Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2011 Jan 14;77(5):1833–1843. doi: 10.1128/AEM.02374-10

Comprehensive Approaches to Molecular Biomarker Discovery for Detection and Identification of Cronobacter spp. (Enterobacter sakazakii) and Salmonella spp. ▿

Xianghe Yan 1,*, Joshua Gurtler 1, Pina Fratamico 1, Jing Hu 2, Nereus W Gunther IV 1, Vijay Juneja 1, Lihan Huang 1
PMCID: PMC3067294  PMID: 21239552

Abstract

Cronobacter spp. (formerly Enterobacter sakazakii) and Salmonella spp. are increasingly implicated internationally as important microbiological contaminants in low-moisture food products, including powdered infant formula. Estimates indicate that 40 to 80% of infants infected with Cronobacter sakazakii and/or Salmonella in the United States may not survive the illness. A systematic approach, combining literature-based data mining, comparative genome analysis, and the direct sequencing of PCR products of specific biomarker genes, was used to construct an initial collection of genes to be targeted. These targeted genes, particularly genes encoding virulence factors and genes responsible for unique phenotypes, have the potential to function as biomarker genes for the identification and differentiation of Cronobacter spp. and Salmonella from other food-borne pathogens in low-moisture food products. In this paper, a total of 58 unique Salmonella gene clusters and 126 unique potential Cronobacter biomarkers and putative virulence factors were identified. A chitinase gene, a well-studied virulence factor in fungi, plants, and bacteria, was used to confirm this approach. We found that the chitinase gene has very low sequence variability and/or polymorphism among Cronobacter, Citrobacter, and Salmonella, while differing significantly in other food-borne pathogens, either by sequence blasting or experimental testing, including PCR amplification and direct sequencing. This computational analysis for Cronobacter and Salmonella biomarker identification and the preliminary laboratory studies are only a starting point; thus, PCR and array-based biomarker verification studies of these and other food-borne pathogens are currently being conducted.


Cronobacter spp. and Salmonella spp. are recognized as food-borne pathogens that cause serious human illness, and in infants, these pathogens are considered to be of great health concern (3, 6). In addition to Salmonella, Cronobacter spp. have been isolated not only from low-moisture food products such as powdered infant milk but also from fresh lettuce, frozen shellfish, ready-to-eat meat, and fermented and cooked food products (5, 17). In 2008, Enterobacter sakazakii was reclassified into the new genus Cronobacter (23, 24). Within the genus Cronobacter, there are five species: C. sakazakii, C. malonaticus, C. turicensis, C. muytjensii, and C. dublinensis. Further, three subspecies currently exist within the species C. dublinensis, including dublinensis, lausannensis, and lactaridi. A wide variety of other bacteria and pathogens, including Pantoea agglomerans, Enterobacter cloacae, Staphylococcus aureus, Hafnia alvei, Citrobacter, Klebsiella pneumoniae, Klebsiella oxytoca, Escherichia vulneris (2, 4), and Listeria monocytogenes (42), have also been found in powdered infant formula (PIF) and other low-moisture products (1-4, 7-9, 13, 26), as well as in foods of animal origin (28, 32).

In recent years, the use of molecular methods, such as multiplex PCR (27), real-time PCR (21, 35), DNA microarrays (7, 34), automated ribotyping (33), amplified fragment length polymorphisms (AFLP) (18), full-length 16S rRNA gene sequencing (11, 12), and immunoassays (20, 44), for the detection and identification of the aforementioned pathogens has been intensively researched. The majority of these methods are heavily dependent on species-specific biomarker genes. One such gene is gluA (α-1,4-glucosidase), which was identified as a biomarker gene in Cronobacter spp. and was not found in any other Enterobacter spp. (22, 39). Additionally, DNase (14), arginine dihydrolase (22), 16S-23S rRNA genes, internal transcribed spacer (ITS) regions (34), outer membrane protein A (ompA) (37, 45), ornithine decarboxylase (14), recN, thdF, and rpoA have been utilized as species-specific biomarkers via multilocus sequence analysis (30).

During the past 2 decades, over 1,000 microbial genomes, including 1 genome from Cronobacter spp. (29) and 31 genomes from Salmonella strains, have been sequenced completely, and over 1,500 microbial genome sequences are in the process of being completed (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi?view=1). Genome sequence data have shown that bacterial DNA is highly dynamic, and the process of bacterial genome evolution demonstrates substantial differences, even within strains of the same genus. The size of the chromosome may also vary among strains from clinical isolates of Cronobacter (36), Salmonella, and other pathogens. Therefore, finding clinically useful biomarkers that can be used to specifically distinguish Cronobacter spp. and Salmonella spp. from the other food-borne pathogens in mixed bacterial populations is very challenging. A major obstacle for the development of genetic-based detection methods for specific pathogens is the identification of suitable target sequences. Additionally, many methods for detection and isolation of these pathogens in foods are labor intensive and time-consuming. Therefore, the aim of this study was to systematically collect and verify potential genetic biomarker genes through literature-based data mining, comparative genomic comparisons, and verification of specific selected biomarkers to enable the detection and differentiation of Cronobacter and Salmonella spp. from other food-borne pathogens in a direct, single-step, rapid PCR-based method for potential application to food samples and clinical specimens.

MATERIALS AND METHODS

Bacterial strains, DNA isolation, and target gene amplification.

Seventeen Cronobacter strains were obtained from Larry Beuchat (University of Georgia, Center for Food Safety, Griffin, GA) and Dong-Hyun Kang (Washington State University, School of Food Science, Pullman, WA). All of these strains are potentially pathogenic and were isolated from a wide range of food samples and environmental and clinical sources. Strains were grown overnight in Luria-Bertani broth at 37°C, and genomic DNA was isolated using the Qiagen DNeasy kit following the manufacturer's recommendations. The degenerate primer set for chitinase and a nondegenerate primer set for the ompA gene, listed in Table 1, were novelly designed so as to amplify unique bands under standard PCR amplification conditions. PCR amplification was performed in a total volume of 50 μl, containing 5 μl of 10× reaction buffer, 1 μl of deoxynucleoside triphosphates (dNTPs), 5 μl of each of the primers (10 μM), 1 μl of template DNA (50 to 100 ng/μl), 0.25 μl of Taq DNA polymerase (5 U/μl), and 32.75 μl of PCR water to make up the final volume. The amplification was performed using an iCycler thermocycler (Bio-Rad, Hercules, CA). The PCR conditions used were 95°C for 2 min, followed by 30 cycles of 95°C for 10 s, 55°C for 30 s, 72°C for 2 min, and a final extension for 10 min at 72°C. A portion of these amplified PCR products were verified by agarose gel electrophoresis (Fig. 1).

TABLE 1.

Primers used in this study

Primer name Expected size Primer sequencea Gene
sak_Chi_F 2.2 kb ATGGCTACMAGYAAAYTRATYCAGGG Chitinase
sak_chi_R CACCTGRTAGTTRTGVCCTTTCCAGC
ompA_F 469 bp GGATTTAACCGTGAACTTTTCC ompA
ompA_R CGCCAGCGATGTTAGAAGA
a

M, A or C; Y, C or T; R, A or G; V, A or C or G.

FIG. 1.

FIG. 1.

Agarose gel electrophoresis analysis of PCR products targeting the chitinase (2.2-kb) and ompA (469-bp) genes.

DNA sequencing and phylogenetic analysis.

In order to explore the evolutionary relationship obtained from an analysis of DNA polymorphisms of the chitinase gene among the tested strains of Cronobacter spp., Salmonella spp., and the other food-borne pathogens, the PCR products of the chitinase gene from various E. sakazakii strains were purified using QIAquick PCR purification columns and sequenced using the BigDye Terminator v3.1 cycle sequencing kit and a 3730 DNA analyzer (Applied Biosystems, Foster City, CA). Sequencher, version 4.9 (Gene Codes, Ann Arbor, MI), was used to trim, combine, and assemble the sequence data to form contiguous stretches. Phylogenetic trees were generated by comparing the nucleotide sequences using ClustalW (43), Phylip (http://evolution.genetics.washington.edu/phylip/general.html), and tree viewer software.

Extraction of unique genes and consensus genes of each genome.

Representative strains (110 in total) of the 15 pathogens listed in Table 2, which are most commonly reported as the cause of food-borne illnesses from low-moisture foods such as dry milk, fruits, peanut butter, cheeses, and chocolate, were analyzed. The complete gene sequence of each bacterial genome was subjected to the BLAST search engine (using default parameters) and compared against each of the sequences of the remaining 14 genomes. If the sequence length (i.e., the total number of bases) of gene A was l and the total number of sequence identities (i.e., the number of identical bases) of gene A with gene B was n, then the identity ratio (similarity) between gene A and gene B was defined as n/l. The identity ratio measures the percentage of similarity between a target gene sequence and a query gene sequence. If the identity ratio between gene A in the query genome and a gene in 1 of 14 subject genomes was greater than or equal to a user-defined threshold, t, then gene A was said to have a hit in the subject genomes. For each query genome, genes that did not have any hits in the other 14 genomes were collected, and these genes were designated unique genes in the query genome. Various t values from 0.5 to 0.05, with a step size of 0.05, were tested, and results were manually analyzed. Manual verification of these computationally generated data showed that a t value between 0.05 and 0.1 would provide the best reasonable data representation. A threshold t value of 0.05 was chosen because it generated a reasonable amount of unique genes. The number of unique genes is shown in Table 2, third column. If gene A in the query genome had hits (various t values from 0.1 to 0.5 were tested, and a t value of 0.1 was chosen) in each of the remaining 14 genomes, then gene A was called a consensus gene. The number of consensus genes in each genome is shown in Table 2, fourth column. To find the unique genes that existed only in Cronobacter spp. and/or Salmonella spp. but not in the other 13 bacterial species, we performed BLAST search analyses of these two genomes against the other 13 genomes. The same threshold (t = 0.05) was used for the genome comparisons, and a subset of the genes unique to Cronobacter spp. and Salmonella spp. is listed in Table 3.

TABLE 2.

Comparative genetic characterization of major pathogens from food-borne illnesses associated with low-moisture food productsa

Species/strain (GenBank accession no.) Total no. of:
GC content (%) Length (bp)
Genes Unique genesb Consensus genesc
Cronobacter sakazakii(CP000783) 4,392 268 105 56 4,368,373
Salmonella Enteritidis (CP001127) 4,707 401 231 52 4,809,037
Shigella boydii(CP000036) 4,463 123 20 51 4,519,823
Enterobacter sp. strain 638 (CP000653) 4,230 232 15 52 4,518,712
Citrobacter koseri(CP000822) 5,123 243 207 53 4,720,462
Escherichia coli O157:H7 (AE005174) 5,371 366 121 50 5,498,450
Enterobacter cloacae(CP001918) 5,241 391 134 54 5,314,581
Pantoea ananatis(CP001875) 4,341 551 21 53 4,690,298
Klebsiella pneumoniae(CP000964) 5,567 651 224 57 5,641,239
Yersinia pestis (CP000901)d 4,224 696 231 47 4,504,254
Campylobacter jejuni(AL111168) 1,699 804 19 30 1,641,481
Staphylococcus aureus(CP001844) 2,664 902 43 32 2,814,816
Listeria monocytogenes(AL591824) 2,940 1,034 5 37 2,944,528
Clostridium difficile(AM180355) 3,970 1,747 29 29 4,290,252
Bacillus cereus 03BB102 (CP001407) 5,566 2,033 201 35 5,269,628
a

See references 1-4, 7, 9, 13, and 26. Data from the second, fifth, and sixth columns were obtained from NCBI's Entrez database (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi).

b

t = 0.05.

c

t = 0.1.

TABLE 3.

Select unique genes/regions of Cronobacter and Salmonella spp. based on comparative computational analysis

Species GenBank accession no. Positions Gene function (unique gene locus tags)
Salmonella spp. CP001125.1a 20447-23029 EstP, putative pesticide-degrading enzyme; esterase
CP001125.1a 85623-83905 Histidine kinase
CP001125.1a 88002-87088 Response regulator receiver protein
CP001125.1a 92586-93302 TriD protein
CP001125.1a 93314-93598 Putative entry exclusion protein
CP001125.1a 93616-94623 TriE protein
CP001125.1a 82199-82840 Chloramphenicol acetyltransferase 2
NC_014476a 42152-48198 spvDCBAR gene cluster, virulence gene
CP001127.1 17869-19968 Exochitinase
CP001127.1 25762-28428 Outer membrane usher protein FimD
CP001127.1 35340-37058 Arylsulfotransferase (asst) superfamily protein
CP001127.1 213571-212303 Putative fimbrial-like adhesin protein
CP001127.1 249550-246581 Viral enhancin protein
CP001127.1 250369-251670 Shikimate transporter
CP001127.1 343747-344484 Gram-negative pili assembly chaperone
CP001127.1 344508-347018 Outer membrane fimbrial usher protein
CP001127.1 347040-347510 Putative fimbrial structural subunit
CP001127.1 392509-391751 Fimbrial chaperone protein
CP001127.1 397279-396350 Fimbrial chaperone protein
CP001127.1 406659-405202 Outer membrane protein OprM
CP001127.1 566030-565194 Probable secreted protein
CP001127.1 664550-665164 Lytic enzyme
CP001127.1 699362-697905 O-antigen conversion protein
CP001127.1 785621-786787 Hydrolase, UxaA family
CP001127.1 853136-853906 O-antigen export system, permease protein
CP001127.1 986043-985153 Transcriptional regulator, LysR family
CP001127.1 1179341-1180033 Oligogalacturonate-specific porin
CP001127.1 1242120-1241122 Putative fimbrial protein
CP001127.1 1292378-1293106 Pertussis toxin, subunit 1 subfamily
CP001127.1 1295248-1294439 Cytolethal distending toxin B
CP001127.1 1433385-1434401 Tetrathionate reductase gene cluster
CP001127.1 1435347-1437095 Sensor kinase
CP001127.1 1444369-1445862 Type III secretion outer membrane pore, YscC/HrcC family
CP001127.1 1445855-1447054 Type III secretion apparatus protein, YscD/HrpQ family
CP001127.1 1679794-1678562 l-Lactate oxidase
CP001127.1 1692014-1693240 Secreted effector protein
CP001127.1 2187749-2186574 Wzy
CP001127.1 2191447-2190167 Putative O-antigen transporter
CP001127.1 2264284-2263262 Putative fimbrial protein
CP001127.1 2828458-2829702 Enterochelin esterase
CP001127.1 2933896-2931884 Cell invasion protein SipA
CP001127.1 2934982-2933960 Type III effector protein IpaD/SipD/SspD
CP001127.1 2938091-2936310 Cell invasion protein SipB
CP001127.1 2943452-2942442 Antigen presentation protein SpaN
CP001127.1 2945168-2943873 Flagellum-specific ATP synthase
CP001127.1 2945572-2945165 Surface presentation of antigens protein Spak
CP001127.1 2948796-2947678 Invasion protein InvE
CP001127.1 2951227-2950478 Invasion protein
CP001127.1 2999371-2998574 Beta-lactamase domain protein
CP001127.1 3095222-3092733 Fimbrial usher protein
CP001127.1 3207119-3206064 Putative methyl-accepting chemotaxis protein
CP001127.1 3783645-3784859 O-antigen ligase
CP001127.1 4335277-4336125 ClpP protease
CP001127.1 4341875-4343800 Tail protein
CP001127.1 4455678-4458116 CshB porin
CP001127.1 4459680-4460462 CshE pilin
CP001127.1 4700538-4699453 Putative major fimbrial subunit
CP001127.1 4703584-4701155 Outer membrane usher protein SfmD
Cronobacter spp. CP000783.1 268708-272424 Hypothetical protein (ESA_00298-ESA_00300)
CP000783.1 273598-287078 Hypothetical protein (ESA_00304-ESA_00310, except alginate O-acetyltransferase AlgI [ESA_00303], putative lipoprotein [ESA_00305], and the alpha-2-macroglobulin family region [ESA_00308])
CP000783.1 578742-591835 Hypothetical protein (ESA_00611, ESA_00612, ESA_00615, ESA_00616, and ESA_00618)
CP000783.1 957212-969835 Hypothetical protein (ESA_00981-ESA_00990, except putative invasin [ESA_00987] and phage integrase [ESA_00990])
CP000783.1 991095-994496 Hypothetical protein (ESA_01026), peptidase S14 ClpP (ESA_01027), phage major capsid protein, HK97 family (ESA_01028)
CP000783.1 1152718-1158275 O-antigen cluster (ESA_01181-ESA_01185)
CP000783.1 1186371-1190015 Hypothetical protein (ESA_01216-ESA_01218)
CP000783.1 1391367-1394671 Putative fatty acid hydroxylase (ESA_01448), putative fatty acid desaturase (ESA_01449), putative membrane protein (ESA_01450)
CP000783.1 2137914-2140588 Hypothetical protein (ESA_02201), putative esterase/lipase/thioesterase (ESA_02202), transcriptional regulator, LysR family (ESA_02203)
CP000783.1 2256328-2258819 Putative caudovirus prohead protease (ESA_02319), putative phage portal protein, lambda family (ESA_02320), putative phage terminase large subunit (ESA_02321)
CP000783.1 3289362-3297665 Capsular polysaccharide biosynthesis gene cluster (ESA_03352-ESA_03357)
CP000783.1 3762752-3765513 Fimbrial gene cluster (ESA_03812-ESA_03814)
CP000783.1 3861832-3864117 Hypothetical protein (ESA_03913-ESA_03916)
CP000783.1 4039090-4042971 Hypothetical protein (ESA_04084-ESA_04086)
CP000783.1 4348939-4352405 Putative phosphoribosylpyrophosphate synthetase (ESA_04383), putative nicotinamide phosphoribosyl transferase (ESA_04384), hypothetical protein (ESA_04385), putative tellurite resistance protein (ESA_04386)
a

GenBank accession number for a plasmid-borne gene.

Literature-based data mining and comparative analysis of unique gene clusters, putative virulence factors, and biomarker genes.

Every unique gene cluster, putative virulence factor, and biomarker gene that we identified, shown in Tables 4 and 5, were based on scientific publications or protein sequence similarity searches (BLASTp) against the GenBank nonredundant protein database or were found by relying on keyword-based analysis of text-mined data from publically available databases such as NCBI (http://www.ncbi.nlm.nih.gov/gene) and ENA (http://www.ebi.ac.uk/ena/). The stand-alone BLAST program was downloaded from NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=Download).

TABLE 4.

Identification of potential biomarker genes that might be used to distinguish Cronobacter and Salmonella spp. from other food-borne pathogens based on literature-based data mining

C. sakazakiilocus tag C. sakazakiiprotein accession no. (GenBank) Gene/protein name (symbol) Presence of homology
Salmonella Citrobacter E. coli Klebsiella Clostridium Pantoea Yersinia Shigella E. cloacae Campylobacter/Listeria
ESA_01183 YP_001437286.1 Wzx Yes No Yes No No No No No No No
ESA_01185 YP_001437288.1 Wzy No No No No No No No No No No
ESA_03317 YP_001439374.1 Chitinase Yes Yes No No No No No No No No
ESA_02201 YP_001438286.1 Hypothetical protein No No No No No No No No No No
ESA_02709 YP_001438777.1 α-1,4-Glucosidase gene (gluA) No No No No Yes No No No No No
ESA_02516 YP_001438597.1 Putative hemolysin/hemagglutinin No No No No No No No No No No
ESA_02084 YP_001438170.1 Putative adhesin No No No No No No No No No No
ESA_00341 YP_001436476.1 Beta-carotene hydroxylase pigment (crtZ) No No No No No Yes No No No No
ESA_00341 YP_001436477.1 Phytoene/squalene synthetase (crtB) No No No No No Yes No No No No
ESA_00343 YP_001436478.1 Phytoene dehydrogenase (crtI) No No No No No Yes No No No No
ESA_00344 YP_001436479.1 Lycopene cyclase (crtL) No No No No No Yes No No No No
ESA_00345 YP_001436480.1 Glycosyl transferases (crtX) No No No No No Yes No No No No
ESA_00346 YP_001436481.1 Isopentenyl pyrophosphate isomerase No No No No No Yes No No No No
ESA_00347 YP_001436482.1 Geranylgeranyl pyrophosphate synthase (crtE) No No No No No Yes No No No No
ESA_03721 YP_001439754.1 DNase (TatD) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_02154 YP_001438239.1 Succinylarginine dihydrolase Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_02391 YP_001438473.1 Outer membrane protein A (ompA) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_00314 YP_001436449.1 Ornithine decarboxylase Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_01872 YP_001437962.1 Catalase Yes Yes Yes Yes No No No Yes No No
ESA_01203 YP_001437307.1 4-Aminobutyrate aminotransferase No Yes Yes Yes No No No Yes No No
ESA_01574 YP_001437664.1 Aconitate hydratase Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_04127 YP_001440144.1 6-Phosphofructokinase Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_01954 YP_001438044.1 Fumarate/nitrate reduction transcriptional regulator Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_04154 YP_001440171.1 Alpha-xylosidase (YicI) Yes Yes Yes Yes Yes No No Yes Yes No
ESA_00357 YP_001436490.1 DNA primase (dnaG) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03853 YP_001439875.1 Galactoside permease Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_04206 YP_001440222.1 Endo-1,4-d-glucanase (BscZ) Yes Yes Yes Yes No No Yes Yes Yes No
ESA_00523 YP_001436650.1 Phosphopyruvate hydratase Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03753 YP_001439786.1 Porphobilinogen deaminase Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_00373 YP_001436507.1 Outer membrane channel protein Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_02807 YP_001438873.1 Acriflavin resistance protein A precursor (AcrA) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03723 YP_001439756.1 sec-independent translocase (TatB) Yes Yes Yes Yes No No Yes Yes Yes No
ESA_02187 YP_001438272.1 Virulence protein (VirK) Yes Yes Yes Yes No No Yes Yes No No
ESA_02251 YP_001438336.1 Acyl carrier protein Yes No Yes No No Yes Yes No No No
ESA_00752 YP_001436865.1 Extracellular metalloprotease Prt1 Yes Yes No No No Yes No No No No
ESA_00690 YP_001436805.1 GTP-binding protein (lepA) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_04401 YP_001440417.1 Elongation factor G Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03312 YP_001439369.1 Isoleucyl-tRNA synthetase (ileS) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03973 YP_001439995.1 DNA gyrase subunit B (gyrB) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03690 YP_001439730.1 DNA-directed RNA polymerase subunit beta (rpoB) Yes Yes Yes Yes No Yes Yes Yes Yes No
GU122171 GU122171 16S rRNA No No No No No No No No No No
ACE74909 ACE74909 ATPase (RecN) Yes Yes Yes Yes No No No Yes Yes No
ESA_00031 YP_001436176 DNA-directed RNA polymerase subunit alpha (rpoA) Yes Yes Yes Yes No Yes Yes Yes Yes No
ESA_03979 YP_001440001.1 tRNA modification GTPase TrmE (thdF) Yes Yes Yes Yes No No No Yes Yes No

TABLE 5.

Putative virulence factors and unique biomarker genes for distinguishing Cronobacter, Salmonella, and E. coli from other food-borne pathogens based on literature-based data mining combined with comparative genome analysis

GI no. GenBank accession no. Locus tag Gene/gene function Present in pathogen:
Salmonella E. coli Other major pathogensa
156530628 ABU75454.1 ESA_00150 Putative anaerobic decarboxylate transporter + + ±
156530827 ABU75653.1 ESA_00355 rpoS/sigma S (sigma 38) factor of RNA polymerase, major sigma factor during stationary phase + + ±
156530851 ABU75677.1 ESA_00379 katB/catalase-peroxidase KatB + + ±
156530862 ABU75688.1 ESA_00390 pilT/twitching motility protein PilT − − −
156531119 ABU75945.1 ESA_00662 clpE/ATP-dependent protease + + ±
156531139 ABU75965.1 ESA_00686 algU/alginate biosynthesis protein + + ±
156531159 ABU75985.1 ESA_00708 pilR/two-component response regulator + + ±
156531248 ABU76074.1 ESA_00797 Enterobactin synthetase component E − − −
156531242 ABU76068.1 ESA_00791 Putative iron-siderophore transport system, ATP-binding component + + ±
156531430 ABU76256.1 ESA_00987 Putative eae/intimin − − −
156531432 ABU76258.1 ESA_00989 Similar to plasmid virulence: regulation of spv operon, lysR family − − −
156531610 ABU76436.1 ESA_01169 Mannose-1-phosphate guanylyltransferase 1 + + ±
156531686 ABU76512.1 ESA_01250 bscR/putative type III secretion protein + + ±
156531689 ABU76515.1 ESA_01253 fliM/flagellar motor switch protein + + ±
156531693 ABU76519.1 ESA_01257 bscN/putative ATP synthase in type III secretion system + + ±
156531695 ABU76521.1 ESA_01259 fliG/flagellar motor switch protein + + ±
156531696 ABU76522.1 ESA_01260 fliF/flagellar M-ring protein − − −
156531723 ABU76549.1 ESA_01287 fliD/putative flagellar hook-associated protein − − −
156531724 ABU76550.1 ESA_01288 flaA/flagellin − − ±
156531745 ABU76571.1 ESA_01309 bvgA/virulence factors transcription regulator + + ±
156531788 ABU76614.1 ESA_01354 flhB/flagellar biosynthetic protein − − −
156531789 ABU76615.1 ESA_01355 pcrD/type III secretory apparatus protein + + ±
156531820 ABU76646.1 ESA_01386 Lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase − − −
156531952 ABU76778.1 ESA_01520 Nitrate reductase 1, alpha subunit + + ±
156531953 ABU76779.1 ESA_01521 Nitrate reductase 1, beta subunit + + ±
156531980 ABU76806.1 ESA_01552 Outer membrane receptor FepA − − −
156532312 ABU77138.1 ESA_01884 Putative receptor − − −
156532401 ABU77227.1 ESA_01974 lpfC/long polar fimbrial outer membrane usher protein − − −
156532403 ABU77229.1 ESA_01976 sfaD/SfaD protein − − −
156532510 ABU77336.1 ESA_02086 pykF/pyruvate kinase I + + ±
156532639 ABU77465.1 ESA_02216 phoP/response regulator in two-component regulatory system with PhoQ, transcribes genes expressed under low Mg+ concn (OmpR family) + + ±
156532640 ABU77466.1 ESA_02217 phoQ/sensory kinase protein in two-component regulatory system with PhoP, ligand is Mg+ − − −
156532687 ABU77513.1 ESA_02264 Flagellar hook-associated protein type 3 − − −
156532688 ABU77514.1 ESA_02265 flgK/flagellar hook-filament junction protein − − −
156532690 ABU77516.1 ESA_02267 flgI/flagellar P-ring protein + + ±
156532691 ABU77517.1 ESA_02268 flgH/flagellar L-ring protein + + ±
156532692 ABU77518.1 ESA_02269 flgG/flagellar basal body rod protein + + ±
156532693 ABU77519.1 ESA_02270 flgF/flagellar basal body rod protein − − −
156532694 ABU77520.1 ESA_02271 flgE/flagellar hook protein FlgE − − −
156532695 ABU77521.1 ESA_02272 flgD/flagellar basal body rod modification protein FlgD − − −
156532696 ABU77522.1 ESA_02273 flgC/flagellar basal-body rod protein + + ±
156532767 ABU77593.1 ESA_02344 sfaE/SfaE protein − − −
156532769 ABU77595.1 ESA_02347 Putative oxidoreductase + + ±
156532833 ABU77659.1 ESA_02413 ompF/outer membrane protein F − − −
156532850 ABU77676.1 ESA_02430 Lipid transporter ATP-binding/permease protein + + ±
156532935 ABU77761.1 ESA_02516 fhaB/filamentous hemagglutinin/adhesin − − −
156532957 ABU77783.1 ESA_02538 fimD/fimbrial adhesin − − −
156532958 ABU77784.1 ESA_02539 lpfB/long polar fimbrial chaperone − − −
156532959 ABU77785.1 ESA_02540 Outer membrane usher protein LpfC − − −
156533053 ABU77879.1 ESA_02639 Putative inner membrane protein − − −
156533067 ABU77893.1 ESA_02653 fur/transcriptional repressor of iron-responsive genes + + ±
156533133 ABU77959.1 ESA_02727 Enterobactin synthase subunit F − − ±
156533264 ABU78090.1 ESA_02861 clpP/ATP-dependent Clp protease proteolytic subunit + + ±
156533628 ABU78454.1 ESA_03232 pilB/(type IV) pilus assembly protein − − −
156533629 ABU78455.1 ESA_03233 pilC/(type IV) pilus assembly protein − − −
156533744 ABU78570.1 ESA_03349 kpsE/putative capsule polysaccharide export system inner membrane protein − − −
156533745 ABU78571.1 ESA_03350 kpsD/polysialic acid capsule transport protein − − −
156533747 ABU78573.1 ESA_03352 kpsC/possible polysaccharide modification protein − − −
156533748 ABU78574.1 ESA_03353 kpsS/possible polysaccharide modification protein − − −
156533753 ABU78579.1 ESA_03358 kpsT/putative capsule polysaccharide export ATP-binding protein − − −
156533960 ABU78786.1 ESA_03575 basS/sensory kinase in two-component regulatory system with BasR − − −
156534135 ABU78961.1 ESA_03769 bplF/lipopolysaccharide biosynthesis protein + + ±
156534173 ABU78999.1 ESA_03813 fimC/outer membrane usher protein precursor − − −
156534174 ABU79000.1 ESA_03814 fimB/chaperone protein − − −
156534462 ABU79288.1 ESA_04107 rfaC/lipopolysaccharide heptosyltransferase I − + ±
156534650 ABU79476.1 ESA_04296 dep/capD gamma-glutamyltranspeptidase + + ±
156534760 ABU79586.1 ESA_04407 pilD/type 4 (IV) prepilin-like protein − − −
a

Twelve other genomes used in this study.

RESULTS

Analysis of genetic similarities.

The complete gene data set of the C. sakazakii (CP000783) genome was used to make a gene-by-gene comparison with the representative strains from 13 other bacterial genera. Salmonella enterica serovar Enteritidis (CP001127), Enterobacter cloacae (CP001918), Citrobacter koseri (CP000822), Enterobacter sp. strain 638 (CP000653), Klebsiella pneumoniae (CP000964), Shigella boydii (CP000036), Escherichia coli O157:H7 (AE005174), Pantoea ananatis (CP001875), Yersinia pestis (CP000901), Listeria monocytogenes (AL591824), Bacillus cereus 03BB102 (CP001407), Staphylococcus aureus (CP001844), Clostridium difficile (AM180355), and Campylobacter jejuni (AL111168) were the representative strains used for comparing food-borne pathogens that may be isolated from PIF and other low-moisture food products. The number of genes, the number of unique genes, the total number of consensus genes, the percent GC content, and the size of the genomes (in no. of bp) of the different bacteria are presented in Table 2. We categorized these pathogens into different groups based on the number of unique genes, the GC content obtained from a genome-wide comparative analysis (Table 2), and the phylogenetic analysis of the ompA gene shown in Fig. 2 B. The evolutionary implication of phylogenetic analyses of the chitinase and ompA genes is shown in Fig. 2. Among these genomes are the following groups: group 1, C. sakazakii, Salmonella, Citrobacter, E. cloacae, Enterobacter, Shigella, and E. coli O157:H7; group 2 (no chitinase gene), Pantoea, Klebsiella, and Yersinia; and group 3 (not shown in Fig. 2 due to no significant sequence similarity to ompA and chitinase genes in this group), Listeria, B. cereus, Staphylococcus, C. difficile, and Campylobacter. All pathogens in groups 1 and 2 have 50% or higher GC contents and similar genome sizes, except for Y. pestis, which has a 47% GC content.

FIG. 2.

FIG. 2.

Phylogenetic analysis of the chitinase (A) and ompA (B) genes shows 2 distinct groups. Protein accession numbers correspond to GenBank.

Identification of unique gene clusters, putative virulence factors, and biomarker genes of Cronobacter spp., Salmonella spp., and the other food-borne pathogens.

The number of unique genes was 268 in C. sakazakii and 401 in Salmonella. Some of these unique genes in C. sakazakii are clustered and are listed as hypothetical genes, with the original annotation provided in GenBank format. Table 3 lists 58 unique clusters of genes, including 8 plasmid-borne genes whose protein products are involved in bacterial pathogenesis and/or have functions or form structures that are important to Salmonella. Likewise, Table 3 also lists 15 unique gene clusters (each gene cluster has a minimum of 3 genes) from Cronobacter spp. whose protein products are also hypothesized to have important functional or structure roles or are involved in pathogenesis. These gene clusters could be used to design a series of unique primers for PCR assays potentially useful for the detection and identification of Cronobacter and Salmonella strains. As an example, there are unique multicopy plasmid-borne genes or clusters listed in Table 3, including estP, a putative esterase or pesticide-degrading enzyme (10) that may exist only in Salmonella. Therefore, these genes have potential application in designing a rapid and sensitive diagnostic test to distinguish Salmonella spp. from related organisms due to the genes' high copy numbers and unique nature; however, comprehensive studies to determine the universal presence of biomarkers, including those that are plasmid encoded in a broad array of Salmonella isolates, would need to be conducted.

Table 4 lists potential biomarkers identified based on scientific publications and protein sequence similarity searches (BLASTp) against the GenBank nonredundant protein database or by relying on keyword-based analysis of text-mined data from publically available databases such as NCBI (http://www.ncbi.nlm.nih.gov/gene) and ENA (http://www.ebi.ac.uk/ena/). In Table 5, the protein homology using the stand-alone BLAST program downloaded from NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=Download) is shown for putative virulence factors and unique biomarker gene discovery. Any protein having an identity of 80% or greater and greater than or equal to 70% query coverage by using the BLASTp program of the BLAST package was considered to have similarity.

Cronobacter yellow pigment gene cluster.

E. sakazakii (now C. sakazakii) was designated a distinct species in 1980 by Farmer et al. (14) and was named in honor of the Japanese bacterial taxonomist/microbiologist Riichi Sakazaki (1920 to 2002), who discovered a distinct yellow-pigmented variant of E. cloacae; however, today non-pigment-producing strains are known to exist within the genus Cronobacter. In the present study, genes responsible for the production of the yellow pigment were used as one of the three targets for the identification of C. sakazakii. The crt operon in C. sakazakii, which contributes to the formation of the yellow pigment (25), was not found in other bacteria shown in Table 4, except for P. ananatis, a plant pathogen, which also produces a yellow pigment. The carotenoid pigment biosynthesis enzymes are encoded by multiple genes within the crt operon. There are 7 genes in this operon, including beta-carotene hydroxylase (crtZ), phytoene synthase (crtB), phytoene dehydrogenase (crtI), phytoene desaturase (crtL), zeaxanthin glucosyl transferase (crtX), isopentenyl pyrophosphate isomerase (idi), and geranylgeranyl diphosphate synthase (crtE). Although these crt operon genes theoretically can be used as targets for bacterial detection, recent studies have shown that approximately 5 to 7% of strains are nonpigmented variants (22; http://www.foodmicrobe.com/food%20poisoning%20microorganisms.htm). Recently, yellow pigment gene clusters from three Cronobacter strains, C. sakazakii ATCC BAA-894 (GenBank accession no. CP000783.1), C. sakazakii BAC 9E10 (GenBank accession no. AM384990.1), and C. turicensis z3032 (GenBank accession no. FN543093.1), have been sequenced. Based on the sequence alignment (data not shown), their DNA sequences are very similar, with only a few nucleotide polymorphisms scattered over the entire 7.6-kb region sequenced; however, there are two significant sequence variabilities in the crtZ gene region. Although the genomic method for the identification of all Cronobacter spp. based on yellow pigment genes as the sole biomarker for clinical diagnosis and early detection could be hampered by these restrictions, since there is limited sequence information to determine if these nonpigmented strains are due to a mutated gene(s), the implication of a consensus sequence in this operon in the genus Cronobacter demonstrates that there is an excellent opportunity to design universal biomarker gene targets for the identification and detection of Cronobacter spp. if also combined with the other suitable biomarkers for identifying nonpigmented Cronobacter strains.

Cronobacter O-antigen gene cluster.

Another potential strain- or serogroup-specific gene cluster, the O-antigen gene cluster, was investigated to determine its suitability as a biomarker (15, 16, 38, 41). The O-antigen gene cluster contains genes with distinctly different functions, including genes involved in the processing and assembly of the O antigen. The genes that encode the O antigen flippase (wzx) and the O antigen polymerase (wzy) are extensively used as biomarker genes for Salmonella and E. coli serotyping (15, 16) and may be suitable biomarkers for Cronobacter spp. as well (Table 4). Both the wzx and wzy genes show limited homology to the same genes in other food-borne pathogens, as confirmed by computational comparative analysis among genomes, making them ideal identification targets for our purposes. It is not clear, however, how much genetic variability of the wzx and wzy genes exists within Cronobacter spp., Salmonella spp., and the other food-borne pathogens due to the limited availability of genomic sequences in the public databases. As shown in Table 4, the wzx gene may not be a suitable biomarker due to significant genetic similarity among Cronobacter spp., Salmonella spp., and E. coli; however, the wzy gene may be suitable.

Cronobacter- and Salmonella-specific virulence factors.

In order to more fully evaluate strain-specific biomarker genes for the differentiation of Cronobacter and Salmonella spp. from the other food-borne pathogens, a systematic approach, combining literature-based data mining (Table 4) and comparative genome analysis (Table 5), was conducted. In Tables 4 and 5, we present an analysis of components of bacterial pathogenesis, including genes that play a role in infection, colonization, and adhesion. In this study, a total of 44 biomarker genes listed in Table 4 were collected by literature-based data mining, and the 14 genomes listed in Table 2 were compared by using the sequences of individual C. sakazakii genes as reference sequences. In Table 4, two important virulence biomarker genes in Cronobacter spp., which are absent in all other pathogens, were analyzed. One gene that was analyzed is a putative hemolysin/hemagglutinin (ESA_02516; GenBank accession no. YP_001438597.1), while another is a putative adhesin (ESA_02084; GenBank accession no. YP_001438170.1). Another putative virulence factor, chitinase, which is of significant clinical importance, was also found to be a suitable biomarker gene for Cronobacter spp. Virulence genes listed in Table 4, such as a gene encoding the hydrolytic enzyme extracellular metalloprotease, prt1, a secretion and transport gene, tatB, and virK, were also analyzed and compared to other pathogens, as well. For the purpose of serotyping, it is necessary to generate a group of species- and serotype-specific biomarker genes. In this study, we found a series of consensus genes (species-specific biomarkers), including 16S rRNA, gyrB, rpoB, recN, thdF, rpoA, ileS, elongation factor G (EF-G), and lepA, through literature data mining and computational analysis suitable for our purposes. In Table 4, we listed only 3 (Clostridium, Campylobacter, and Listeria) out of 5 bacterial species in group 3 food-borne pathogens, due to their importance and the frequencies of their appearance in low-moisture food products.

Verification of analysis of chitinase and ompA genes as potential biomarkers.

As stated above, to verify these virulence factors and unique genes as potential biomarkers (Tables 3 to 5), we amplified and sequenced the PCR products generated from the targeted genes. For this process, we chose two target genes with good potential as biomarkers. One is the chitinase gene, which was identified by the comprehensive sequence comparisons, and the other is the ompA gene, identified by literature-based data mining. Chitinase is a putative virulence factor, and there are various chitinase enzymes present in many organisms, including bacteria. The sequence divergence of the chitinase gene has been used to identify and characterize stage-specific and/or organism-specific genes in several species (9, 31, 40). OmpA is the outer membrane protein A, previously shown to play a role in the invasion of various mammalian host cells. The length of the chitinase gene is ca. 2.2 kb. The primers (Table 1) used for the amplification of the chitinase gene are based on the consensus sequences identified in Salmonella and C. sakazakii through sequence alignments (data not shown). We found that the chitinase gene was present in all 17 tested Cronobacter strains, which originated from three different sources (i.e., environmental, food, and clinical origins). This primer set also amplified the chitinase gene from Salmonella enterica (data not shown). The primers targeting the ompA gene yielded a 469-bp fragment. However, the ompA gene was found only in 11 out of 17 Cronobacter strains tested (Table 6 ) and in 10 out of 15 genomes listed in Table 2. Some of these PCR results are shown in Fig. 1. Partial sequences of the chitinase gene in Cronobacter spp. from various strains and the ompA gene sequences of Cronobacter spp. were analyzed via construction of phylogenetic trees. C. sakazakii was demonstrated to be close to Salmonella, Citrobacter, and Cronobacter turicensis with regard to sequence similarity of the chitinase gene (Fig. 2A). The phylogenetic analysis of the ompA gene (Fig. 2B) was consistent with the genome-level comparison shown in Table 2. Among the food-borne pathogens tested and shown in Table 2, only Salmonella, Citrobacter, and Cronobacter spp. have similar chitinase or chitinase-like genes, as determined by computational blasting and experimental detection of PCR products; however, the chitinase gene is also present in other bacterial pathogens (Fig. 2A), such as Vibrio coralliilyticus, Yersinia bercovieri ATCC 43970, and others.

TABLE 6.

Strains used in this study

Species (strain/isolate no.) Presence of:
Source
Chitinase ompA gene
C. sakazakii (2.39-1 and LCDC 674) Yes No Clinical
C. sakazakii (2.39-2) Yes No Clinical
C. sakazakii (2.69 and CD1A7[1]) Yes No Shell of hen's egga
C. sakazakii (FSM 145) Yes No Environmental, from infant formula manufacturing plant
C. sakazakii (FSM 265) Yes No Environmental, from infant formula manufacturing plant
C. sakazakii (ATCC 12868) Yes Yes Not available
C. sakazakii (ATCC 29004)b Yes Yes Clinical
C. sakazakii (ATCC 29544) Yes Yes Clinical (child's throat), type strain
C. sakazakii (ATCC 51329)c Yes Yes Not available, type strain
C. sakazakii (1) Yes Yes Not available
C. sakazakii (2) Yes Yes Not available
C. sakazakii (3) Yes Yes Not available
C. sakazakii (5) Yes Yes Not available
C. sakazakii (6) Yes Yes Not available
C. sakazakii (7) Yes Yes Not available
C. sakazakii (2.70) Yes No Shell of hen's egga
C. sakazakii (2.47 and Gd. St. 8 [HPB 2878]) Yes Yes Environmental
a

Originally provided by Michael Musgrove, USDA, ARS.

b

Now C. sakazakii.

c

Now C. muytjensii.

DISCUSSION

The discovery of reliable candidate biomarkers for accurate, rapid, and sensitive detection of Cronobacter and Salmonella spp. in complex food matrices and clinical samples remains difficult. This is likely due to several reasons. First, sequence availability detailing genetic differences among food-borne pathogens is very limited. As an example, information as to DNA sequence divergence between Salmonella and E. coli with respect to their O-antigen gene clusters, a common genus- and strain-specific biomarker for differentiation, is incomplete (Table 4). Second, the lack of a comprehensive understanding of phenotypic differences among food-borne pathogens and the absence of particular traditional phenotypic markers may lead to a false-positive diagnosis, as may occur with the absence of the yellow pigment in some strains of Cronobacter spp. (Table 4). Third, the ability to define a set of biomarkers with a role in bacterial pathogenesis or bacterial metabolism that also function as genus-specific markers will provide a more complete and novel picture of the biological activity of food-borne pathogens of interest rather than relying on a single biomarker for identification.

In order to identify potential biomarkers for distinguishing Cronobacter, Salmonella, and the other food-borne pathogens and for developing sensitive and accurate DNA-based detection and identification methods, we investigated a number of candidate biomarker genes. These included genes involved in yellow pigment formation in C. sakazakii (metabolites), the O-antigen cluster genes wzx and wzy, unique genes, and virulence factors common to major food-borne pathogens. The data shown in Tables 3, 4, and 5 in this report are consistent with those shown in a prior report by Healy et al. (19), which demonstrate that many biomarkers were genes related to cell wall/membrane biogenesis/degradation, secretion, and extracellular structures such as fimbriae and flagella. This approach for identifying these putative biomarkers was validated by amplifying and sequencing a particular chitinase gene that showed greater sequence similarity between Cronobacter and Salmonella but was absent in other major food-borne pathogens most frequently found in PIF. As presented in Results, the data obtained in this study demonstrate that chitinase could be a suitable candidate biomarker. In this research, we tested only 17 individual Cronobacter strains and 4 Salmonella strains; therefore, researchers should be cautious when selecting chitinase as the sole biomarker for detection and diagnostic purposes until more comprehensive screening for this gene in Cronobacter and Salmonella spp. is performed. The potential biomarkers listed in Tables 3, 4, and 5 will provide a complete and solid foundation for scientists to draw reliable conclusions based on multiple biomarker genes rather than relying on an individual gene, particular data set, or single experiment.

In this study, we also performed a computational analysis of unique and consensus genes of 15 major food-borne and human pathogens. In total, we identified 292 and 425 unique genes for Cronobacter and Salmonella spp., respectively, that are distinguished from similar genes in other pathogens by a threshold, t, equal to 0.05. Because of the similarity of the genome sequences, the numbers of both the unique and consensus genes suggest that Cronobacter, Salmonella, Shigella, and Enterobacter are genetically more closely related to each other than to other food-borne pathogens, which is not a surprising finding. Further, for detection and diagnostic purposes, this approach could be applied to the use of microarray or target-enrichment strategies for next-generation sequencing technologies when the choice of putative biomarkers can be categorized by functional activities and/or if the number of selected biomarker genes is not a limiting factor. Most importantly, by focusing on a limited number of candidate biomarkers presented in this paper rather than on the whole genome or single biomarkers, appropriate “first tier” and “second tier” of biomarkers are provided for researchers to analyze samples in a complex food matrix or for clinical diagnostic applications. The quantification and characterization of a set of unique biomarkers for various food-borne and human pathogens can be reasonably obtained by either real-time PCR (RT-PCR) or microarray assays, allowing for the detection and identification of important food-borne pathogens based on their genetic differences using currently available technology.

The approaches described above represents our first attempt to describe a systematic approach to identify biomarkers for various food-borne pathogens. Currently, no conventional laboratory method can definitively detect and identify all six of the newly defined species of Cronobacter spp. Recent advances in the areas of genomics and high-throughput studies, as well as the development of new technologies, are improving our understanding of the molecular mechanisms of Cronobacter and Salmonella pathogenesis and are helping to develop effective biomarker identification computational pipelines, an important step toward identifying highly pathogenic Cronobacter spp. and differentiating the other major food-borne pathogens in a timely manner. However, our computational analysis for Cronobacter and Salmonella biomarker identification and the studies described in this report are only a preliminary step toward accomplishing this goal. The fundamental laboratory research, applying PCR and array-based high throughput verification of all major food-borne pathogen biomarkers, is an ongoing project in our laboratory.

Acknowledgments

We express our appreciation to James Smith for his critical review of the manuscript. We also thank Larry Beuchat (University of Georgia, Center for Food Safety, Griffin, GA) and Dong-Hyun Kang (Washington State University, School of Food Science, Pullman, WA) for providing the Cronobacter isolates used in this study.

The mention of trade names or commercial products is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

Footnotes

▿

Published ahead of print on 14 January 2011.

REFERENCES

  • 1.Anonymous. 2002. Isolation and enumeration of Enterobacter sakazakii from dehydrated powdered infant formula. U.S. Food and Drug Administration, Rockville, MD. http://www.cfsan.fda.gov/comm/mmesakaz.html.
  • 2.Anonymous. 2004. Enterobacter sakazakii and other microorganisms in powdered infant formula: meeting report, MRA series 6. FAO/WHO, Geneva, Switzerland.
  • 3.Anonymous. 2006. Enterobacter sakazakii and Salmonella in powdered infant formula. Second Risk Assessment Workshop, 16 to 20 January 2006. FAO/WHO, Rome, Italy.
  • 4.Anonymous. 2006. Milk and milk products—detection of Enterobacter sakazakii. Technical specification ISO/TS 22964. ISO/TS 22964:2006(E) and IDF/RM 210:2006(E), 1st ed. International Organization for Standardization, Geneva, Switzerland.
  • 5.Beuchat, L. R., et al. 2009. Cronobacter sakazakii in foods and factors affecting its survival, growth, and inactivation. Int. J. Food Microbiol. 136:204-213. [DOI] [PubMed] [Google Scholar]
  • 6.Bowen, A. B., and C. R. Braden. 2006. Invasive Enterobacter sakazakii disease in infants. Emerg. Infect. Dis. 12:1185-1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Call, D. R. 2005. Challenges and opportunities for pathogen detection using DNA microarrays. Crit. Rev. Microbiol. 31:91-99. [DOI] [PubMed] [Google Scholar]
  • 8.Caubilla-Barron, J., and S. Forsythe. 2007. Dry stress and survival time of Enterobacter sakazakii and other Enterobacteriaceae in dehydrated infant formula. J. Food Prot. 13:467-472. [DOI] [PubMed] [Google Scholar]
  • 9.Chaudhuri, S., et al. 2010. Contribution of chitinases to Listeria monocytogenes pathogenesis. Appl. Environ. Microbiol. 76:7302-7305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Choi, Y. J., C. B. Miguez, and B. H. Lee. 2004. Characterization and heterologous gene expression of a novel esterase from Lactobacillus casei CL96. Appl. Environ. Microbiol. 70:3213-3221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Clarridge, J. E., III. 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 17:840-862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Drancourt, M., et al. 2000. 16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. J. Clin. Microbiol. 38:3623-3630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Drudy, D., et al. 2006. Characterization of a collection of Enterobacter sakazakii isolates from environmental and food sources. Int. J. Food Microbiol. 110:127-134. [DOI] [PubMed] [Google Scholar]
  • 14.Farmer, J. J., III., M. A. Asbury, F. W. Hickman, and D. J. Brenner. 1980. The Enterobacteriaceae Study Group (U. S. A.)—Enterobacter sakazakii: a new species of “Enterobacteriaceae” isolated from clinical specimens. Int. J. Syst. Bacteriol. 30:569-584. [Google Scholar]
  • 15.Fitzgerald, C., R. Sherwood, L. L. Gheesling, F. W. Brenner, and P. I. Fields. 2003. Molecular analysis of the rfb O antigen gene cluster of Salmonella enterica serogroup O:6,14 and development of a serogroup-specific PCR assay. Appl. Environ. Microbiol. 69:6099-6105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fratamico, P. M., et al. 2010. Escherichia coli serogroup O2 and O28ac O-antigen gene cluster sequences and detection of pathogenic E. coli O2 and O28ac by PCR. Can. J. Microbiol. 56:308-316. [DOI] [PubMed] [Google Scholar]
  • 17.Friedemann, M. 2007. Enterobacter sakazakii in food and beverages (other than infant formula and milk powder). Int. J. Food Microbiol. 116:1-10. [DOI] [PubMed] [Google Scholar]
  • 18.Guerra, M. M., F. Bernardo, and J. McLauchlin. 2002. Amplified fragment length polymorphism (AFLP) analysis of Listeria monocytogenes. Syst. Appl. Microbiol. 25:456-461. [DOI] [PubMed] [Google Scholar]
  • 19.Healy, B., et al. 2009. Microarray-based comparative genomic indexing of the Cronobacter genus (Enterobacter sakazakii). Int. J. Food Microbiol. 136:159-164. [DOI] [PubMed] [Google Scholar]
  • 20.Ho, J. A., and H. W. Hsu. 2003. Procedures for preparing Escherichia coli O157:H7 immunoliposome and its application in liposome immunoassay. Anal. Chem. 75:4330-4334. [DOI] [PubMed] [Google Scholar]
  • 21.Iijima, Y., N. T. Asako, M. Aihara, and K. Hayashi. 2004. Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay. J. Med. Microbiol. 53:617-622. [DOI] [PubMed] [Google Scholar]
  • 22.Iversen, C., et al. 2007. Identification of “Cronobacter” spp. (Enterobacter sakazakii). J. Clin. Microbiol. 45:3814-3816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Iversen, C., et al. 2007. The taxonomy of Enterobacter sakazakii: proposal of a new genus Cronobacter gen. nov. and descriptions of Cronobacter sakazakii comb. nov., Cronobacter sakazakii subsp. Sakazakii comb. nov., Cronobacter sakazakii subsp. malonaticus subsp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov. and Cronobacter genomospecies 1. BMC Evol. Biol. 7:64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Iversen, C., et al. 2008. Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, Cronobacter dublinensis subsp. dublinensis subsp. nov., Cronobacter dublinensis subsp. lausannensis subsp. nov. and Cronobacter dublinensis subsp. lactaridi subsp. nov. Int. J. Syst. Evol. Microbiol. 58:1442-1447. [DOI] [PubMed] [Google Scholar]
  • 25.Johler, S., R. Stephan, I. Hartmann, K. A. Kuehner, and A. Lehner. 2010. Genes involved in yellow pigmentation of Cronobacter sakazakii ES5 and influence of pigmentation on persistence and growth under environmental stress. Appl. Environ. Microbiol. 76:1053-1061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kandhai, M. C., M. W. Reij, L. G. M. Gorris, O. Guillaume-Gentil, and M. van Schothorst. 2004. Occurrence of Enterobacter sakazakii in food production environments and households. Lancet 363:39-40. [DOI] [PubMed] [Google Scholar]
  • 27.Kim, J. S., et al. 2007. A novel multiplex PCR assay for rapid and simultaneous detection of five pathogenic bacteria: Escherichia coli O157:H7, Salmonella, Staphylococcus aureus, Listeria monocytogenes, and Vibrio parahaemolyticus. J. Food Prot. 70:1656-1662. [DOI] [PubMed] [Google Scholar]
  • 28.Kimura, B., et al. 1999. Evaluation of TaqMan PCR assay for detecting Salmonella in raw meat and shrimp. J. Food Prot. 62:329-335. [DOI] [PubMed] [Google Scholar]
  • 29.Kucerova, E., et al. 2010. Genome sequence of Cronobacter sakazakii BAA-894 and comparative genomic hybridization analysis with other Cronobacter species. PLoS One 5:e9556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kuhnert, P., B. M. Korczak, R. Stephan, H. Joosten, and C. Iversen. 2009. Phylogeny and prediction of genetic similarity of Cronobacter and related taxa by multilocus sequence analysis (MLSA). Int. J. Food Microbiol. 136:152-158. [DOI] [PubMed] [Google Scholar]
  • 31.LeCleir, G. R., A. Buchan, and J. T. Hollibaugh. 2004. Chitinase gene sequences from diverse aquatic habitats reveal complex patterns of diversity. Appl. Environ. Microbiol. 70:6977-6983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Leclercq, A., C. Wanegue, and P. Baylac. 2002. Comparison of fecal coliform agar and violet red bile lactose agar for fecal coliform enumeration in foods. Appl. Environ. Microbiol. 68:1631-1638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lehner, A., T. Tasara, and R. Stephan. 2004. 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification. BMC Microbiol. 4:43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Liu, Y., et al. 2006. PCR and oligonucleotide array for detection of Enterobacter sakazakii in infant formula. Mol. Cell. Probes 20:11-17. [DOI] [PubMed] [Google Scholar]
  • 35.Mackay, I. M. 2004. Real-time PCR in the microbiology laboratory. Clin. Microbiol. Infect. 10:190-212. [DOI] [PubMed] [Google Scholar]
  • 36.Miled-Bennour, R., et al. 2010. Genotypic and phenotypic characterisation of a collection of Cronobacter (Enterobacter sakazakii) isolates. Int. J. Food Microbiol. 139:116-125. [DOI] [PubMed] [Google Scholar]
  • 37.Mohan Nair, M. K., and K. S. Venkitanarayanan. 2006. Cloning and sequencing of the ompA gene of Enterobacter sakazakii and development of an ompA-targeted PCR for rapid detection of Enterobacter sakazakii in infant formula. Appl. Environ. Microbiol. 72:2539-2546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mullane, N., et al. 2008. Molecular analysis of the Enterobacter sakazakii O-antigen gene locus. Appl. Environ. Microbiol. 74:3783-3794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Muytjens, H. L., J. van der Ros-van de Repe, and H. A. M. van Druten. 1984. Enzymatic profiles of Enterobacter sakazakii and related species with special reference to the alpha glucosidase reaction and reproducibility of the test system. J. Clin. Microbiol. 20:684-686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Rehli, M., S. W. Krause, and R. Andreesen. 1997. Molecular characterization of the gene for human cartilage gp-39(CHI3L1), a member of the chitinase protein family and marker for late stages of macrophage differentiation. Genomics 43:221-225. [DOI] [PubMed] [Google Scholar]
  • 41.Samuel, G., and P. Reeves. 2003. Biosynthesis of O-antigens: genes and pathways involved in nucleotide sugar precursor synthesis and O-antigen assembly. Carbohydr. Res. 338:2503-2519. [DOI] [PubMed] [Google Scholar]
  • 42.Steele, M. L., et al. 1997. Survey of Ontario bulk tank raw milk for food-borne pathogens. J. Food Prot. 60:1341-1346. [DOI] [PubMed] [Google Scholar]
  • 43.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Yang, H., L. W. Qu, A. N. Wimbrow, X. P. Jiang, and Y. P. Sun. 2007. Rapid detection of Listeria monocytogenes by nanoparticle-based immunomagnetic separation and real-time PCR. Int. J. Food Microbiol. 118:132-138. [DOI] [PubMed] [Google Scholar]
  • 45.Ye, Y.-W., Q.-P. Wu, W.-P. Guo, J.-M. Zhang, and X.-H. Dong. 2007. Rapid detection for Enterobacer sakazakii based on species-specific PCR in powdered milks. Microbiology 34:1192-1197. [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES