trafficking of the ankB mutant within hMDMs
Evasion of the endocytic pathway and recruitment of early secretory vesicles by the Legionella containing phagosome are both controlled by the Dot/Icm type IV secretion system (Derre and Isberg, 2004; Kagan et al., 2004). Since the ankB mutant exhibited a severe defect in intracellular replication, we examined intracellular trafficking of the ankB mutant within hMDMs. Confocal laser scanning microscopy was used to assess co-localization of the late endosomal/lysosomal marker, (LAMP-2), and the luminal lysosomal enzyme, cathepsin D, with phagosomes harboring the wild type strain AA100 and the ankB mutant (Fig. 5). Formalin-killed bacteria, which traffic to the phagolysosomes, were used as a positive control for co-localization with LAMP-2 and cathepsin D. The data showed that at 2h post-infection, phagosomes harboring the wild type strain and the ankB mutant co-localized with LAMP-2 at a frequency of approximately 30 and 44% respectively, whereas phagosomes containing formalin-killed bacteria showed 78% co-localization (Fig. 5A). Approximately 80% of the formalin-killed bacteria co-localized with the lysosomal marker cathepsin D, whereas the wild type strain AA100 and the ankB mutant showed 31 to 40% co-localization, respectively (Fig. 5B). The difference in LAMP2 and cathepsin D co-localization between the wild type strain and the ankB mutant was not significant (Student t-test, p> 0.1).
Fig. 5. Quantitative analysis of intracellular trafficking of the ankB mutant.

Quantitative analyses of confocal microscopy images of infected hMDMs of co-localization of the bacterial phagosomes with the late endosomal marker LAMP2 (A), the lysosomal enzyme cathepsin D (B), and the KDEL marker (C) at 2 h post-infection. Formalin killed bacteria (FK) were used as a positive control for LAMP2 and cathepsin D co-localization and as a negative control for KDEL and ER recruitment. At least 100 infected cells from multiple cover slips were examined in each experiment. (D) Quantitative analysis by TEM of recruitment of the RER. At least 100 infected cells from multiple sections obtained from different blocks were analyzed. Results shown are representative of three independent experiments performed in triplicate. Data represents means ± standard deviation. No significant difference was observed between the WT strain and the ankB mutant (Student t-test, p>0.1). Asterisks represent significant difference (p< 0.05) between the WT and FK bacteria.
We examined by confocal microscopy the presence of RER-associated proteins in the phagosomes at 4h post-infection, using an antibody that recognizes the KDEL amino acid sequence, which is the signal for ER retention. The data showed that at 4h post-infection of hMDMs, ~70–80% of the phagosomes harboring the wild type strain and the ankB mutant co-localized with the KDEL marker, whereas phagosomes harboring the formalin-killed bacteria did not acquire the KDEL marker (20%) (Fig. 5C). These results were confirmed by transmission electron microscopy, which showed the presence of ribosome-studded ER membrane around the organism (Supplementary Fig. S1). No significant difference (Student t-test p>0.1) was observed in recruitment of the RER to the vacuole containing the wild type strain and the ankB mutant (Fig. 5D). We conclude that despite its severe intracellular growth defect, trafficking of the ankB mutant-containing phagosomes is not distinguishable from the parental strain.
In-cis and in-trans rescue of the ankB mutant growth defect within macrophages harboring the wild type strain
Mutants of the dot/icm genes encoding structural components of the type IV secretion apparatus are defective in modulating phagosomal biogenesis and in intracellular replication. The dot/icm mutants are rescued for their intracellular defect within communal phagosomes harboring the wild type strain of L. pneumophila, which is able to modulate phagosomal biogenesis into a niche suitable for bacterial replication (Coers et al., 1999). However, L. pneumophila mutants defective in intracellular replication due to a defect in stress response genes, such as htrA or rpoS, that are required for adaptation to the phagosomal microenvironment, are not rescued within communal phagosomes harboring the wild type strain (Abu-Zant et al., 2006; Coers et al., 1999; Pedersen et al., 2001). To examine whether the AnkB protein is required for formation of replicative phagosomes or for adaptation to the phagosomal microenvironment, we co-infected macrophages with the wild type strain and the ankB mutant and determined whether the mutant replicated in communal phagosomes harboring the wild type strain. We used co-infection of wild type L. pneumophila and the two isogenic mutants, dotA and htrA, as positive and negative controls, respectively. In all co-infections, only ~10 % of the phagosomes were communal phagosomes harboring the two different strains. Our data showed that in ~85% of the cells harboring the ankB mutant within communal phagosomes containing the wild type strain, the mutant replicated robustly (Fig. 6). There were equivalent numbers of bacteria for both strains in the communal phagosomes harboring the two strains. There was no detectable rescue of the ankB mutant between cells, since there was no detectable proliferation of the ankB mutant without the presence of the wild type strain within the same cell. In the control co-infection of L. pneumophila and its dotA mutant, replication of the dotA mutant was rescued in 80% of the communal phagosomes containing the wild type strain (Fig. 6A–C). Control co-infection with L. pneumophila and its htrA mutant showed failure of the wild type strain to rescue the htrA mutant in communal phagosomes, since rescue was detected only in ~15 of the communal phagosomes harboring the wild type strain (Fig. 6A and C) (Pedersen et al., 2001).
Fig. 6. In-cis and in-trans rescue of intracellular growth of the ankB mutant by the wild type strain within hMDMs.

Wild-type L. pneumophila strain AA100 expressing GFP and the ankB mutant strain were phagocytosed by hMDMs simultaneously (co-infection with AA100+ankB) or sequentially spaced 30 min apart by super-infection of strain AA100 followed by the ankB mutant, (AA100/ankB) or infection by the ankB mutant followed by strain AA100, (ankB/AA100). Infections were carried out using an equivalent amount of total CFUs for the different strains based on the optical density, which was further confirmed later by enumerating the CFUs after growth on agar plates. Infected cells were gentamicin treated, washed and fixed 10 h after infection. Bacterial phagosomes were scored for all macrophages in randomly selected fields by fluorescence microscopy at 10h post-infection. Macrophages harboring phagosomes containing both strains (GFP-WT and mutants) were scored. The dotA mutant was used as positive control for the co-infection illustrating the in-cis rescue, whereas the htrA mutant was used as negative control (A). Representative confocal images and quantitation are shown in panel A for in-cis and in-trans rescue. Panel B represents a single infection by the wild type strain AA100 and the ankB mutant after 10h. Rescue was calculated by quantifying the percentage of the cells harboring the ankB mutant replicating within communal phagosomes with the WT strain (in cis) or within cells super-infected with the WT strain (in trans). Quantitation is shown in panel C. The results are representative of three independent experiments performed in triplicate. Error bars represent standard deviation.
Our data above showed that synchronous uptake of the ankB mutant and the wild-type bacteria into a communal phagosome resulted in an in-cis rescue of the growth defect of the ankB mutant within the communal phagosomes, which was similar to the rescue of the dot/icm mutants defective in structural components of the secretion apparatus. To determine whether the ankB mutant can be rescued in-trans by the wild type strain located in a different phagosome within the same cell, we did sequential infections by the two strains. First, we infected hMDMs for 30 min with one strain, followed by extensive washing to remove the extracellular bacteria, and then super-infected the macrophages with the second strain. In control super-infections by the wild type strain and the dotA mutant, there was no detectable rescue of the defect of the dotA mutant in intracellular proliferation, regardless of the order of the infection by the two strains (Fig. 6). This confirmed entry of the two strains into different phagosomes in our sequential infection protocol. When the wild type strain-infected hMDMs were super-infected by the ankB mutant, 76% of the dually infected cells showed replication of the ankB mutant by 10h post infection (Fig. 6). When the order of the infection was reversed and the ankB mutant-infected hMDMs were super-infected by the WT strain, 72% of the dually infected cells showed replication of the ankB mutant by 10h post infection (Fig. 6A,C). There was no detectable rescue of the ankB mutant between cells, since there was no detectable proliferation of the ankB mutant without the presence of the wild type strain within the same cell. To ensure reliability of our analyses of the in-cis and in-trans rescue of the ankB mutant by the wild type strain, we switched GFP expression from the wild type strain into the ankB mutant and used non-fluorescent wild type strain. The GFP-expressing dotA and htrA mutants were used as controls. The data showed that switching GFP expression from the wild type strain into the ankB mutant had no effect on the in-cis or in-trans rescue of the ankB mutant by the wild type strain, since the results were similar to those when GFP-expressing wild type strain was used (Fig. 6 and data not shown). These results showed that the wild type strain can rescue the intracellular growth defect of the ankB mutant in-cis within communal phagosomes and in-trans within different phagosomes within the same cell. This is distinct from the dot/icm structural mutants (such as dotA), where the mutants are only rescued in-cis, but not in-trans, by the wild type strain (Coers et al., 1999). Our data suggest that AnkB is a trans-acting effector that is likely exported by the wild type strain into the host cell to exhibit the in-trans rescue of the ankB mutant.
Dot/Icm-mediated translocation of AnkB
The ability of the wild type strain to rescue the ankB mutant in-trans in a different phagosome within the same cell indicated that AnkB is likely to be a trans-acting Dot/Icm-translocated effector. To assess translocation of AnkB, we constructed fusions of this protein to the C-terminus of the catalytic domain of Bordetella pertussis adenylate cyclase (Cya) (Sory and Cornelis, 1994). Adenylate cyclase activity has been extensively used as a reporter to measure translocation of L. pneumophila T4SS substrates in a variety of host cells (Cambronne and Roy, 2007; Chen et al., 2004; Nagai et al., 2005). Translocation of AnkB was examined using the wild type strain AA100 and an isogenic strain defective in the T4SS apparatus (ΔdotA). Levels of cAMP were measured at 1 hour post-infection. U937 cells that were mock infected, or infected with the wild type strain AA100 harboring a plasmid encoding only the Cya domain (empty vector) exhibited low levels of cAMP (Fig. 7A). In contrast, cells infected with a strain harboring a Cya-RalF fusion, as a positive control, demonstrated a high level of cAMP after 1 hour, as shown plasmid encoding a Cya-AnkB fusion also exhibited high levels of cAMP, indicating that AnkB is translocated into host cells (Fig. 7A). In contrast, levels of cAMP in U937 cells infected by the dotA mutant harboring a plasmid encoding Cya-AnkB were similar to mock-infected or empty vector controls (Fig. 7A).
Fig. 7. Translocation of AnkB into host cells is Dot/Icm-dependent and the IcmS and IcmW chaperones are essential for translocation.

(A) Requirement of Dot/Icm components for AnkB translocation. U937 cells were infected with the wild type strain or the isogenic mutants, ΔdotA, ΔicmS or ΔicmW harboring the indicated plasmids (MOI 50) for 1 h. Data points are the average cAMP concentration per well ± SD for an experiment performed in triplicate, and are representative of three independent experiments. (B) Requirement of C-terminal residues for AnkB translocation. U937 cells were infected with AA100 harboring the indicated plasmids at an MOI of 50 for 1 h. Data points are the average cAMP concentration per well ± SD for an experiment performed in triplicate. (C) Immunoblots of Cya-AnkB fusions expressed in L. pneumophila. Proteins derived from equivalent numbers of bacteria (1 × 108 bacteria) were loaded onto an SDS-PAGE gel and Cya fusion proteins were detected using a αM45 antibody, recognizing the N-terminal M45 epitope present on all Cya fusions used.
Since IcmS and IcmW have been shown to act as a bimolecular chaperone complex for many Dot/Icm-exported effectors, we examined translocation of AnkB in the icmS and icmW isogenic mutants. The data showed that U937 cells infected with ΔicmS or ΔicmW mutants harboring plasmids encoding Cya-AnkB generated levels of cAMP that were similar to mock-infected or empty vector controls (Fig. 7A). Taken together, our data indicate that translocation of AnkB is dependent on the Dot/Icm T4SS and that the IcmSW chaperone complex is essential for its translocation.
The L. pneumophila T4SS translocation signal has been shown to reside within the C-terminus of some but not all Dot/Icm substrates (Laguna et al., 2006; Nagai et al., 2005). Similar to RalF, which is a Dot/Icm-exported effector, AnkB has hydrophobic residues at the -2 and -3 positions relative to the C-terminus, and a leucine residue at the -3 position, which is crucial for translocation of the RalF effector (Nagai et al., 2005) (Fig. 1). To assess the requirement for the C-terminus and determine which residues were critical for translocation, truncated mutants of AnkB fused to the Cya domain were generated and assayed for translocation (Fig. 1). Removal of the C-terminal cysteine residue (AnkB 1–171) had no effect on translocation of AnkB into the host cell (Fig. 7B). However, removal of the last two residues (VC) of AnkB (AnkB 1–170) reduced translocation by 50% relative to full-length AnkB (Fig. 7B). Furthermore, removal of the last three C-terminal residues (LVC) of AnkB (AnkB 1–169) and further truncations of the C-terminus completely abolished translocation of AnkB (Fig. 7B). Immunoblot analyses of the cell lysates, probed with an antibody that recognizes the M45 tag peptide portion of the Cya fusion proteins, showed that expression of Cya-AnkB and the derived truncation mutants in strain AA100 and in the isogenic mutants was similar among the strains. The blots were re-probed with anti-CAT antibodies, which showed equivalent expression of another protein encoded on the same reporter plasmid (data not shown). The data indicated that differences in cAMP levels were not due to differences in cellular concentration or protein stability of the fusion constructs in the wild type strain or the mutants (Fig. 7C). We conclude that the –2 and -3 residues (V and L respectively) are required for translocation of AnkB into the host cell.
Regulation of expression of ankB
Entry into the PE phase is triggered by the activation of the stringent response regulator RelA and accumulation of its product, ppGpp (Hammer and Swanson, 1999). Together with RelA and LetE, the two-component regulatory system LetA/S, (Bachman and Swanson, 2004; Hammer et al., 2002), the sigma factors RpoS, RpoN, and FliA (Bachman and Swanson, 2001; Hales and Shuman, 1999) play critical roles in the expression and regulation of many virulence factors. In addition, the PmrA response regulator controls the expression of several Dot/Icm substrates (Zusman et al., 2007). Most L. pneumophila genes required for intracellular replication are triggered at the PE phase (Byrne and Swanson, 1998; Hammer and Swanson, 1999; Hammer et al., 2002). To determine whether expression of ankB is governed by the regulatory cascade at the PE phase (Fig. 8A) (Hammer et al., 2002), we examined expression of ankB by RealTime qRT-PCR in the rpoS, relA, rpoS-relA, letE, letA/S, and pmrA/B isogenic mutants and compared it to the wild type strain. The flaA gene encoding the flagellum subunit protein was used as a positive control for a gene that is highly induced at the PE phase (Bosshardt et al., 1997).
Fig. 8. Regulation of expression of ankB by the L. pneumophila wild type strain and different regulatory mutants.

Real Time qRT-PCR was used to determine regulation of expression of ankB by the wild type strain and the pmrA/B, relA, rpoS, ΔrpoS-ΔrelA, letA/S, and letE mutants. (A) and (B) represent the in vitro qRT-PCR expression of ankB by the wild type strain and its isogenic regulatory mutants at the E and PE phases of growth, respectively. The ankB mRNA was normalized internally to the 16S rRNA. The results of the qRT-PCR are represented as the ratios of ratios, i.e., (ankB/16S) mutant over (ankB/16S) wild type. Individual experiments were performed three times, and the results of one experiment are shown. Error bars represent standard deviations of triplicate samples.
The data showed a seven-fold increase in expression of ankB in the relA mutant at both the E and PE phases (Fig. 8A and B), while in the relA-rpoS double mutant a 26-fold increase in expression of ankB was detected at the PE phase. In the letA mutant, expression of ankB was decreased by 50-fold upon transition into the PE phase (Fig. 8B). In contrast, the letE mutant exhibited a 123 to 156 fold increase in expression of ankB at the E and PE phases, respectively (Fig. 8). Expression of ankB was 22-fold less in the pmrA mutant at the PE phase relative to the E phase, consistent with previous findings that the promoter region of the ankB gene contains a PmrA-binding consensus motif (Zusman et al., 2007). We conclude that during the developmental life cycle of L. pneumophila, many PE phase regulators are responsible for the temporal regulation of ankB expression.
Discussion
The L. pneumophila genome codes for an unexpectedly high number of eukaryotic-like proteins, which are thought to interfere with various cellular processes by mimicking functions of eukaryotic proteins (Cazalet et al., 2004; de Felipe et al., 2005; Steinert et al., 2007). The large number and wide variety of eukaryotic-like proteins encoded in the L. pneumophila genome is unique for a prokaryotic genome (Habyarimana et al., 2008). These proteins include ankyrin (Ank), Sel-1 (TPR), U-box and F-box motifs (Kubori et al., 2008; Steinert et al., 2007). In L. pneumophila, the Ank proteins are considered the most prominent family of proteins with eukaryotic-like domains and may play an important role in the intracellular life cycle (Habyarimana et al., 2008; Steinert et al., 2007). The Ank proteins have also been identified in other pathogens including Coxiella burnetii and Anaplasma phagocytophilum ( Caturegli et al., 2000; Ogata et al., 2005; Park et al., 2004; Seshadri et al., 2003; Wu et al., 2004), where they have been shown to be multifunctional and are involved in modulation of various cellular processes in the host.
To generate a replicative niche within the host cell, L. pneumophila translocates more than 100 effector proteins via the Dot/Icm T4SS apparatus into the host cell (Campodonico et al., 2005; Chen et al., 2004; Conover et al., 2003; Murata et al., 2006; Shohdy et al., 2005; Zusman et al., 2007). Some but not all the Dot/Icm substrates contain specific translocation motifs that target them for translocation. There is a correlation between the presence of hydrophobic residues at the C-terminus of some but not all L. pneumophila Dot/Icm-translocated effectors (Nagai et al., 2005). The AnkB protein is translocated into the host cell by the Dot/Icm T4SS apparatus in an IcmSW-dependent manner, and the last 3 C-terminal amino acids are essential for translocation into the host cell (Nagai et al., 2005). The lack of complementation of the intracellular growth defect of the ankB insertion mutant by the ankB allele with deletion of only the last three residues excludes the possibility that the insertion mutant expresses a truncated AnkB with potential deleterious effects on the host cell. In addition, there is no detectable mRNA for the region of ankB upstream of the kanamycin cassette insertion in the ankB mutant. Taken together, we conclude that the insertion mutation is fully complemented by the wild type ankB and the insertion has not resulted in expression of any detectable truncated AnkB protein. Importantly, our data show that Dot/Icm-mediated translocation of AnkB is essential for intracellular proliferation.
Consistent with translocation of AnkB into the host cell, sequential infections by the wild type strain and the ankB mutant indicated that the mutant is rescued in-trans within macrophages harboring the wild type strain in a separate vacuole. This is consistent regardless of the order of the infection by the two strains. In contrast, in sequential infections with the wild type strain and the dotA mutant control, there is not detectable rescue of the dotA mutant within cells harboring the wild type strain in separate vacuoles. This is also consistent regardless of the order of the infection by the two strains. These observations indicate that our super-infections do not involve any detectable contamination of the first strain during the super-infection by the second strain, which allows entry of the second strain into a separate vacuole. However, when co-infected, the dotA mutant is only rescued within vacuoles occupied by the wild type strain. We conclude that the ankB mutant is rescued in-trans by the wild type strain.
Although the Dot/Icm system plays an important role in the modulation of eukaryotic cellular processes, most mutants lacking single Dot/Icm-exported effectors, such as SidJ, do not exhibit any defect or are only modestly defective in intracellular proliferation (Campodonico et al., 2005; Luo and Isberg, 2004; Ninio et al., 2005). The ankB mutant is severely defective in intracellular proliferation within hMDMs. The sdhA mutant is severely defective within macrophages (Laguna et al., 2006), but it has not been tested in Acanthamoeba. Therefore, AnkB and SdhA are the only two known Dot/Icm-exported effectors that play a major role in the intracellular growth of L. pneumophila within macrophages, which makes these two effectors unique among the Dot/Icm-exported substrates.
Despite its severe defect in intracellular replication, the ankB mutant evades the endocytic pathway, and remodels its phagosome into an RER-derived compartment, similar to the WT strain. This may suggest a role for AnkB in the formation of a replicative phagosome, independent of evasion of endocytic fusion and remodeling of the phagosome by the RER. The lack of homology of the AnkB protein and the 6 specificity-determining residues within the two ANK domains to other L. pneumophila Ank proteins or other proteins in databases and the presence of a eukaryotic F-box domain indicates a novel function for AnkB in modulating biology of the host cell to remodel it into a suitable proliferation niche. Future studies to elucidate the function of AnkB, and the role of the two ANK domains and the F-box domain in its function will enhance our knowledge of the cell biology of this intracellular pathogen.
Similar to many Dot/Icm secreted effectors and virulence factors, the expression levels of ankB are higher at the PE phase of growth in an RpoS dependant mechanism (Habyarimana et al., 2008). Examination of the ankB promoter region did not identify any regulatory sequence recognized by the RpoS transcription factor, which suggests a role for other PE phase regulators that may act through RpoS in a cascade manner. At both the E and PE phases, the expression profiles of ankB are similar for all regulatory mutants relA, rpoS, and letE (Bachman and Swanson, 2001; Feldman and Segal, 2007; Hammer et al., 2002; Zusman et al., 2007), with the exception of the letA/S and pmrA/B mutants. At both growth phases, the three regulators LetE, RelA, and RpoS suppress expression of ankB, while the PmrA/B TCS induces its expression (Zusman et al., 2007). Recent data derived from genome-wide microarray analyses of pmrA/B mutants are consistent with these findings and show a more global role for this two component regulator in expression of numerous genes encoding Dot/Icm effectors, including the ank genes (Al-Khodor et al, unpublished data).
On the other hand, both LetA and LetS suppress the expression of ankB at the E phase, whereas growth transition into the PE phase relieves this suppression. Therefore, the LetA/S TCS plays a major role in temporal regulation of ankB in a growth phase-dependent manner. Upon depletion of amino acids, the RelA product (ppGpp) triggers two parallel signaling cascades in L. pneumophila. One of the cascades is controlled by RpoS, while the other is controlled by LetE (Molofsky and Swanson, 2003). Both regulators confer a negative regulation on ankB. We show that all known regulatory pathways are involved in temporal regulation of the expression of ankB and we propose another signaling pathway through PmrA/B. In other pathogens, PmrA/B has been shown to be activated through many signals, such as pH change or iron levels, where both can occur during the stringent response (Wosten et al., 2000). The signals that trigger PmrA/B in L. pneumophila within the phagosome are still to be elucidated. Interestingly, although AnkB is required during early stages of infection of macrophages and protozoa, its expression is triggered at the PE phase, which is consistent with phenotypic modulation of the bacteria after they terminate proliferation in the host cell and prepare to infect a new susceptible cell in the human lung or in the aquatic environment.
Experimental Procedures
DNA manipulations
DNA manipulations and restriction enzyme digestions were performed using standard procedures (Stone and Abu Kwaik, 1998). Restriction enzymes and T4 DNA ligase were purchased from Promega (Madison, WI). L. pneumophila chromosomal DNA was prepared using the Puregene DNA isolation kit form Gentra Systems (Minneapolis, MN). Plasmid preparations were performed with the Bio-Rad Quantum miniprep kit. Purification of DNA fragments from agarose gels for subcloning was carried out with a QIAquick gel purification kit (Qiagen Inc, Valencia, CA). Fragments containing the L. pneumophila ankB gene were cloned into the plasmid vector pBC-SK+ from Stratagene, and the resulting clone was mutagenized using the EZ-Tn5TM <KAN-2> in vitro transposome insertion kit from Epicentre. Transformation of E. coli strain DH5α by electroporation was performed with a BTX ECM 630, as recommended by Invitrogen Corp. (Carlsbad, California). Mutations of the parental strain AA100 were carried out by allelic exchange with the mutagenized ankB clone after natural transformation, as previously described (Stone and Abu Kwaik, 1999; Stone et al., 1999). The isogenic ankB mutant was trans-complemented with the plasmid vector pBC-SK+ harboring the corresponding gene.Primers used to amplify the L. pneumophila ankB gene by PCR were synthesized by Integrated DNA Technologies,Inc. (Coralville, IA) and are as follows: for cloning of ankB (lpg2144, legAU13, lpl2072, lpp2082, lpc1593) genomic region (F:GCCGGACTTCATTCACTA and R:CCGCTGATCCTGGTAGTA), to amplify the coding sequence of ankB for Kanamycin insertion verification (F:TTGCTGCTATGAAAAAGA and R: CTTGCTCTGTGCTATTTT). To generate Cya-AnkB fusions, the ankB orf was PCR amplified from strain AA100, using primers listed in Table S1, to generate either full length AnkB or C-terminal truncations of the protein. PCR products were cloned into pCR2.1 via topoisomerization as described by the manufacturer (Invitrogen). ankB inserts were sub-cloned into the BamHI-PstI sites of pCYA-ralF (Nagai et al., 2005), resulting in replacement of the ralF gene with ankB or its truncated mutants in frame with cya. Recombinant plasmids were electroporated into AA100 and isogenic mutant derivatives ΔdotA, ΔicmS and ΔicmW. To verify that the ankB insertion mutant is not expressing truncated fragments of AnkB, we complemented both the WT strain and the ankB mutant using a clone of ankB with a deletion of the last 3 codons (AnkB1–169).
Bacterial strains and media
L. pneumophila serogroup I parental strain AA100/130b (ATCC BAA-74) and the mutants dotA, ankB, htrA, rpoS, relA, ΔrpoS-ΔrelA, letA, letS, letE, pmrA, and pmrB (Hammer et al., 2002; Pedersen et al., 2001) were grown from frozen stocks on buffered charcoal-yeast extract (BCYE) agar at 37°C or in buffered yeast extract (BYE) broth at 37°C with shaking. The plates and broth used for the cultivation of the mutant strains listed above were supplemented with thymidine (100μg ml−1), kanamycin (50 μg ml−1) or chloramphenicol (5 μg ml−1) as needed. Escherichia coli strain DH5α was used as surrogate to clone the ankB gene. E. coli strains were cultured with the appropriate antibiotic on Luria-Bertani (LB) agar plates at 37°C or in LB broth at 37°C with shaking.
Cell cultures
Isolation and preparation of the human monocyte-derived macrophages (hMDMs) from peripheral blood of volunteers and macrophage-like U937 cells was carried out as previously described (Doyle et al., 2001; Santic et al., 2005; Tilney et al., 2001). Cells were maintained in RPMI-1640 tissue culture medium (Mediatech) supplemented with 10% heat-inactivated fetal bovine serum FBS (Atlas Biologicals). Axenic Acanthamoeba polyphaga was cultured as adherent cells in PYG medium as previously described (Gao et al., 1997). All cells were grown at 37°C in presence of 5% CO2.
Intracellular growth kinetics
The bacterial strainswere grown in BYE medium to an optical density (OD550) of 2.0 to 2.2 (PE phase). The mammalian or protozoan cells were infected with the bacteria at a multiplicity of infection (MOI) of 10. To synchronize the infection, the plates were centrifuged for 5 min at 500Xg using a Centra GP8R Thermo IEC centrifuge. After 1 h of incubation in 5% CO2 at 37°C, the infected cells were washed 3 times with the culture medium to remove extracellular bacteria, and incubated with 50μg ml−1 gentamicin for 1 h to kill the remaining extracellular bacteria. The infected cells were washed 3 times to remove the gentamicin. This step was considered the zero (T0) time point and the infected cells were subsequently incubated for several time intervals. At the end of each time interval, the culture supernatant was removed and the macrophages were lysed hypotonically by the addition of 200 μl of sterile water for 10 min or with 0.04% Triton X-100 for protozoan cells. The supernatant and the lysates were combined, and serial dilutions were prepared and aliquots plated on BCYE plates for counting. The number of bacteria was expressed as the number of CFU ml−1. Three independent experiments, in triplicate, were performed.
Confocal laser scanning microscopy
Approximately 5 × 105 hMDMs were grown on circular glass coverslips (Fisher) in 24-well culture plates. After infection, cells were washed three times with warm RPMI containing 10% FBS, and processed for confocal microscopy as we described previously (Santic et al., 2005). To study the role of AnkB in intracellular replication, both wild type and the isogenic mutant were labeled with polyclonal rabbit anti-L. pneumophila antiserum (Pedersen et al., 2001) and Alexa Fluor 488-conjugated donkey anti-rabbit IgG purchased from Molecular Probes (Invitrogen, Carlsbad, CA). The anti-LAMP-2 (H4B4) monoclonal antibody (developed by J. T. August and J. E. K. Hildreth) was obtained from the Developmental Studies Hybridoma Bank (University of Iowa, IA, USA). To label the lysosomes, macrophages were incubated with mouse monoclonal anti-cathepsin D antibodies (BD Transduction, Franklin Lakes, NJ). Mouse anti-KDEL monoclonal antibodies purchased from StressGen Biotechnologies (Ann Arbor, Michigan) were used to label the ER proteins, followed by Alexa Fluor 555-conjugated donkey anti-mouseIgG (Molecular Probes). For the coinfection experiments, cells were coinfected simultaneously with the wild type strain of L. pneumophila expressing GFP (Coers et al., 1999; Pedersen et al., 2001) and isogenic mutants at a MOI of 10, with the exception of the dotA mutant using a MOI of 20. To synchronize the infection, the plates were centrifuged for 5 min at 500Xg using a Centra GP8R Thermo IEC centrifuge. After 1 h of incubation in CO2 at 37°C, the infected cells were washed 3 times with the culture medium to remove extracellular bacteria and incubated with 50μg ml−1 gentamicin for 1 h to kill the remaining extracellular bacteria. Infected cells were further incubated for 10 h and the cells were processed for confocal microscopy as described below. All bacteria were labeled with polyclonal rabbit anti-L. pneumophila anti-serum and Alexa Fluor 555-conjugated donkey anti-rabbit IgG antibody, and therefore, the GFP-expressing bacteria become yellow when the two colors are combined, while the bacterial strain that did not have GFP is detected by red fluorescence. The dotA and htrA mutants were used as positive and negative controls, respectively. For the superinfection, the cells were infected with one strain for 30 min, washed 3 times, incubated for 30 min with gentamicin to remove extracellular bacteria, and then infected with the second strain for another 30 min. The cells were then incubated for 30 min with gentamicin. The dotA mutant was used as negative control for in-trans rescue (Coers et al., 1999). The cells were examined using an Olympus Fv500 laser scanning confocal microscope as described previously (Santic et al., 2005). On average, 8–15 0.2 μm serial Z sections of each image were captured and stored for further analysis, using Adobe photoshop 6.0.
Transmission electron microscopy
For transmissionelectron microscopy, monolayers in six-well plates were infected with L. pneumophila strains at a MOI of 10 for 1 h, followed by 1 h of gentamicin treatment. At 6 hpost infection, the infected monolayers were washed and the cells were fixed in 3.5% glutaraldehyde, dehydrated in alcohol, processed and stained for TEM as described previously (Abu Kwaik, 1998). Sections were examined with a Hitachi H-7000/STEM electron microscope (Hitachi, Ltd.) at 80 kV (Gao et al., 1998; Molmeret et al., 2004).
Cya translocation assays
L. pneumophila strains used in this assay were plated on BCYE agar with antibiotic selection as required and incubated at 37°C for 3 days. U937 cells were plated into 24 well plates at a density of 5 × 105 per well and chemically differentiated using PMA (final concentration 50 ng ml−1), and incubated for 2 days at 37°C and 5% CO2 prior to infection. Bacteria were added to U937 monolayers (MOI of 50) and centrifuged at 200 g for 5 min. Infected monolayers were incubated at 37°C for 1 h, after which they were washed 3 times with PBS to remove extracellular bacteria, and subsequently lysed in 200 μl of 0.1M HCl + 0.5 % v/v Triton X-100. Cell lysates were centrifuged at 600 g for 5 min and supernatants were retained. cAMP levels in the supernatants were measured using the Direct Cyclic AMP Enzyme Immunoassay kit (Assay Designs) following the acetylation protocol as described by the manufacturer. Immunoblots of bacterial cell lysates probed with the anti-M45 peptide antibody and re-probed with the anti-CAT antibodies were performed according to standard procedures.
Quantitative Real Time PCR
For analysis of expression of the ankB gene in vitro, samples of bacterial cultures from the wild type strain AA100, the mutants letE, rpoS, relA, pmrA, pmrB, ΔrpoS-ΔrelA double mutant, letA, and letS, were grown in BYE medium to an optical density (OD550) of 0.8–1 (E phase) or 2.0–2.2 (PE phase). Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA) as recommended by the manufacturer. RNA integrity was assessed by visualizing ethidium bromide-stained 0.8% agarose gel. Total RNA was treated with DNase I (Ambion, Austin, TX) at 37°C for 30 min. Equal amounts of RNA from both the wild type and the ankB mutant were used for cDNA synthesis with Superscript III Plus RNase H− reverse transcriptase (RT) (Invitrogen, California) and random primers. The generated cDNA was diluted five-fold with RNase-free water. Real-time qPCR was done using the DNA Engine Opticon System (MJ Research), and carried out in triplicate using the DyNAmo SYBR Green qPCR Kit in a 20 μl reaction volume, as recommended by the manufacturer (New England Biolabs, Ipswich, MA). The ankB gene was amplified using the following primers (F: TATGGGGAAATCTTATGGTG and R: TCCAGAGGTAATTTGCAGTT), and the primers (F: GTTACCCACAGAAGAAGCAC and R: CCACTACCCTCTCCCATACT) were used to amplify the 16sRNA. The flaA gene was amplified by the two primers (F: CGATGGTTCTTTCTCTGG and R: GCTACTTCTGTTCCTGTTG). To verify the absence of detectable ankB mRNA in the ankB insertion mutant, we used the following primers (F: TTTTCTGATCTTCCTGAG and R: AGTTTGATATGCTTTTCCTT) to amplify the region (1–300 bp) upstream of the transposon insertion in ankB. PCR conditions were 5 min at 94°C, 15 s at 96°C, and 15 s at 72°C for 30 cycles. The concentration was determined by the comparative CT method (threshold cycle number at the cross-point between amplification plot and threshold) and values were normalized to the 16sRNA. Relative quantitation by quantitative reverse transcriptase PCR was validated by equivalent and linear amplification of 16sRNA and ankB gene at the assay concentrations. Negative or positive values were considered as down-regulation or up-regulation of expression of ankB, respectively, represented by a minimum of two-fold difference.
Statistical analysis
All experiments were performed at least three times and the data shown are representatives of one experiment. To analyze for statistically significant differences between different sets of data, the two-tail Student’s t-test was used and the p value was obtained.
Supplementary Material
Acknowledgments
YAK is supported by Public Health Service Awards R01AI43965 and R01AI069321 from NIAID and by the commonwealth of Kentucky Research Challenge Trust Fund. We thank Snake Jones for proofreading the manuscript.
References
- Abu-Zant A, Asare R, Graham JE, Abu Kwaik Y. Role for RpoS but not RelA of Legionella pneumophila in modulation of phagosome biogenesis and adaptation to the phagosomal microenvironment. Infect Immun. 2006;74:3021–3026. doi: 10.1128/IAI.74.5.3021-3026.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abu-Zant A, Jones S, Asare R, Suttles J, Price C, Graham J, Kwaik YA. Anti-apoptotic signalling by the Dot/Icm secretion system of L. pneumophila. Cell Microbiol. 2007;9:246–264. doi: 10.1111/j.1462-5822.2006.00785.x. [DOI] [PubMed] [Google Scholar]
- Abu Kwaik Y. Induced expression of the Legionella pneumophila gene encoding a 20-kilodalton protein during intracellular infection. Infect Immun. 1998;66:203–212. doi: 10.1128/iai.66.1.203-212.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abu Kwaik Y, Gao LY, Stone BJ, Venkataraman C, Harb OS. Invasion of protozoa by Legionella pneumophila and its role in bacterial ecology and pathogenesis. Appl Environ Microbiol. 1998;64:3127–3133. doi: 10.1128/aem.64.9.3127-3133.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amstutz P, Binz HK, Parizek P, Stumpp MT, Kohl A, Grutter MG, Forrer P, Pluckthun A. Intracellular kinase inhibitors selected from combinatorial libraries of designed ankyrin repeat proteins. J Biol Chem. 2005;280:24715–24722. doi: 10.1074/jbc.M501746200. [DOI] [PubMed] [Google Scholar]
- Bachman MA, Swanson MS. RpoS co-operates with other factors to induce Legionella pneumophila virulence in the stationary phase. Mol Microbiol. 2001;40:1201–1214. doi: 10.1046/j.1365-2958.2001.02465.x. [DOI] [PubMed] [Google Scholar]
- Bachman MA, Swanson MS. Genetic evidence that Legionella pneumophila RpoS modulates expression of the transmission phenotype in both the exponential phase and the stationary phase. Infect Immun. 2004;72:2468–2476. doi: 10.1128/IAI.72.5.2468-2476.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barbaree JM, Fields BS, Feeley JC, Gorman GW, Martin WT. Isolation of protozoa from water associated with a legionellosis outbreak and demonstration of intracellular multiplication of Legionella pneumophila. Appl Environ Microbiol. 1986;51:422–424. doi: 10.1128/aem.51.2.422-424.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Batchelor AH, Piper DE, de la Brousse FC, McKnight SL, Wolberger C. The structure of GABPalpha/beta: an ETS domain- ankyrin repeat heterodimer bound to DNA. Science. 1998;279:1037–1041. doi: 10.1126/science.279.5353.1037. [DOI] [PubMed] [Google Scholar]
- Bosshardt SC, Benson RF, Fields BS. Flagella are a positive predictor for virulence in Legionella. Microb Pathog. 1997;23:107–112. doi: 10.1006/mpat.1997.0134. [DOI] [PubMed] [Google Scholar]
- Bruggemann H, Hagman A, Jules M, Sismeiro O, Dillies MA, Gouyette C, Kunst F, Steinert M, Heuner K, Coppee JY, Buchrieser C. Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila. Cell Microbiol. 2006;8:1228–1240. doi: 10.1111/j.1462-5822.2006.00703.x. [DOI] [PubMed] [Google Scholar]
- Byrne B, Swanson MS. Expression of Legionella pneumophila virulence traits in response to growth conditions. Infect Immun. 1998;66:3029–3034. doi: 10.1128/iai.66.7.3029-3034.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cambronne ED, Roy CR. The Legionella pneumophila IcmSW complex interacts with multiple Dot/Icm effectors to facilitate type IV translocation. PLoS Pathog. 2007;3:e188. doi: 10.1371/journal.ppat.0030188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Campodonico EM, Chesnel L, Roy CR. A yeast genetic system for the identification and characterization of substrate proteins transferred into host cells by the Legionella pneumophila Dot/Icm system. Mol Microbiol. 2005;56:918–933. doi: 10.1111/j.1365-2958.2005.04595.x. [DOI] [PubMed] [Google Scholar]
- Caturegli P, Asanovich KM, Walls JJ, Bakken JS, Madigan JE, Popov VL, Dumler JS. ankA: an Ehrlichia phagocytophila group gene encoding a cytoplasmic protein antigen with ankyrin repeats. Infect Immun. 2000;68:5277–5283. doi: 10.1128/iai.68.9.5277-5283.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cazalet C, Rusniok C, Bruggemann H, Zidane N, Magnier A, Ma L, Tichit M, Jarraud S, Bouchier C, Vandenesch F, Kunst F, Etienne J, Glaser P, Buchrieser C. Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat Genet. 2004;36:1165–1173. doi: 10.1038/ng1447. [DOI] [PubMed] [Google Scholar]
- Cazalet C, Buchrieser C. What do we learn from the genome of Legionella pneumophila? Med Sci (Paris) 2005;21:455–457. doi: 10.1051/medsci/2005215455. [DOI] [PubMed] [Google Scholar]
- Cazalet C, Jarraud S, Ghavi-Helm Y, Kunst F, Glaser P, Etienne J, Buchrieser C. Multigenome analysis identifies a worldwide distributed epidemic Legionella pneumophila clone that emerged within a highly diverse species. Genome Res. 2008;18:431–441. doi: 10.1101/gr.7229808. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen J, de Felipe KS, Clarke M, Lu H, Anderson OR, Segal G, Shuman HA. Legionella effectors that promote nonlytic release from protozoa. Science. 2004;303:1358–1361. doi: 10.1126/science.1094226. [DOI] [PubMed] [Google Scholar]
- Chien M, Morozova I, Shi S, Sheng H, Chen J, Gomez SM, Asamani G, Hill K, Nuara J, Feder M, Rineer J, Greenberg JJ, Steshenko V, Park SH, Zhao B, Teplitskaya E, Edwards JR, Pampou S, Georghiou A, Chou IC, Iannuccilli W, Ulz ME, Kim DH, Geringer-Sameth A, Goldsberry C, Morozov P, Fischer SG, Segal G, Qu X, Rzhetsky A, Zhang P, Cayanis E, De Jong PJ, Ju J, Kalachikov S, Shuman HA, Russo JJ. The genomic sequence of the accidental pathogen Legionella pneumophila. Science. 2004;305:1966–1968. doi: 10.1126/science.1099776. [DOI] [PubMed] [Google Scholar]
- Coers J, Monahan C, Roy CR. Modulation of phagosome biogenesis by Legionella pneumophila creates an organelle permissive for intracellular growth. Nat Cell Biol. 1999;1:451–453. doi: 10.1038/15687. [DOI] [PubMed] [Google Scholar]
- Conover GM, Derre I, Vogel JP, Isberg RR. The Legionella pneumophila LidA protein: a translocated substrate of the Dot/Icm system associated with maintenance of bacterial integrity. Mol Microbiol. 2003;48:305–321. doi: 10.1046/j.1365-2958.2003.03400.x. [DOI] [PubMed] [Google Scholar]
- De Felipe KS, Pampou S, Jovanovic OS, Pericone CD, Ye SF, Kalachikov S, Shuman HA. Evidence for acquisition of Legionella type IV secretion substrates via interdomain horizontal gene transfer. J Bacteriol. 2005;187:7716–7726. doi: 10.1128/JB.187.22.7716-7726.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Derre I, Isberg RR. Legionella pneumophila replication vacuole formation involves rapid recruitment of proteins of the early secretory system. Infect Immun. 2004;72:3048–3053. doi: 10.1128/IAI.72.5.3048-3053.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dorer MS, Kirton D, Bader JS, Isberg RR. RNA interference analysis of Legionella in Drosophila cells: exploitation of early secretory apparatus dynamics. PLoS Pathog. 2006;2:e34. doi: 10.1371/journal.ppat.0020034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doyle RM, Cianciotto NP, Banvi S, Manning PA, Heuzenroeder MW. Comparison of virulence of Legionella longbeachae strains in guinea pigs and U937 macrophage-like cells. Infect Immun. 2001;69:5335–5344. doi: 10.1128/IAI.69.9.5335-5344.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Faulkner G, Garduno RA. Ultrastructural analysis of differentiation in Legionella pneumophila. J Bacteriol. 2002;184:7025–7041. doi: 10.1128/JB.184.24.7025-7041.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feldman M, Segal G. A pair of highly conserved two-component systems participates in the regulation of the hypervariable FIR proteins in different Legionella species. J Bacteriol. 2007;189:3382–3391. doi: 10.1128/JB.01742-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fields BS. The molecular ecology of legionellae. Trends Microbiol. 1996;4:286–290. doi: 10.1016/0966-842x(96)10041-x. [DOI] [PubMed] [Google Scholar]
- Gao L-Y, Harb OS, Abu Kwaik Y. Utilization of similar mechanisms by Legionella pneumophila to parasitize two evolutionarily distant hosts, mammalian and protozoan cells. Infect Immun. 1997;65:4738–4746. doi: 10.1128/iai.65.11.4738-4746.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao LY, Harb OS, Abu Kwaik Y. Identification of macrophage-specific infectivity loci (mil) of Legionella pneumophila that are not required for infectivity of protozoa. Infect Immun. 1998;66:883–892. doi: 10.1128/iai.66.3.883-892.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Glockner G, Albert-Weissenberger C, Weinmann E, Jacobi S, Schunder E, Steinert M, Hacker J, Heuner K. Identification and characterization of a new conjugation/type IVA secretion system (trb/tra) of Legionella pneumophila Corby localized on two mobile genomic islands. Int J Med Microbiol. 2007 doi: 10.1016/j.ijmm.2007.07.012. [DOI] [PubMed] [Google Scholar]
- Habyarimana F, Al-Khodor S, Kalia A, Graham JE, Price CT, Garcia MT, Kwaik YA. Role for the Ankyrin eukaryotic-like genes of Legionella pneumophila in parasitism of protozoan hosts and human macrophages. Environ Microbiol. 2008;10:1460–1474. doi: 10.1111/j.1462-2920.2007.01560.x. [DOI] [PubMed] [Google Scholar]
- Hales LM, Shuman HA. The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii. J Bacteriol. 1999;181:4879–4889. doi: 10.1128/jb.181.16.4879-4889.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hammer BK, Swanson MS. Co-ordination of Legionella pneumophila virulence with entry into stationary phase by ppGpp. Mol Microbiol. 1999;33:721–731. doi: 10.1046/j.1365-2958.1999.01519.x. [DOI] [PubMed] [Google Scholar]
- Hammer BK, Tateda ES, Swanson MS. A two-component regulator induces the transmission phenotype of stationary-phase Legionella pneumophila. Mol Microbiol. 2002;44:107–118. doi: 10.1046/j.1365-2958.2002.02884.x. [DOI] [PubMed] [Google Scholar]
- Hilbi H, Weber SS, Ragaz C, Nyfeler Y, Urwyler S. Environmental predators as models for bacterial pathogenesis. Environ Microbiol. 2007;9:563–575. doi: 10.1111/j.1462-2920.2007.01238.x. [DOI] [PubMed] [Google Scholar]
- Horwitz MA. Formation of a novel phagosome by the Legionnaires' disease bacterium (Legionella pneumophila) in human monocytes. J Exp Med. 1983;158:1319–1331. doi: 10.1084/jem.158.4.1319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Howell ML, Alsabbagh E, Ma JF, Ochsner UA, Klotz MG, Beveridge TJ, Blumenthal KM, Niederhoffer EC, Morris RE, Needham D, Dean GE, Wani MA, Hassett DJ. AnkB, a periplasmic ankyrin-like protein in Pseudomonas aeruginosa, is required for optimal catalase B (KatB) activity and resistance to hydrogen peroxide. J Bacteriol. 2000;182:4545–4556. doi: 10.1128/jb.182.16.4545-4556.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- IJdo J, Carlson AC, Kennedy EL. Anaplasma phagocytophilum AnkA is tyrosine-phosphorylated at EPIYA motifs and recruits SHP-1 during early infection. Cell Microbiol. 2007;9:1284–1296. doi: 10.1111/j.1462-5822.2006.00871.x. [DOI] [PubMed] [Google Scholar]
- Johnston JB, Wang G, Barrett JW, Nazarian SH, Colwill K, Moran M, McFadden G. Myxoma virus M-T5 protects infected cells from the stress of cell cycle arrest through its interaction with host cell cullin-1. J Virol. 2005;79:10750–10763. doi: 10.1128/JVI.79.16.10750-10763.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kagan JC, Roy CR. Legionella phagosomes intercept vesicular traffic from endoplasmic reticulum exit sites. Nat Cell Biol. 2002;4:945–954. doi: 10.1038/ncb883. [DOI] [PubMed] [Google Scholar]
- Kagan JC, Stein MP, Pypaert M, Roy CR. Legionella subvert the functions of rab1 and sec22b to create a replicative organelle. J Exp Med. 2004;199:1201–1211. doi: 10.1084/jem.20031706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaufmann AF, McDade JE, Patton CM, Bennett JV, Skaliy P, Feeley JC, Anderson DC, Potter ME, Newhouse VF, Gregg MB, Brachman PS. Pontiac fever: isolation of the etiologic agent (Legionella pneumophilia) and demonstration of its mode of transmission. Am J Epidemiol. 1981;114:337–347. doi: 10.1093/oxfordjournals.aje.a113200. [DOI] [PubMed] [Google Scholar]
- Kitazawa M, Yamakuni T, Song SY, Kato C, Tsuchiya R, Ishida M, Suzuki N, Adachi E, Iwashita S, Ueno S, Yanagihara N, Taoka M, Isobe T, Ohizumi Y. Intracellular cAMP controls a physical association of V-1 with CapZ in cultured mammalian endocrine cells. Biochem Biophys Res Commun. 2005;331:181–186. doi: 10.1016/j.bbrc.2005.03.127. [DOI] [PubMed] [Google Scholar]
- Kubori T, Hyakutake A, Nagai H. Legionella translocates an E3 ubiquitin ligase that has multiple U-boxes with distinct functions. Mol Microbiol. 2008;67:1307–1319. doi: 10.1111/j.1365-2958.2008.06124.x. [DOI] [PubMed] [Google Scholar]
- Laguna RK, Creasey EA, Li Z, Valtz N, Isberg RR. A Legionella pneumophila-translocated substrate that is required for growth within macrophages and protection from host cell death. Proc Natl Acad Sci USA. 2006;103:18745–18750. doi: 10.1073/pnas.0609012103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Y, Luo ZQ. The Legionella pneumophila effector SidJ is required for efficient recruitment of endoplasmic reticulum proteins to the bacterial phagosome. Infect Immun. 2007;75:592–603. doi: 10.1128/IAI.01278-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luo ZQ, Isberg RR. Multiple substrates of the Legionella pneumophila Dot/Icm system identified by interbacterial protein transfer. Proc Natl Acad Sci USA. 2004;101:841–846. doi: 10.1073/pnas.0304916101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Magliery TJ, Regan L. Sequence variation in ligand binding sites in proteins. BMC Bioinformatics. 2005;6:240. doi: 10.1186/1471-2105-6-240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marra A, Blander SJ, Horwitz MA, Shuman HA. Identification of a Legionella pneumophila locus required for intracellular multiplication in human macrophages. Proc Natl Acad Sci USA. 1992;89:9607–9611. doi: 10.1073/pnas.89.20.9607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mercer AA, Fleming SB, Ueda N. F-box-like domains are present in most poxvirus ankyrin repeat proteins. Virus Genes. 2005;31:127–133. doi: 10.1007/s11262-005-1784-z. [DOI] [PubMed] [Google Scholar]
- Michel F, Soler-Lopez M, Petosa C, Cramer P, Siebenlist U, Muller CW. Crystal structure of the ankyrin repeat domain of Bcl-3: a unique member of the IkappaB protein family. Embo J. 2001;20:6180–6190. doi: 10.1093/emboj/20.22.6180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Molmeret M, Bitar DM, Han L, Kwaik YA. Cell biology of the intracellular infection by Legionella pneumophila. Microbes Infect. 2004;6:129–139. doi: 10.1016/j.micinf.2003.11.004. [DOI] [PubMed] [Google Scholar]
- Molmeret M, Horn M, Wagner M, Santic M, Abu Kwaik Y. Amoebae as training grounds for intracellular bacterial pathogens. Appl Environ Microbiol. 2005;71:20–28. doi: 10.1128/AEM.71.1.20-28.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Molmeret M, Santic M, Asare R, Carabeo RA, Abu Kwaik Y. Rapid escape of the dot/icm mutants of Legionella pneumophila into the cytosol of mammalian and protozoan cells. Infect Immun. 2007;75:3290–3304. doi: 10.1128/IAI.00292-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Molofsky AB, Swanson MS. Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol Microbiol. 2003;50:445–461. doi: 10.1046/j.1365-2958.2003.03706.x. [DOI] [PubMed] [Google Scholar]
- Mosavi LK, Minor DL, Jr, Peng ZY. Consensus-derived structural determinants of the ankyrin repeat motif. Proc Natl Acad Sci USA. 2002a;99:16029–16034. doi: 10.1073/pnas.252537899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mosavi LK, Williams S, Peng ZY. Equilibrium folding and stability of myotrophin: a model ankyrin repeat protein. J Mol Biol. 2002b;320:165–170. doi: 10.1016/S0022-2836(02)00441-2. [DOI] [PubMed] [Google Scholar]
- Mosavi LK, Cammett TJ, Desrosiers DC, Peng ZY. The ankyrin repeat as molecular architecture for protein recognition. Protein Sci. 2004;13:1435–1448. doi: 10.1110/ps.03554604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Murata T, Delprato A, Ingmundson A, Toomre DK, Lambright DG, Roy CR. The Legionella pneumophila effector protein DrrA is a Rab1 guanine nucleotide-exchange factor. Nat Cell Biol. 2006;8:971–977. doi: 10.1038/ncb1463. [DOI] [PubMed] [Google Scholar]
- Nagai H, Cambronne ED, Kagan JC, Amor JC, Kahn RA, Roy CR. A C-terminal translocation signal required for Dot/Icm-dependent delivery of the Legionella RalF protein to host cells. Proc Natl Acad Sci USA. 2005;102:826–831. doi: 10.1073/pnas.0406239101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ninio S, Zuckman-Cholon DM, Cambronne ED, Roy CR. The Legionella IcmS-IcmW protein complex is important for Dot/Icm-mediated protein translocation. Mol Microbiol. 2005;55:912–926. doi: 10.1111/j.1365-2958.2004.04435.x. [DOI] [PubMed] [Google Scholar]
- Ogata H, Robert C, Audic S, Robineau S, Blanc G, Fournier PE, Renesto P, Claverie JM, Raoult D. Rickettsia felis, from culture to genome sequencing. Ann NY Acad Sci. 2005;1063:26–34. doi: 10.1196/annals.1355.004. [DOI] [PubMed] [Google Scholar]
- Park J, Kim KJ, Choi KS, Grab DJ, Dumler JS. Anaplasma phagocytophilum AnkA binds to granulocyte DNA and nuclear proteins. Cell Microbiol. 2004;6:743–751. doi: 10.1111/j.1462-5822.2004.00400.x. [DOI] [PubMed] [Google Scholar]
- Pedersen LL, Radulic M, Doric M, Abu Kwaik Y. HtrA homologue of Legionella pneumophila: an indispensable element for intracellular infection of mammalian but not protozoan cells. Infect Immun. 2001;69:2569–2579. doi: 10.1128/IAI.69.4.2569-2579.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rowbotham TJ. Preliminary report on the pathogenicity of Legionella pneumophila for freshwater and soil amoebae. J Clin Pathol. 1980;33:1179–1183. doi: 10.1136/jcp.33.12.1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santic M, Molmeret M, Abu Kwaik Y. Maturation of the Legionella pneumophila-containing phagosome into a phagolysosome within gamma interferon-activated macrophages. Infect Immun. 2005;73:3166–3171. doi: 10.1128/IAI.73.5.3166-3171.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Segal G, Shuman HA. Legionella pneumophila utilizes the same genes to multiply within Acanthamoeba castellanii and human macrophages. Infect Immun. 1999;67:2117–2124. doi: 10.1128/iai.67.5.2117-2124.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seshadri R, Paulsen IT, Eisen JA, Read TD, Nelson KE, Nelson WC, Ward NL, Tettelin H, Davidsen TM, Beanan MJ, Deboy RT, Daugherty SC, Brinkac LM, Madupu R, Dodson RJ, Khouri HM, Lee KH, Carty HA, Scanlan D, Heinzen RA, Thompson HA, Samuel JE, Fraser CM, Heidelberg JF. Complete genome sequence of the Q-fever pathogen Coxiella burnetii. Proc Natl Acad Sci USA. 2003;100:5455–5460. doi: 10.1073/pnas.0931379100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shohdy N, Efe JA, Emr SD, Shuman HA. Pathogen effector protein screening in yeast identifies Legionella factors that interfere with membrane trafficking. Proc Natl Acad Sci USA. 2005;102:4866–4871. doi: 10.1073/pnas.0501315102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sory MP, Cornelis GR. Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol. 1994;14:583–594. doi: 10.1111/j.1365-2958.1994.tb02191.x. [DOI] [PubMed] [Google Scholar]
- Steinert M, Heuner K, Buchrieser C, Albert-Weissenberger C, Glockner G. Legionella pathogenicity: genome structure, regulatory networks and the host cell response. Int J Med Microbiol. 2007;297:577–587. doi: 10.1016/j.ijmm.2007.03.009. [DOI] [PubMed] [Google Scholar]
- Stone BJ, Abu Kwaik Y. Expression of multiple pili by Legionella pneumophila: Identification and characterization of a type IV pilin gene and its role in adherence to mammalian and protozoan cells. Infect Immun. 1998;66:1768–1775. doi: 10.1128/iai.66.4.1768-1775.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stone BJ, Abu Kwaik Y. Natural competency for DNA uptake by Legionella pneumophila and its association with expression of type IV pili. J Bacteriol. 1999;181:1395–1402. doi: 10.1128/jb.181.5.1395-1402.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stone BJ, Brier A, Kwaik YA. The Legionella pneumophila prp locus; required during infection of macrophages and amoebae. Microb Pathog. 1999;27:369–376. doi: 10.1006/mpat.1999.0311. [DOI] [PubMed] [Google Scholar]
- Tilney LG, Harb OS, Connelly PS, Robinson CG, Roy CR. How the parasitic bacterium Legionella pneumophila modifies its phagosome and transforms it into rough ER: implications for conversion of plasma membrane to the ER membrane. J Cell Sci. 2001;114:4637–4650. doi: 10.1242/jcs.114.24.4637. [DOI] [PubMed] [Google Scholar]
- Vogel JP, Andrews HL, Wong SK, Isberg RR. Conjugative transfer by the virulence system of Legionella pneumophila. Science. 1998;279:873–876. doi: 10.1126/science.279.5352.873. [DOI] [PubMed] [Google Scholar]
- Winn WC., Jr Legionnaires disease: historical perspective. Clin Microbiol Rev. 1988;1:60–81. doi: 10.1128/cmr.1.1.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wosten MM, Kox LF, Chamnongpol S, Soncini FC, Groisman EA. A signal transduction system that responds to extracellular iron. Cell. 2000;103:113–125. doi: 10.1016/s0092-8674(00)00092-1. [DOI] [PubMed] [Google Scholar]
- Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, McGraw EA, Martin W, Esser C, Ahmadinejad N, Wiegand C, Madupu R, Beanan MJ, Brinkac LM, Daugherty SC, Durkin AS, Kolonay JF, Nelson WC, Mohamoud Y, Lee P, Berry K, Young MB, Utterback T, Weidman J, Nierman WC, Paulsen IT, Nelson KE, Tettelin H, O'Neill SL, Eisen JA. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2004;2:E69. doi: 10.1371/journal.pbio.0020069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zusman T, Aloni G, Halperin E, Kotzer H, Degtyar E, Feldman M, Segal G. The response regulator PmrA is a major regulator of the icm/dot type IV secretion system in Legionella pneumophila and Coxiella burnetii. Mol Microbiol. 2007;63:1508–1523. doi: 10.1111/j.1365-2958.2007.05604.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
