Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2011 Jan 14;77(5):1900–1903. doi: 10.1128/AEM.01934-10

Gene Cluster Conferring Streptomycin, Sulfonamide, and Tetracycline Resistance in Escherichia coli O157:H7 Phage Types 23, 45, and 67 ▿

K Ziebell 1,*, R P Johnson 1, A M Kropinski 1, R Reid-Smith 1, R Ahmed 3, V P Gannon 2, M Gilmour 3, P Boerlin 4
PMCID: PMC3067293  PMID: 21239555

Abstract

Multidrug resistance to streptomycin, sulfonamide, and tetracycline (AMR-SSuT) was identified in 156 of 171 isolates of Escherichia coli O157:H7 of phage types 23, 45, and 67. In 154 AMR-SSuT isolates, resistance was encoded by strA, strB, sul2, and tet(B), which in 59 of 63 tested isolates were found clustered together on the chromosome within the cdiA locus.


Shiga toxin (Stx)-producing Escherichia coli (STEC) O157:H7 (STEC O157) is the most prominent STEC serotype, causing hemorrhagic colitis and hemolytic-uremic syndrome in many countries (12). Cattle colonized with STEC O157 are important animal reservoirs of this zoonotic pathogen, which is frequently transmitted to humans through manure-contaminated foods, water, and other environmental sources (12). Factors that enhance the survival of STEC O157 in cattle and the cattle-rearing environment may contribute to increased frequency and transmission among cattle (26, 30).

Antimicrobial resistance (AMR) can potentially contribute to enhanced survival of STEC O157 in cattle, particularly under intensive rearing conditions where antimicrobials are frequently used therapeutically and for disease prevention and growth promotion (7, 21). AMR in STEC O157 may also be relevant clinically, although antimicrobial therapy in STEC-infected patients remains controversial (11, 25). While uncommon in early investigations (5, 16), AMR in STEC O157 isolates is increasing, with the most common being single-drug or most often multidrug resistance to streptomycin, sulfonamide, and tetracycline (AMR-SSuT) (2, 16, 22, 24, 27, 29, 30). The high frequency of AMR-SSuT reported among STEC O157 isolates may in part reflect the common use of these antibiotics for growth promotion and disease prevention in food animals (2, 3, 6, 9). However, AMR may persist in the absence of these antimicrobials if the resistance genes are linked with genes conferring a selective advantage in a specific niche, as exemplified by an increase in AMR-SSuT calf fecal E. coli following the use of a dietary supplement with or without oxytetracycline (14).

Our recent phenotypic AMR tests of 187 Canadian STEC O157 isolates (30) revealed that while most were susceptible to many antibiotics, 45 (24%) had only AMR-SSuT. Forty-three of these belonged to only 3 of the 17 tested phage types (PTs), namely, PTs 23, 45, and 67, strongly suggesting a PT bias to AMR-SSuT. A possible PT bias to AMR-SSuT has also been noted in Spanish STEC O157 isolates of PTs 2, 21/28, 23, 26, 32, 45, and 54 (22); although five of these PTs were represented by ≤10 strains, most isolates were also resistant to other antimicrobials, and the frequency of AMR-SSuT was generally lower than the >95% found in our study (30). Due to the low numbers of AMR-SSuT strains in our initial study and the lack of investigation of the genetic basis for AMR-SSuT in both studies, we tested a larger collection of Canadian isolates of PTs 23, 45, and 67. Our objectives were to confirm a PT bias to AMR-SSuT in these PTs and, if confirmed, to determine the nature and location of the genes encoding this multidrug resistance.

Bacterial strains and AMR.

The 171 STEC O157 strains of PTs 23, 45, and 67 for investigation were submitted to the National Microbiology Laboratory and the Laboratory for Foodborne Zoonoses from nine Canadian provinces between 1993 and 2007. They were mostly epidemiologically unrelated and comprised 104 PT 23 strains (79 human, 24 bovine, 1 environmental), 50 PT 45 strains (41 human, 9 bovine), and 17 PT 67 strains (2 human, 8 bovine, 7 environmental). Phage types were confirmed as described previously (15). Genotyping by the lineage-specific polymorphism assay (LSPA-6) (28) classified all the strains as E. coli O157:H7 lineage II (17). All strains were tested for sulfonamide, tetracycline, β-lactam, and aminoglycoside resistance genes by PCR (18) and phenotypically for susceptibility to SSuT and 13 other antimicrobials by broth microdilution testing (Sensititer; TREK Diagnostic Systems, Inc., Cleveland, OH) (18). The breakpoint for streptomycin was set at 32 μg/ml (4). Overall, phenotypic AMR-SSuT was evident in 156 (91.2%) of the 171 strains and in 88.5 to 100% of individual PT 23, 45, and 67 strains (Table 1), confirming the high frequency of this AMR profile among strains of these PTs (30). Resistance to other antimicrobials was infrequent (data not shown). The concordance between phenotypic AMR results and PCR detection of SSuT genes was 100% (Table 1). Notably, in 154 (99%) of the 156 resistant isolates, phenotypic AMR-SSuT was associated with the presence of strA, strB, sul2, and tet(B), a gene combination found in other E. coli isolates (4, 10, 13). The remaining two AMR-SSuT strains had aadA, sul1, and tet(A), a combination of genes also reported in STEC by others (20, 29).

TABLE 1.

Frequency of phenotypic resistance and genes encoding resistance to streptomycin, sulfonamides and tetracycline (SSuT) in phage types 23, 45, and 67 of STEC O157

Phage type Source n No. (%) with SSuT resistance phenotype No. (%) of resistant strains with resistance genes:
strA strB sul2 tet(B) aadA sul1 tet(A)
23 Human 79 69 (87.3) 67 (97.1) 2 (2.9)
Bovine 24 22 (91.7) 22 (100) 0 (0)
Other 1 1 (100) 1 (100) 0 (0)
Total 104 92 (88.5) 90 (97.8) 2 (0.2)
45 Human 41 38 (92.7) 38 (100) 0 (0)
Bovine 9 9 (100) 9 (100) 0 (0)
Other 0 NAa NA NA
Total 50 47 (94) 47 (100) 0 (0)
67 Human 2 2 (100) 2 (100) 0 (0)
Bovine 8 8 (100) 8 (100) 0 (0)
Other 7 7 (100) 7 (100) 0 (0)
Total 17 17 (100) 17 (100) 0 (0)
Total 171 156 (91.2) 154 (98.7) 2 (1.3)
a

NA, not applicable.

Location of resistance genes.

The location of the resistance genes was investigated by Southern hybridization. Briefly, genomic DNA from two AMR-SSuT strains of each PT and the appropriate controls (18) was extracted using the BioRobot EZ1 (Qiagen, Hilden, Germany) with the EZ1 DNA kit (Qiagen) and digested with an excess of restriction endonuclease EcoRI (New England BioLabs). Plasmid DNA was isolated from the same strains using the Qiagen minikit (Qiagen). Both DNAs were subjected to electrophoresis in a horizontal 0.7% agarose gel, transferred to nylon membranes, and probed with digoxigenin-labeled tet(B), strA, strB, and sul2 probes (19). The blots revealed one discrete band with each probe in total genomic DNA but not in plasmid DNA (data not shown). Furthermore, the AMR-SSuT genes were present on a single 14.96-kb ClaI fragment (data not shown), indicating that they are clustered together.

Sequencing of SSuT resistance genes.

The cluster of genes encoding AMR-SSuT was identified after cloning and sequencing of the 14.96-kb ClaI restriction fragment containing the AMR-SSuT genes from a PT 23 strain, EC20020119. The restriction fragments were cloned into E. coli DH10B using the BIG Easy V 2.0 linear cloning kit containing the pJAZZ-OK blunt vector (catalog number 43036-1; Lucigen Corporation, Middleton, WI). Transformants were tested by the disk diffusion method (Becton Dickinson and Company, Sparks, MD) (23) for resistance to tetracycline (30 μg/ml) and sulfonamide (300 μg/ml) but not for streptomycin resistance, which was present in the recipient strain E. coli DH10B. Small zones of inhibition of the transformants by tetracycline indicated they were less resistant to tetracycline than the donor strain EC20020119, which showed no zone of inhibition. Sequencing (Laboratory Services Division, University of Guelph, Canada) of a fragment generated by primer walking on the plasmid of one transformant revealed an insert containing the AMR-SSuT gene cluster and 5 kb of flanking sequence to the right. The last 50 bases of tet(B) on the left side of the cloned fragment were missing, which may account for the lower tetracycline resistance of the transformants. A BLASTN search of the whole genome shotgun database (NCBI) identified a 99% match with the recently sequenced STEC O157 strain EC869, isolated in the United States (GenBank accession number NZ_ABHU01000020).

To ascertain if the regions flanking the AMR-SSuT gene cluster in our STEC O157 strains and EC869 were the same, primers designed from the EC869 sequence were used to create overlapping PCR products from strain EC20020119 that were subsequently sequenced. The sequenced 32.76-kb fragment of EC20020119 (GenBank accession number HQ018801) comprising the 12.47-kb AMR-SSuT gene cluster, 16.55 kb of the right flanking region, and 3.6 kb of the left flanking region (Fig. 1) is 99% identical to that of the sequenced strain EC869. Analysis of the 32.76-kb region with Kodon (Applied Maths, Austin, TX) identified 40 potential open reading frames (ORFs). The ORFs included the AMR gene cluster (Fig. 1), hypothetical proteins, and ORFs for truncated genes (pseudogenes) that included an adhesin, GTPase, and partial transposases. Preceding the AMR-SSuT gene cluster was a 151-bp potential ORF that shared 94% identity with nucleotides 12988 to 13137 of the larger cdiA gene (9.37 kb) (GenBank accession number DQ100454.1). The cdiA gene is part of a contact-dependent inhibition system (1). Following the AMR-SSuT gene cluster is a 471-bp ORF that shared 85% identity with nucleotides 13198 to 13556 of the cdiA gene. This suggests that the AMR-SSuT gene cluster was inserted within a truncated cdiA gene. A BLASTN search of the nucleotide collection database (NCBI) for the sequence of the AMR-SSuT gene cluster (Fig. 1) revealed similarity to a SSuT resistance element in a commensal E. coli strain, although the order of the genes is slightly different (13). This sequence was derived from an isolate representing bovine fecal commensal E. coli strains that have a similar and widespread AMR-SSuT (13).

FIG. 1.

FIG. 1.

The streptomycin, sulfonamide, and tetracycline resistance gene cluster and flanking regions in Escherichia coli O157:H7 of phage types 23, 45, and 67. The locations of the primers for long-range PCR amplification of the region are shown above the map.

Occurrence of the AMR gene cluster in STEC O157 PTs 23, 45, and 67.

To determine if the AMR-SSuT gene cluster is similarly located in EC20020119 and other STEC O157 PT 23, 45, and 67 strains, restriction enzyme analysis was applied to amplicons of the AMR-SSuT and flanking regions of a subset of 63 of the original 171 strains. The amplicons were generated by two long-range PCRs (Expand Long Template PCR system; Roche). The two primer sets (Target 1 upper, CTAAAAGCCCTCACATTCCAGACCAC, and Target 1 lower, ACCGAGCAAGAGCGCGACACTAT; Target 2 upper, CGACAAATAAACACCAGACAAAAG, and Target 2 lower, TCGAAACTGACAGAAGATCAGAAG) were designed to amplify the entire AMR-SSuT gene cluster and the flanking regions (Fig. 1). Amplified products were purified (Montage PCR units; Millipore, Bedford, MA) and digested with HincII (New England BioLabs, Pickering, Ontario, Canada), and the restriction fragments of the two PCRs were separated by 1% agarose gel electrophoresis. Of the 63 isolates tested, 59 (94%) shared the same restriction profile as strain EC20020119, strongly suggesting that this AMR-SSuT gene cluster occurs at the same chromosomal location in STEC O157 of PTs 23, 45, and 67.

The PT bias suggests that the AMR-SSuT gene cluster could be selectively transferred to STEC O157 strains of these PTs only. However, this is improbable because the gene cluster is in precisely the same location in the chromosome in all three PTs, i.e., within the cdiA locus. It is more likely that the AMR-SSuT gene cluster was integrated stably into the chromosome before differentiation into these PTs. The lysis profiles of the 16 typing phages on PT 23, 45, and 67 strains are highly similar, and a clustering analysis of the phage lysis profiles of all 88 possible PTs shows that PTs 23, 45, and 67 cluster together (data not shown). These findings indicate a high degree of similarity among these PTs and support the likelihood of a strong evolutionary relationship. Classification of all isolates of these three PTs as LSPA-6 lineage II strains regardless of source further supports their relatedness. It also may indicate that the AMR-SSuT cluster is simply a marker for lineage II strains of PT 23, 45, and 67.

The AMR-SSuT identified in STEC O157 PTs 23, 45, and 67 possibly favors their persistence in cattle treated with these antimicrobials. However, mechanisms other than AMR clearly contribute to persistence in cattle, since isolates of STEC O157 PT 14, the most common PT isolated from humans and cattle (8), are sensitive to most antimicrobials (30). Also, as noted earlier, commensal E. coli with this AMR-SSuT may persist and thrive in the absence of these antimicrobials due to linkages of the AMR genes with others that confer advantages under specific conditions (14). However, it is not known if STEC O157 strains with a similar AMR-SSuT gene cluster also thrive under conditions without antimicrobials. Nor is the frequency of AMR-SSuT known in all STEC O157 PTs. In our preliminary study (30), we tested 17 of the 88 possible PTs of STEC O157, while those tested by Mora and others (22) included only seven additional PTs. Testing of other STEC O157 PTs would be required to determine if they possess the AMR-SSuT gene cluster characterized in this report.

In summary, the present study confirms the high frequency (91%) of AMR-SSuT in Canadian STEC O157 strains of PTs 23, 45, and 67. In almost all strains, this resistance is encoded by chromosomally located strA, strB, sul2, and tet(B) genes that are clustered in a single AMR locus, probably located at the same site in the cdiA locus.

Nucleotide sequence accession number.

The 32.76-kb fragment that was obtained from STEC O157 strain EC20020119 was deposited in GenBank (accession number HQ018801).

Acknowledgments

We thank the Public Health Laboratories of Newfoundland and Labrador, Prince Edward Island, Nova Scotia, New Brunswick, Quebec, Ontario, Manitoba, Saskatchewan, and Alberta for their contributions of STEC O157 strains for inclusion in this study. We also thank Irene Yong, Shelley Frost, Jason De Melo, and Shaun Kernaghan for their technical assistance.

Footnotes

▿

Published ahead of print on 14 January 2011.

REFERENCES

  • 1.Aoki, S. K., et al. 2005. Contact-dependent inhibition of growth in Escherichia coli. Science 309:1245-1248. [DOI] [PubMed] [Google Scholar]
  • 2.Aslam, M., K. Stanford, and T. A. McAllister. 2010. Characterization of antimicrobial resistance and seasonal prevalence of Escherichia coli O157:H7 recovered from commercial feedlots in Alberta, Canada. Lett. Appl. Microbiol. 50:320-326. [DOI] [PubMed] [Google Scholar]
  • 3.Berge, A. C., P. Lindeque, D. A. Moore, and W. M. Sischo. 2005. A clinical trial evaluating prophylactic and therapeutic antibiotic use on health and performance of preweaned calves. J. Dairy Sci. 88:2166-2177. [DOI] [PubMed] [Google Scholar]
  • 4.Boerlin, P., et al. 2005. Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario. Appl. Environ. Microbiol. 71:6753-6761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bopp, C. A., et al. 1987. Unusual verotoxin-producing Escherichia coli associated with hemorrhagic colitis. J. Clin. Microbiol. 25:1486-1489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Braidwood, J. C., and N. W. Henry. 1990. Clinical efficacy of chlortetracycline hydrochloride administered in milk replacer to calves. Vet. Rec. 127:297-301. [PubMed] [Google Scholar]
  • 7.Call, D. R., M. A. Davis, and A. A. Sawant. 2008. Antimicrobial resistance in beef and dairy cattle production. Anim. Health Res. Rev. 9:159-167. [DOI] [PubMed] [Google Scholar]
  • 8.Demczuk, W. H. B. 2005. Laboratory surveillance data for enteric pathogens in Canada; annual summary 2002 and 2003. National Microbiology Laboratory for Enteric Pathogens, National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, Manitoba, Canada.
  • 9.Donovan, D. C., S. T. Franklin, C. C. Chase, and A. R. Hippen. 2002. Growth and health of Holstein calves fed milk replacers supplemented with antibiotics or Enteroguard. J. Dairy Sci. 85:947-950. [DOI] [PubMed] [Google Scholar]
  • 10.Enne, V. I., C. Cassar, K. Sprigings, M. J. Woodward, and P. M. Bennett. 2008. A high prevalence of antimicrobial resistant Escherichia coli isolated from pigs and a low prevalence of antimicrobial resistant E. coli from cattle and sheep in Great Britain at slaughter. FEMS Microbiol. Lett. 278:193-199. [DOI] [PubMed] [Google Scholar]
  • 11.Ikeda, K., et al. 2000. Predictors for the development of haemolytic uraemic syndrome with Escherichia coli O157:H7 infections: with focus on the day of illness. Epidemiol. Infect. 124:343-349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Karmali, M. A., V. Gannon, and J. M. Sargeant. 2010. Verocytotoxin-producing Escherichia coli (VTEC). Vet. Microbiol. 140:360-370. [DOI] [PubMed] [Google Scholar]
  • 13.Khachatryan, A. R., T. E. Besser, and D. R. Call. 2008. The streptomycin-sulfadiazine-tetracycline antimicrobial resistance element of calf-adapted Escherichia coli is widely distributed among isolates from Washington State cattle. Appl. Environ. Microbiol. 74:391-395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Khachatryan, A. R., T. E. Besser, D. D. Hancock, and D. R. Call. 2006. Use of a nonmedicated dietary supplement correlates with increased prevalence of streptomycin-sulfa-tetracycline-resistant Escherichia coli on a dairy farm. Appl. Environ. Microbiol. 72:4583-4588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Khakhria, R., D. Duck, and H. Lior. 1990. Extended phage typing scheme for Escherichia coli 0157:H7. Epidemiol. Infect. 105:511-520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kim, H. H., et al. 1994. Characteristics of antibiotic-resistant Escherichia coli O157:H7 in Washington State, 1984-1991. J. Infect. Dis. 170:1606-1609. [DOI] [PubMed] [Google Scholar]
  • 17.Kim, J., J. Nietfeldt, and A. K. Benson. 1999. Octamer-based genome scanning distinguishes a unique subpopulation of Escherichia coli O157:H7 strains in cattle. Proc. Natl. Acad. Sci. U. S. A. 96:13288-13293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kozak, G. K., P. Boerlin, N. Janecko, R. J. Reid-Smith, and C. Jardine. 2009. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 75:559-566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lanz, R., P. Kuhnert, and P. Boerlin. 2003. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. Microbiol. 91:73-84. [DOI] [PubMed] [Google Scholar]
  • 20.Maidhof, H., et al. 2002. A multiresistant clone of Shiga toxin-producing Escherichia coli O118:[H16] is spread in cattle and humans over different European countries. Appl. Environ. Microbiol. 68:5834-5842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.McEwen, S. A., and P. J. Fedorka-Cray. 2002. Antimicrobial use and resistance in animals. Clin. Infect. Dis. 34(Suppl. 3):S93-S106. [DOI] [PubMed] [Google Scholar]
  • 22.Mora, A., et al. 2005. Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res. Microbiol. 156:793-806. [DOI] [PubMed] [Google Scholar]
  • 23.National Committee for Clinical Laboratory Standards. 2002. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, 2nd ed. Approved standard M31-A2. National Committee for Clinical Laboratory Standards, Wayne, PA.
  • 24.Schroeder, C. M., et al. 2002. Antimicrobial resistance of Escherichia coli O157 isolated from humans, cattle, swine, and food. Appl. Environ. Microbiol. 68:576-581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shiomi, M., M. Togawa, K. Fujita, and R. Murata. 1999. Effect of early oral fluoroquinolones in hemorrhagic colitis due to Escherichia coli O157:H7. Pediatr. Int. 41:228-232. [DOI] [PubMed] [Google Scholar]
  • 26.Vanaja, S. K., A. C. Springman, T. E. Besser, T. S. Whittam, and S. D. Manning. 2010. Differential expression of virulence and stress fitness genes between Escherichia coli O157:H7 strains with clinical or bovine-biased genotypes. Appl. Environ. Microbiol. 76:60-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Willshaw, G. A., T. Cheasty, H. R. Smith, S. J. O'Brien, and G. K. Adak. 2001. Verocytotoxin-producing Escherichia coli (VTEC) O157 and other VTEC from human infections in England and Wales: 1995-1998. J. Med. Microbiol. 50:135-142. [DOI] [PubMed] [Google Scholar]
  • 28.Yang, Z., et al. 2004. Identification of common subpopulations of non-sorbitol-fermenting, beta-glucuronidase-negative Escherichia coli O157:H7 from bovine production environments and human clinical samples. Appl. Environ. Microbiol. 70:6846-6854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Zhao, S., et al. 2001. Identification and characterization of integron-mediated antibiotic resistance among Shiga toxin-producing Escherichia coli isolates. Appl. Environ. Microbiol. 67:1558-1564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ziebell, K., et al. 2008. Genotypic characterization and prevalence of virulence factors among Canadian Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 74:4314-4323. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES