Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2011 Jan 21;77(6):1981–1989. doi: 10.1128/AEM.02219-10

Shifting the Fermentative/Oxidative Balance in Saccharomyces cerevisiae by Transcriptional Deregulation of Snf1 via Overexpression of the Upstream Activating Kinase Sak1p ▿

Andreas M Raab 1,2, Verena Hlavacek 2,†, Natalia Bolotina 2, Christine Lang 1,2,*
PMCID: PMC3067313  PMID: 21257817

Abstract

With the aim to reduce fermentation by-products and to promote respiratory metabolism by shifting the fermentative/oxidative balance, we evaluated the constitutive overexpression of the SAK1 and HAP4 genes in Saccharomyces cerevisiae. Sak1p is one of three kinases responsible for the phosphorylation, and thereby the activation, of the Snf1p complex, while Hap4p is the activator subunit of the Hap2/3/4/5 transcriptional complex. We compared the physiology of a SAK1-overexpressing strain with that of a strain overexpressing the HAP4 gene in wild-type and sdh2 deletion (respiratory-deficient) backgrounds. Both SAK1 and HAP4 overexpressions led to the upregulation of glucose-repressed genes and to reduced by-product formation rates (ethanol and glycerol). SAK1 overexpression had a greater impact on growth rates than did HAP4 overexpression. Elevated transcript levels of SAK1, but not HAP4, resulted in increased biomass yields in batch cultures grown on glucose (aerobic and excess glucose) as well as on nonfermentable carbon sources. SAK1 overexpression, but not the combined overexpression of SAK1 and HAP4 or the overexpression of HAP4 alone, restored growth on ethanol in an sdh2 deletion strain. In glucose-grown shake flask cultures, the sdh2 deletion strain with SAK1 and HAP4 overexpression produced succinic acid at a titer of 8.5 g liter−1 and a yield of 0.26 mol (mol glucose)−1 within 216 h. We here report for the first time that a constitutively high level of expression of SAK1 alleviates glucose repression and shifts the fermentative/oxidative balance under both glucose-repressed and -derepressed conditions.


The Crabtree-positive yeast Saccharomyces cerevisiae ferments under aerobic conditions in the presence of excess glucose. This may be a major disadvantage in biotechnological production processes, in particular when respiratory metabolism is required. Being able to shift the respirofermentative flux distribution toward a more respiratory metabolic state of the cell could be beneficial for many industrial applications of baker's yeast, since it leads to improved growth characteristics and the reduced formation of fermentation by-products.

The formation of ethanol under aerobic conditions can be overcome by growing yeast cells under conditions of sugar limitation. Strategies to redirect carbon fluxes into the respiratory central metabolism by altering expression levels of single enzymes of the central metabolism were not promising (9, 44) or even resulted in impaired growth (2, 9, 17). However, interference with the expression levels of genes involved directly in the glucose repression cascade has been shown to have the potential to redirect the respirofermentative flux distribution. When overexpressing the Hap4p activator subunit of the Hap2/3/4/5 transcriptional complex, which is involved in the carbon-source-dependent regulation of the respiratory status, an increase of the respiratory capacity was observed for glucose-grown cells. Hap4p overexpression resulted in increased growth rates and biomass formation, while levels of ethanol and glycerol were decreased (3, 14, 28, 29, 50). A yeast strain expressing a chimeric protein composed of the amino-terminal half of the glucose transporter Hxt1p and the carboxy-terminal half of Hxt7p in an hxt1-7 deletion background exhibited complete respiratory metabolism during growth at external glucose concentrations as high as 20 g liter−1 (22, 38). This strain produced negligible amounts of ethanol and glycerol on glucose, but the biomass production rate was decreased compared to the corresponding wild-type rate. This indicates that a comprehensive shift toward respiration can lead to growth defects on fermentable carbon sources. The deletion of the REG1 gene also leads to impaired growth on fermentable carbon sources (18), due to a constitutively active Snf1p complex (36). REG1 encodes the regulatory subunit of the Glc7p/Reg1p phosphatase, which negatively regulates the activity of the Snf1p complex (13, 42, 43).

The Snf1p complex plays a major role in the glucose derepression cascade (42), since it influences several other transcription factors and kinases involved in this cascade, such as Mig1p, Cat8p, and Adr1p (12, 46-48, 53). The Snf1 kinase is a heterotrimeric protein complex and comprises the Snf1p catalytic subunit, the Snf4p activating subunit, and one of three β-subunit isoforms, Gal83p, Sip1p, or Sip2p (15, 35). Besides the expression of the SNF1 gene, which is not subject to glucose repression (6), the level of activity of the Snf1p kinase is under multiple types of regulation. Its N-terminal catalytic domain appears to be autoinhibited by binding to its C-terminal regulatory domain under high-glucose conditions (5, 25). Snf4p counteracts this autoinhibition upon glucose depletion (35, 36). Snf1p is deactivated by the Glc7/Reg1 phosphatase (19, 33) and is activated by phosphorylation on threonine 210 by one of the three upstream activating kinases, Sak1p, Tos3p, or Elm1p (15, 23, 45). Sak1p was originally identified as a high-copy-number suppressor of a mutation in DNA polymerase α (24) and is the major kinase for activating Snf1p in response to glucose limitation. It is also required for the relocalization of Snf1-Gal83 to the nucleus (21). Increased levels of Sak1p result in an increased phosphorylation of Snf1p (36). Phenotypically, only invertase activity during cultivation in the presence of glucose has been investigated with SAK1 overexpression strains so far (36).

With the aim to shift the fermentative/oxidative balance, to improve growth characteristics, and to explore the physiological effects of elevated levels of Sak1p, we constructed yeast strains overexpressing SAK1, the gene encoding the main kinase responsible for the activation of the Snf1 complex. We investigated the influence of SAK1 overexpression on the physiology and the fermentative/oxidative balance in comparison to HAP4 overexpression. Both SAK1 and HAP4 overexpressions hold potential for optimizing microorganisms for industrial applications by a one-step genetic modification. While the effects of HAP4 overexpression on respirofermentative flux distribution and by-product formation have already been investigated comprehensively (3, 14, 28, 29, 50), this is not the case for SAK1 overexpression, although this modification should have a greater impact on the physiology of the cell, since the Snf1 complex is located far up in the hierarchy of the glucose derepression cascade (42). As the HAP4 promoter region shows a strong binding site for the transcriptional inhibitor Mig1p, a downstream target of Snf1, the expression of HAP4 could at least partially be regulated by Snf1 (34). We analyzed the effects of SAK1 and HAP4 overexpressions under fermentative (excess glucose) and under respiratory conditions on nonfermentable carbon sources in wild-type and sdh2 deletion backgrounds. SDH2 encodes the iron-sulfur protein subunit of the succinate dehydrogenase (SDH) complex (Sdhp) (32), and its deletion leads to respiratory deficiency, in terms of an inability to grow on nonfermentable carbon sources (31). Sdhp plays an important role in respiration and central metabolism, as it connects the mitochondrial respiratory chain to the tricarboxylic acid (TCA) cycle, where it catalyzes the oxidation of succinate to fumarate. The cellular response to Sdhp dysfunction thus has important implications for biotechnological applications as well as for an understanding of cellular physiology (8). It was demonstrated previously that Sdhp dysfunction leads to the downregulation of many genes involved in respiratory metabolism, including HAP4 (8). In a previous study we showed that the disruption of SDH activity leads to increased levels of succinic acid production under respiratory conditions (41). In the present study we evaluated the influence of SAK1 and HAP4 overexpression on oxidative succinic acid production in SDH disruptants. The significant changes due to SAK1 overexpression are consistent with a redirection of fermentative flux toward oxidative flux. The broad physiological impact of an elevated SAK1 gene dose underlines the prominent role of the Snf1 complex in shifting the fermentative/oxidative balance.

MATERIALS AND METHODS

Yeast strains.

All yeast strains used in this study (Table 1) are derived from Saccharomyces cerevisiae strain AH22ura3 (MATa ura3Δ leu2-3 leu2-112 his4-519 can1), which was described previously (39). Yeast strain S. cerevisiae S288c (ATCC 26108) was used for the amplification of genomic DNA.

TABLE 1.

S. cerevisiae strains used in this study

Strain Relevant genotype and plasmid(s)
AH13 (wild type) MATa pFlat1 pFlat3; wild type, reference strain
AH13SAK MATa pFlat1SAK1 pFlat3
AH13HAP MATa pFlat1 pFlat3HAP4
AH13SAKHAP MATa pFlat1SAK1 pFlat3HAP4
AH13sdh2 MATasdh2::loxP pFlat1 pFlat3; reference strain
AH13sdh2SAK MATasdh2::loxP pFlat1SAK1 pFlat3
AH13sdh2HAP MATasdh2::loxP pFlat1 pFlat3HAP4
AH13sdh2SAKHAP MATasdh2::loxP MATa pFlat1SAK1 pFlat3HAP4
AH13sdh2sdh1SAK MATasdh2::loxP sdh1::loxP pFlat1SAK1 pFlat3

Escherichia coli strain and growth conditions.

E. coli K-12 JM109 {e14− (McrA−) recA1 endA1 gyrA96 thi-1 hsdR17(rK− mK+), supE44 relA1 Δ(lac-proAB) [F′ traD36 proAB laqlqZΔM15]} was used for the maintenance and amplification of plasmid DNA (52). Bacteria were grown in LB medium at 37°C.

Deletion of the SDH1 and SDH2 genes in S. cerevisiae AH22ura3.

Vector pUG6 (20) was used to delete the SDH1 and SDH2 genes in S. cerevisiae AH22ura3. The deletion of the two genes was done successively by the same method. After plasmid preparation, a fragment of pUG6 was amplified by PCR to obtain a cassette consisting of loxP-kanMX-loxP. Primers were constructed to fuse 5′ and 3′ sequences of SDH1 (5′-ATGCTATCGCTAAAAAAATCAGCGCTCTCCAAGTTGACTTCCAGCTGAAGCTTCGTACGC-3′ and 5′-TTAGTAGGCTCTTACAGTTGGAGGTACGGAAGGACATTCCGCATAGGCCACTAGTGGATCTG-3′, respectively) SDH2 (5′-ATGTTGAACGTGCTATTGAGAAGGAAGGCCTTTTGTTTGGCCAGCTGAAGCTTCGTACGC-3′ and 5′-CTAGGCAAATGCCAAAGATTTCTTAATTTCAGCAATAGCCGCATAGGCCACTAGTGGATCTG-3′, respectively), and coding sequences of the loxP regions (underlined) of the pUG6 vector. The resulting PCR product comprises the kanMX gene resistance cassette, loxP sites, and SDH1 and SDH2 homologous regions for integrative transformation in S. cerevisiae AH22ura3. Homologous recombination in yeast led to the deletion of the target genes. Geneticin resistance was used to select for positive clones. The Geneticin resistance gene was removed via transformation with pSH47 (20). The vector carries the cre recombinase gene to remove the kanMX module flanked by loxP sites. To dispose of pSH47, yeast strains were counterselected on 5-FOA (5-fluoroorotic acid) (1 g liter−1) agar plates.

Plasmid construction and yeast transformation.

The plasmids used in this work were pFlat1, pFlat3, pFlat1SAK1, and pFlat3HAP4. The construction of plasmids pFlat1 (2μm PADH1 URA3) and pFlat3 (2μm PADH1 LEU2) was described previously (51). To construct pFlat1SAK1 and pFlat3HAP4, the SAK1 and HAP4 genes were amplified from genomic DNA of strain S288c with primers introducing a 5′ NotI restriction site and a 3′ XhoI restriction site, respectively (CTGCGGCCGCACCATGGATAGGAGTGATAAAAAAG and ATCTCGAGTCATGGAAGTGCACTCCTTCTCTTCT for SAK1 and CTGCGGCCGCACCATGACCGCAAAGACTTTTCTAC and ATCTCGAGTCAAAATACTTGTACCTTTAAAAAATC for HAP4 [restriction sites are underlined]). Plasmids pFlat1 and pFlat3 were restricted with NotI and XhoI before ligation with the resulting fragments. The SAK1 and HAP4 genes were expressed under the control of a constitutive version of the ADH1 promoter (27). Yeast strains were transformed by the lithium acetate method (20). After transformation, yeast cells were plated onto WMVIII medium (27) with histidine (100 mg liter−1) lacking uracil and leucine to select for plasmids pFlat1 and pFlat3.

S. cerevisiae shake flask cultivation.

Precultures were grown to stationary phase in 100-ml shake flasks in 20 ml WMVIII medium (27) with 5% (wt/vol) glucose supplemented with histidine (100 mg liter−1) on a rotary shaker (150 rpm). Main cultures were inoculated with 1% of the preculture in 250-ml shake flasks with baffles in 50 ml WMVIII medium with 5% (wt/vol) glucose or galactose, ethanol, and glycerol (2%, wt/vol) supplemented with histidine (100 mg liter−1) without uracil and leucine to select for plasmids pFlat1 and pFlat3 on a rotary shaker (150 rpm) and incubated at 30°C.

Metabolite analysis and specific metabolite production rates.

Ethanol, glycerol, and acetate analyses of culture supernatants were done via gas chromatography (GC)-mass spectrometry (MS) analysis, which was performed with an Agilent 6890N GC system coupled to an Agilent 5975B VL MSD quadrupole mass selective detector. The column used for the analysis was an Agilent DB-FFAP column (30 m, with a 0.25-mm internal diameter [i.d.] and a 0.25-μm film thickness). The mass spectrometer was operated in scan mode (start after 4 min; mass range, 29 to 500 atomic mass units at 3.1 scans s−1). The glucose concentration was determined with a glucose assay kit (R-Biopharm, Darmstadt, Germany). Specific metabolite consumption/production rates (q) (mmol of metabolite per gram dry yeast biomass per hour) were calculated from the slope of a plot of the metabolite concentration versus the dry yeast biomass concentration, multiplied by the specific growth rate. The correlation of the metabolite concentration versus the dry yeast biomass concentration was linear for all metabolites during all independent experiments. The quantification of succinic acid in culture supernatants was performed by high-performance liquid chromatography (HPLC) analysis with an Ascentis Express RP-Amide column (25 cm, 0.4-cm i.d.; Supelco, Munich, Germany) on an Agilent 1100 HPLC system. Succinic acid was detected at 210 nm with a fluorescence detector equipped with a diode array (UVD340S). The mobile phase consisted of 99% (vol/vol) 20 mM NaH2PO4 and 1% acetonitrile (pH 2). The flow rate was 4 ml min−1, and the column temperature was 45°C. For the verification of HPLC chromatogram peaks, putative dicarboxylic acids (succinic acid) were fractioned, lyophilized, derivatized with methyl-chloroformate according to a method described previously by Villas-Boas et al. (51a), and analyzed via GC-MS analysis with an Agilent 6890N GC system coupled to an Agilent 5975B VL MSD quadrupole mass selective detector with an Agilent HP-5MS column (30 m, with a 0.25-mm i.d. and a 0.25-μm film thickness). The mass spectrometer was operated in scan mode (70 eV, with a start after 1 min and a mass range of 29 to 500 a.m.u. at 3.1 scans s−1).

2-DOG sensitivity plate assay.

Cells grown to the early stationary phase were spotted at different dilutions (10−1 to 10−5) on YP plates (10 g liter−1 yeast extract and 20 g liter−1 Bacto peptone) that contained one carbon source (5% glucose, 5% galactose, 5% glycerol, or 5% ethanol) and 200 μg ml−1 2-deoxyglucose (2-DOG) (for glucose and galactose plates) or 100 μg ml−1 2-DOG (for glycerol and ethanol plates). Plates were incubated for 48 h at 30°C after spotting of the dilutions.

Quantitative real-time PCR.

For the isolation of total RNA, 2 × 107 cells were used. Total RNA was isolated with the RNeasy minikit (Qiagen, Hilden, Germany) according to the instruction manual. The amount of isolated RNA was determined photometrically (an optical density at 260 nm [OD260] of 1 equals 40 μg ml−1 RNA). Reverse transcription was carried out with the QuantiTect reverse transcription (RT) kit (Qiagen) according to the instruction manual. One microgram of isolated total RNA was used for reverse transcription. The amplification of the cDNA via quantitative real-time PCR was carried out with the Brilliant SYBR green kit (Stratagene, La Jolla, CA). The reaction mix consisted of 12.5 μl 2× SYBR green PCR Mastermix, 1 μl forward and reverse primers (10 pmol μl−1) (for sequences, see Table 2), 0.375 μl reference dye at a dilution of 1:5,000, 9.125 μl water, and 1 μl cDNA. The PCR was carried out with a 96-well microtiter plate (VWR, Darmstadt, Germany) according to the following program: 95°C for 10 min; 95°C for 30 s, 55°C for 1 min, and 72°C for 1 min for 40 cycles; followed by a melting-curve program of 95°C for 1 min, 55°C for 30 s, and 95°C for 30 s (55 to 95°C with a gradient of 0.2°C min−1). Additionally, a water control (water instead of cDNA) and a minus-RT control (total RNA instead of cDNA) were included for each sample to check for contamination. The fold expression relative to the expression in the reference strain was calculated according to an efficiency-corrected ΔΔCT model (16). The expression levels were normalized to the expression of the reference gene ACT1. For the calculation of the efficiency, different dilutions of cDNA were plotted logarithmically versus the corresponding threshold cycle (CT) values. The efficiency was calculated with the slope (m) of the resulting curve (efficiency equal to 10−1/m). All measurements were carried out at least in triplicates. Changes in expression levels below a factor of 2 (increase or reduction) were not considered significant.

TABLE 2.

Sequences of RT-PCR primer sets used in this study

Gene Primer Sequence
ACT1 Forward AGGTTGCTGCTTTGGTTATTG
Reverse GCCAGATCTTTTCCATATCGTC
HAP4 Forward ATGACCGCAAAGACTTTTCTAC
Reverse GAGAAGATGATCTTCTACCAGG
SAK1 Forward TAGGAGTGATAAAAAAGTTAACG
Reverse GGTGCTGTGGATGGTTTAACTG
CYC1 Forward GACTGAATTCAAGGCCGGTTC
Reverse ACCAGGAATATATTTCTTTGGG
GAL2 Forward GCAGTTGAGGAGAACAATATG
Reverse CAAACATGAAGCCGCCGAAGG
SDH1 Forward GCTAAAAAAATCAGCGCTCTCC
Reverse CTTGGATATACAAGCAGTCTTG
ICL1 Forward GCCTATCCCCGTTGGAAATAC
Reverse GCACCGAAAGTTTTAGAGACTG
FBP1 Forward TGCCAACTCTAGTAAATGGAC
Reverse CTTCTTTTGCTGGTCACCAGTG

RESULTS

Effects of SAK1 and HAP4 overexpression on growth and by-product formation on glucose.

To observe a potential shift from fermentative toward a more respiratory metabolism during growth on excess glucose, we explored physiological properties like growth and by-product formation rates in SAK1 and HAP4 overexpression strains in comparison to the wild type carrying the corresponding empty vectors. Cells were grown in a defined mineral medium (5% initial glucose) in shake flasks with baffles to ensure a high oxygen supply. The wild type grew exponentially, with a specific growth rate of 0.16 h−1, whereas the growth rate of AH13SAK was 0.19 h−1 (21% increase of the μmax) during exponential growth (Table 3). The combined overexpression of SAK1 and HAP4 resulted in the highest increase of the specific growth rate (28% increase of the μmax), while AH13HAP displayed a growth rate that was increased by 9% compared to that of the wild type.

TABLE 3.

Effects of SAK1 and HAP4 overexpression on growth and carbon flux distributiona

Strain μmax (h−1)b Factor related to wt for μmax qglucose (mmol g dry yeast biomass−1 h−1)a,b Factor related to wt for qglucose qethanol (mmol g dry yeast biomass−1 h−1)a,b Factor related to wt for qethanol qglycerol (mmol g dry yeast biomass−1 h−1)a,b Factor related to wt for qglycerol
wt 0.16 1 −12.5 1 15.4 1 0.9 1
SAK1 0.19 1.21 −13 1.04 12.3 0.8 0.46 0.51
HAP4 0.17 1.09 −10.9 0.87 11.7 0.76 0.32 0.35
SAK1 + HAP4 0.2 1.28 −11.6 0.93 12.8 0.83 0.51 0.57
a

Determined as described in Materials and Methods and calculated from the linear correlation of the metabolite concentration versus the dry biomass formed during 5 h of exponential growth, multiplied by the specific growth rate (q) (mmol of metabolite per gram dry yeast biomass per hour). wt, wild type.

b

Each value represents the mean of data from triplicate samples. The standard deviation of each triplicate was below 6%.

Glucose consumption and ethanol, glycerol, and biomass formation were measured during a 5-h period of exponential growth. Samples were taken every hour, and biomass, metabolite, and glucose concentrations in the culture supernatant were determined. Calculation of the specific ethanol and glycerol production rates showed that the sole overexpression of SAK1 or HAP4 as well as the combined overexpression of these two genes resulted in a significant decrease of specific ethanol and glycerol production rates compared to those of the wild type (Table 3). All three overexpression strains showed a reduction of the ethanol production rate of about 20%. The specific glycerol production rate was reduced by 49% in AH13SAK and 43% in AH13SAKHAP, whereas HAP4 overexpression led to a 65% reduction. In comparison to the wild type, AH13SAK displayed a slightly increased specific glucose consumption rate, while this rate was reduced in AH13HAP (13% reduction of the qglucose) and AH13SAKHAP (7% reduction of the qglucose) (Table 3).

It was previously reported that HAP4 overexpression redirects the respirofermentative flux distribution (3, 50). The results shown in Table 3 are also consistent with a shift of the fermentative/oxidative balance toward respiration in SAK1-overexpressing strains. SAK1 overexpression has a slightly greater impact on the growth rate than does HAP4 overexpression, while the influence on by-product formation rates is comparable. A positive additive effect by the combined overexpression of SAK1 and HAP4 was observed only with respect to growth rates.

Effects of SAK1 and HAP4 overexpression on growth on carbon sources other than glucose.

Propagating the respiratory system by shifting the fermentative/oxidative balance could lead to beneficial effects not only on glucose but also on nonfermentable carbon sources other than glucose. To evaluate growth under glucose-derepressed conditions, we cultivated SAK1 and HAP4 overexpression strains on a carbon mixture consisting of galactose, ethanol, and glycerol (2% each) and on glucose (5%) as a reference. Biomass formation was monitored in shake flask batch cultures, and the biomass yield in grams per gram of carbon source consumed was determined after 96 h of cultivation (Table 4). The highest biomass yield in cultures grown on glucose as well as on galactose, ethanol, and glycerol was obtained with strain AH13SAK (Yxs on glucose, 0.21 g g−1; Yxs on galactose, ethanol, and glycerol, 0.23 g g−1). In contrast, elevated transcript levels of HAP4 or SAK1 and HAP4 resulted in decreased biomass yields compared to those of the wild type on both glucose and galactose, ethanol, and glycerol (Table 4). AH13SAK showed the highest increase of biomass during growth on ethanol after the diauxic shift in glucose-grown batch cultures, while biomass formation was below wild-type levels in strains AH13HAP and AH13SAKHAP during this growth phase on ethanol (data not shown). These results indicate that the overexpression of SAK1 and HAP4 also has an influence on growth under glucose-derepressed conditions on nonfermentable carbon sources and carbon sources other than glucose. In contrast to the overexpression of SAK1 and HAP4 or solely HAP4, elevated levels of SAK1 led to increased biomass yields on nonfermentable carbon sources.

TABLE 4.

Effects of SAK1 and HAP4 overexpression on biomass yield

Strain Yxs (g of dry yeast biomass/g carbon source consumed)a
Glucose Gal, EtOH, Gly
wt 0.2 0.19
SAK1 0.21 0.23
HAP4 0.17 0.14
SAK1 + HAP4 0.18 0.16
a

Biomass yield (Yxs) (grams of dry yeast biomass per gram of carbon source consumed) of SAK1 and HAP4 overexpression strains and the wild type. Each value represents the mean of data for triplicate samples. The standard deviation of each triplicate was below 5%. EtOH, ethanol.

To compare alleviations of glucose repression, growth was monitored on fermentable and on nonfermentable carbon sources in the presence and absence of the glucose analogue 2-deoxyglucose (2-DOG). 2-DOG fully induces glucose repression but is not metabolized by yeast. Since S. cerevisiae is glucophilic, the growth of a wild-type strain on C sources other than glucose is not possible in the presence of 2-DOG. A dilution series (10−1 to 10−5) of cultures of the wild-type strain and the strains overexpressing SAK1 and HAP4 was spotted onto rich-medium plates containing glucose, galactose, glycerol, or ethanol (5% each) with and without 2-DOG (Fig. 1). The presence of 2-DOG did not influence the growth of the four strains on glucose, indicating that 2-DOG has no detrimental effect on growth at the concentration applied. The sole overexpression of SAK1 or HAP4 restored growth on glycerol in the presence of 2-DOG, and the combined overexpression of these two genes led to an additive effect in this respect. This indicates an alleviation of glucose repression due to an increased HAP4 and SAK1 gene dose. None of the four strains grew on ethanol in the presence of 2-DOG. In contrast to SAK1, HAP4 overexpression restored growth on galactose in the presence of 2-DOG (Fig. 1, top). Increased levels of SAK1 and HAP4 resulted in improved growth on glycerol and ethanol in the absence of 2-DOG (Fig. 1, bottom).

FIG. 1.

FIG. 1.

Colony growth assay of wild-type (wt) and SAK1-, HAP4-, and SAK1- and HAP4-overexpressing strains on different carbon sources (indicated at the top) in the presence (top panels) and absence (bottom panels) of the glucose analogue 2-DOG. Each panel represents a dilution series of cells (10−1 to 10−5). The 2-DOG concentration in which growth inhibition was monitored is indicated at the bottom (μg ml−1).

Effects of SAK1 and HAP4 overexpression on transcript levels of genes of the respiratory system.

To investigate the influence of the overexpression of the SAK1 and HAP4 genes on the expression level of genes of the respiratory central metabolism, we determined transcript levels by quantitative real-time PCR. In addition to SAK1 and HAP4, the following genes were assayed as markers for different functional gene clusters of the respiratory system: SDH1 (TCA cycle), ICL1 (glyoxylate shunt), CYC1 (respiratory chain), FBP1 (gluconeogenesis), ADH1 (fermentative flux), and GAL2 (utilization of alternative C sources). For expression analysis under glucose-repressed conditions, the first four strains listed in Table 1 (wild-type background with SAK1 and HAP4 overexpression) were cultivated in defined mineral medium (5% initial glucose) in shake flasks with baffles. Cells were harvested in the mid-log growth phase for the isolation of total RNA. For expression analysis under glucose-derepressed conditions, cells were cultivated on 2% ethanol and 2% glycerol instead of glucose and harvested after 16 h for RNA isolation.

The expression of the SDH1, ICL1, FBP1, GAL2, and HAP4 genes was induced in cells grown on ethanol and glycerol, whereas the expression level of the ADH1 gene was significantly reduced on nonfermentable carbon sources (Table 5). This is consistent with data in the literature (10, 11). Transcript levels of SAK1 under the control of its native promoter did not change significantly in cells grown on ethanol and glycerol compared to glucose-grown cells, which indicates a constitutive expression of SAK1. The expression of Sak1p in medium with excess glucose was observed in a previous study (15). The increase of the transcript levels of SAK1 and HAP4 due to the overexpression of these genes (under the control of a constitutive, i.e., relieved from glucose repression, version of the ADH1 promoter) was higher in cells grown on glucose than in cells grown on ethanol and glycerol (a factor of 54.3 compared to 13.4, and a factor of 71.7 compared to 20.9, respectively). This is conclusive for the HAP4 gene, as its expression was already increased in wild-type cells grown on ethanol and glycerol (Table 5). For SAK1, however, this observation is surprising. It seems that under respiratory conditions, dramatically elevated SAK1 transcript levels are not tolerated and are degraded by the cell.

TABLE 5.

Effects of SAK1 and HAP4 overexpression on transcript levels

Gene Fold expression of strain relative to the wt ona:
Glucose
Ethanol + glycerol
wt SAK1 HAP4 SAK1 HAP4 wtb SAK1 HAP4 SAK1 HAP4
SAK1 1.0 55.1 NS 54.3 1.0 (NS) 13.4 NS 13.5
HAP4 1.0 NS 71.7 67.0 1.0 (2.9) NS 20.9 25.9
ADH1 1.0 NS 0.5 NS 1.0 (0.2) NS NS NS
SDH1 1.0 3.4 19.4 21.0 1.0 (93.9) 12.4 4.6 3.4
ICL1 1.0 NS NS NS 1.0 (52.9) NS 2.2 2.0
CYC1 1.0 NS 2.5 2.0 1.0 (ND) ND ND ND
FBP1 1.0 NS NS NS 1.0 (41.1) NS NS NS
GAL2 1.0 NS 2.8 4.8 1.0 (5.1) NS NS NS
a

Fold expression relative to the wild-type (AH13 with empty plasmids) determined by quantitative real-time PCR. Each value represents the mean of data for triplicate samples. The standard deviation of each triplicate was below 20%. Changes in expression below a factor of 2 (increase or reduction) were considered not significant (NS). ND, not determined.

b

Values in parentheses represent fold expression relative to that of the wild type on glucose.

Under glucose-repressed conditions, SAK1 overexpression led to an increased SDH1 transcript level, whereas HAP4 overexpression also increased expression levels of GAL2 and CYC1 and reduced ADH1 transcription. An additive effect of the simultaneous overexpression of HAP4 and SAK1 was observed with respect to GAL2 transcript levels (Table 5), which is consistent with the results of the 2-DOG growth assay (Fig. 1). In contrast to the strains overexpressing HAP4 and SAK1 simultaneously or HAP4 alone, SAK1 overexpression led to a strong upregulation of the SDH1 gene (factor of 12.4) under respiratory conditions (on ethanol and glycerol). HAP4 overexpression also enhanced ICL1 transcription under these conditions. Transcript levels of the FBP1 gene remained entirely unaffected by SAK1 and HAP4 deregulation under the growth conditions applied. The data in Table 5 show that the increased expression levels of SAK1 and HAP4 affect the expression of genes of the respiratory system under both glucose-repressed and -derepressed conditions.

Physiological effects of SAK1 and HAP4 overexpression in a respiratory-deficient background.

To investigate the physiological effects of an elevated gene dose of SAK1 and HAP4 in a respiratory-deficient background, we overexpressed SAK1 and HAP4 in an sdh2 deletion strain. Yeast strains were cultivated in defined mineral medium with glucose as a carbon source (5% initial glucose) in shaking flasks with baffles for 72 h. Dry yeast biomass, glucose, ethanol, acetate, and succinic acid concentrations in the culture supernatant were monitored (Fig. 2). Strains AH13sdh2, AH13sdh2HAP, and AH13sdh2HAPSAK (Fig. 2A, C, and D) exhibited only a single growth phase on glucose and did not convert the ethanol produced during exponential growth into biomass. A partial uptake of ethanol from the culture broth was observed for these strains, which was converted mainly into acetate. Acetate accumulated up to 3 g liter−1 at the end of fermentation. This behavior was expected, since the disruption of the succinate dehydrogenase activity leads to a respiratory deficiency and to an inability to grow on ethanol (1, 2, 31, 49). Romano and Kolter (41a) also observed a strong formation of acetate in SDH1 and SDH4 deletion strains on ethanol. AH13sdh2HAP and AH13sdh2HAPSAK accumulated succinic acid up to a titer of 2 g liter−1 within 72 h, whereas AH13sdh2 produced only 0.6 g liter−1 (Fig. 2 A, C, and D). During a 216-h cultivation under the same conditions, strain AH13sdh2HAPSAK formed succinic acid continuously up to a titer of 8.5 g liter−1 and a yield of 0.26 mol (mol glucose)−1, while AH13sdh2HAP produced 7.6 g liter−1 and AH13sdh2 3.5 g liter−1 (results not shown). This indicates that the overexpression of HAP4 and SAK1 leads to an increased succinate productivity of SDH disruptants in batch fermentations on glucose.

FIG. 2.

FIG. 2.

Growth characteristics, glucose consumption, and ethanol, acetate, and succinic acid formation in shake flask cultivations on defined mineral medium with glucose (5%) as a carbon source. Shown are dry yeast biomass (□), glucose (▴), ethanol (▵), acetate (•), and succinic acid (○) concentrations (g liter−1) present in the culture supernatant of sdh2 deletion strains with no overexpression (A) and SAK1 (B), HAP4 (C), and SAK1 and HAP4 (D) overexpression. Shown are data from one representative experiment (experiments were carried out at least in duplicates).

Strain AH13sdh2SAK (Fig. 2B), however, showed a different behavior, as it exhibited the typical two-phase growth of a Crabtree-positive wild-type yeast strain during batch fermentation on glucose. The ethanol formed during exponential growth was completely assimilated within the first 3 days of cultivation and was converted mainly into biomass (ca. 10 g liter−1 at the end of fermentation). Like a wild-type yeast strain, AH13sdh2SAK did not accumulate acetate or succinic acid (below 1 g liter−1 at the end of fermentation) (Fig. 2B). It seems that the sole overexpression of SAK1 suppresses the phenotype caused by the SDH2 deletion.

To further investigate the combinatory effect of these two modifications, we constructed strain AH13sdh2sdh1SAK, which additionally harbors the deletion of SDH1, the gene encoding the flavoprotein subunit of the succinate dehydrogenase complex (7). The additional deletion of SDH1 led to a reversal of the phenotype caused by SAK1 overexpression in the sdh2 deletion background, as this strain showed the behavior of a respiratory-deficient SDH disruptant. During a shake flask batch cultivation with glucose as the carbon source (5% initial glucose), AH13sdh2sdh1SAK showed a single growth phase on glucose, did not convert the ethanol produced during exponential growth into biomass, and accumulated acetate up to a titer of 2 g liter−1 within 72 h of cultivation (data not shown).

DISCUSSION

One aim of the present study was to explore the physiological effects of SAK1 overexpression and to explore whether an elevated SAK1 gene dose is, considering the multiple types of regulation of the Snf1 complex, sufficient for shifting the fermentative/oxidative balance toward respiration in the presence of excess glucose. This question has not been addressed in depth so far, as the only phenotypic feature that has been investigated for cells with elevated levels of Sak1p is the invertase activity, which is subject to glucose repression (4). In the corresponding study, the overexpression of SAK1 did not affect invertase activity under glucose-repressed conditions, although an increased phosphorylation of Snf1 threonine 210 was observed (36). It was concluded that the phosphorylation of Snf1 threonine 210 is required but not sufficient for Snf1 activation. This is in line with a previously stated two-step model for the activation process of the Snf1 kinase (30, 35). According to this model the activation process comprises the phosphorylation of Snf1 threonine 210 and, as a second step, the association of Snf1p with Snf4p, which represents the γ-subunit of the Snf1 kinase complex. Upon the depletion of glucose, Snf4p counteracts the autoinhibition of Snf1p by interacting with its regulatory domain, leading to an active, open conformation of the complex (25, 42). The presence of Snf4p was presumed to be necessary for Snf1 kinase activation, since Δsnf4 cells grow poorly on alternative carbon sources and are defective in the derepression of invertase (37). However, in the present study the overexpression of SAK1 led to an increased growth rate, an increased biomass yield, and reduced ethanol and glycerol formation rates in the presence of excess glucose as well as growth on glycerol in the presence of 2-DOG (Tables 3 and 4 and Fig. 1). These results are consistent with a shift of the fermentative/oxidative balance toward respiration and indicate that the phosphorylation of Snf1 threonine 210 is sufficient for Snf1 activation under glucose-repressed conditions. The latter is supported by the results of two other studies which showed that the γ-subunit is not required for an active Snf1 complex. It was observed previously that a fraction of Mig1p, a downstream target of the Snf1 kinase, is phosphorylated even in Δsnf4 cells and that the γ-subunit is dispensable for Snf1 activity in vitro (15, 35). SAK1 overexpression, however, did not lead to a fully activated Snf1 complex under glucose-repressed conditions in the present study, since fermentative metabolism still occurred in the corresponding strains and growth on galactose or ethanol was not observed in the presence of 2-DOG (Table 3 and Fig. 1).

In this study we have also investigated whether an increased gene dose of SAK1 and HAP4 has an impact on cell physiology under glucose-derepressed conditions. Even in a fully glucose-derepressed state of the cell (e.g., when cultivated on ethanol), additional effects due to SAK1 and HAP4 overexpression and a further shift of the respirofermentative balance toward respiration cannot be excluded. Such effects were indeed observed, as the strain overexpressing SAK1 exhibited higher biomass yields than did the wild type when grown on a carbon mixture consisting of galactose, ethanol, and glycerol or solely ethanol (Table 4). This indicates that increased levels of SAK1 influence the balance between the active and inactive states of Snf1 kinase also under glucose-derepressed conditions. In contrast, biomass yields of the strain overexpressing HAP4 were reduced under glucose-derepressed conditions.

To our surprise, the overexpression of SAK1 in an sdh2 deletion background suppressed the growth phenotype caused by the SDH2 deletion, as the corresponding yeast strain showed a two-phase growth like a Crabtree-positive wild-type yeast strain during batch fermentation on glucose (Fig. 2B). The ethanol formed during exponential growth was completely assimilated and converted mainly into biomass, and only negligible amounts of acetate or succinate were accumulated by this strain. The additional deletion of the Sdh1p subunit led to a reversion of this phenotype, again resulting in the behavior of a respiratory-deficient SDH disruptant. In contrast to the strains overexpressing HAP4 and SAK1 simultaneously or overexpressing solely HAP4, which showed respiratory-deficient behavior, transcript analysis of the SAK1 overexpression strain showed a strong upregulation of the SDH1 gene (by a factor of 12) when cells were grown on ethanol and glycerol (Table 5). These results indicate that SAK1 overexpression acts as a suppressor mutation of the SDH2 deletion, possibly by upregulating SDH1, which could restore succinate dehydrogenase activity. Elevated levels of SDH1 could compensate for the lack of SDH2, resulting in an active succinate dehydrogenase complex. It was previously shown that the Sdh2p subunit is not essential for an active succinate dehydrogenase complex. In a previous study of sake (Japanese rice wine) yeast strains, SDH2 or SDH1 disruptants showed residual SDH activity and growth on rich medium containing glycerol (26). In another study, a slight growth of strains with a single disruption of each of the four subunits of the SDH complex (Sdhp1 to Sdhp4) was observed on ethanol, which implies that there is SDH activity in all four disruptants (40).

During a 216-h batch cultivation on glucose, the SDH2 disruptant formed succinic acid up to a titer of about 3.5 g liter−1. The disruption of succinate dehydrogenase activity enables succinate accumulation, since it prevents the succinate produced from being further metabolized (41). Under the same conditions the sdh2 deletion strain overexpressing HAP4 and SAK1 formed succinic acid continuously up to a titer of 8.5 g liter−1 at a yield of 0.26 mol (mol glucose)−1. The succinic acid was formed on glucose as well as on ethanol after the diauxic shift. This significantly increased succinic acid production in comparison to that of the reference strain carrying the corresponding empty plasmids could be due to a derepression of the oxidative metabolism. A strong repression of respiratory metabolism and function, including the TCA cycle, the glyoxylate shunt, and the respiratory chain, under aerobic, anaerobic, and even glucose-limited conditions was described previously for SDH3 disruptants (8). One proposed reason for the decreased respiratory function in the SDH3 deletion strains was the downregulation of genes of the heme activator protein (HAP) complex, which in turn would explain the observed downregulation of respiratory genes and some of the TCA cycle genes. The beneficial effects of an increased HAP4 and SAK1 gene dosage on the succinic acid production observed for SDH disruptants in the present study could therefore be an effect of the upregulation of TCA cycle and glyoxylate shunt genes but also of genes responsible for oxidative phosphorylation. Oxidative phosphorylation is required to reoxidize the NADH generated during oxidative succinate production from ethanol. Transcript level analysis has shown an upregulation of marker genes of the TCA cycle, the glyoxylate shunt, and the respiratory chain (Table 5). However, a complete derepression of respiratory metabolism in sdh2 deletion strains overexpressing SAK1 and HAP4 or HAP4 alone was not observed, since fermentative metabolism still occurred, and ethanol formed during exponential growth on glucose was not entirely assimilated and converted to succinate via the glyoxylate shunt or the oxidative part of the TCA cycle.

With the shift of the fermentative/oxidative balance due to SAK1 overexpression, we have presented another example of how a broad physiological impact on cell physiology can be achieved by altering just one regulatory factor. Influencing such factors holds tremendous potential for optimizing microorganisms for industrial applications by relatively simple means. Regulatory proteins far up in the control hierarchy of the cell, like the Snf1 complex, seem to be particularly interesting in this respect.

Acknowledgments

This work was supported by the Deutsche Bundesstiftung Umwelt (AZ 13180).

Andreas M. Raab thanks Jeffrey Schultchen for support in questions concerning analytics and acknowledges the contribution of Mirjam Schwansee to transcript level analysis experiments.

Footnotes

▿

Published ahead of print on 21 January 2011.

REFERENCES

  • 1.Arikawa, Y., et al. 1999. Isolation of sake yeast strains possessing various levels of succinate- and/or malate-producing abilities by gene disruption or mutation. J. Biosci. Bioeng. 87:333-339. [DOI] [PubMed] [Google Scholar]
  • 2.Arikawa, Y., et al. 1999. Effect of gene disruptions of the TCA cycle on production of succinic acid in Saccharomyces cerevisiae. J. Biosci. Bioeng. 87:28-36. [DOI] [PubMed] [Google Scholar]
  • 3.Blom, J., M. J. De Mattos, and L. A. Grivell. 2000. Redirection of the respiro-fermentative flux distribution in Saccharomyces cerevisiae by overexpression of the transcription factor Hap4p. Appl. Environ. Microbiol. 66:1970-1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Carlson, M., and D. Botstein. 1982. Two differentially regulated mRNAs with different 5′ ends encode secreted with intracellular forms of yeast invertase. Cell 28:145-154. [DOI] [PubMed] [Google Scholar]
  • 5.Celenza, J. L., and M. Carlson. 1989. Mutational analysis of the Saccharomyces cerevisiae SNF1 protein kinase and evidence for functional interaction with the SNF4 protein. Mol. Cell. Biol. 9:5034-5044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Celenza, J. L., and M. Carlson. 1984. Structure and expression of the SNF1 gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 4:54-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chapman, K. B., S. D. Solomon, and J. D. Boeke. 1992. SDH1, the gene encoding the succinate dehydrogenase flavoprotein subunit from Saccharomyces cerevisiae. Gene 118:131-136. [DOI] [PubMed] [Google Scholar]
  • 8.Cimini, D., K. R. Patil, C. Schiraldi, and J. Nielsen. 2009. Global transcriptional response of Saccharomyces cerevisiae to the deletion of SDH3. BMC Syst. Biol. 3:17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cupp, J. R., and L. McAlister-Henn. 1991. NAD(+)-dependent isocitrate dehydrogenase. Cloning, nucleotide sequence, and disruption of the IDH2 gene from Saccharomyces cerevisiae. J. Biol. Chem. 266:22199-22205. [PubMed] [Google Scholar]
  • 10.Denis, C. L., J. Ferguson, and E. T. Young. 1983. mRNA levels for the fermentative alcohol dehydrogenase of Saccharomyces cerevisiae decrease upon growth on a nonfermentable carbon source. J. Biol. Chem. 258:1165-1171. [PubMed] [Google Scholar]
  • 11.DeRisi, J. L., V. R. Iyer, and P. O. Brown. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278:680-686. [DOI] [PubMed] [Google Scholar]
  • 12.De Vit, M. J., J. A. Waddle, and M. Johnston. 1997. Regulated nuclear translocation of the Mig1 glucose repressor. Mol. Biol. Cell 8:1603-1618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dombek, K. M., N. Kacherovsky, and E. T. Young. 2004. The Reg1-interacting proteins, Bmh1, Bmh2, Ssb1, and Ssb2, have roles in maintaining glucose repression in Saccharomyces cerevisiae. J. Biol. Chem. 279:39165-39174. [DOI] [PubMed] [Google Scholar]
  • 14.Duenas-Sanchez, R., A. C. Codon, A. M. Rincon, and T. Benitez. 2010. Increased biomass production of industrial bakers' yeasts by overexpression of Hap4 gene. Int. J. Food Microbiol. 143:150-160. [DOI] [PubMed] [Google Scholar]
  • 15.Elbing, K., R. R. McCartney, and M. C. Schmidt. 2006. Purification and characterization of the three Snf1-activating kinases of Saccharomyces cerevisiae. Biochem. J. 393:797-805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fleige, S., et al. 2006. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol. Lett. 28:1601-1613. [DOI] [PubMed] [Google Scholar]
  • 17.Flikweert, M. T., et al. 1996. Pyruvate decarboxylase: an indispensable enzyme for growth of Saccharomyces cerevisiae on glucose. Yeast 12:247-257. [DOI] [PubMed] [Google Scholar]
  • 18.Frederick, D. L., and K. Tatchell. 1996. The REG2 gene of Saccharomyces cerevisiae encodes a type 1 protein phosphatase-binding protein that functions with Reg1p and the Snf1 protein kinase to regulate growth. Mol. Cell. Biol. 16:2922-2931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gancedo, J. M. 1998. Yeast carbon catabolite repression. Microbiol. Mol. Biol. Rev. 62:334-361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Guldener, U., S. Heck, T. Fielder, J. Beinhauer, and J. H. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:2519-2524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hedbacker, K., S. P. Hong, and M. Carlson. 2004. Pak1 protein kinase regulates activation and nuclear localization of Snf1-Gal83 protein kinase. Mol. Cell. Biol. 24:8255-8263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Henricsson, C., et al. 2005. Engineering of a novel Saccharomyces cerevisiae wine strain with a respiratory phenotype at high external glucose concentrations. Appl. Environ. Microbiol. 71:6185-6192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hong, S. P., F. C. Leiper, A. Woods, D. Carling, and M. Carlson. 2003. Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases. Proc. Natl. Acad. Sci. U. S. A. 100:8839-8843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hovland, P. G., M. Tecklenberg, and R. A. Sclafani. 1997. Overexpression of the protein kinase Pak1 suppresses yeast DNA polymerase mutations. Mol. Gen. Genet. 256:45-53. [DOI] [PubMed] [Google Scholar]
  • 25.Jiang, R., and M. Carlson. 1996. Glucose regulates protein interactions within the yeast SNF1 protein kinase complex. Genes Dev. 10:3105-3115. [DOI] [PubMed] [Google Scholar]
  • 26.Kubo, Y., H. Takagi, and S. Nakamori. 2000. Effect of gene disruption of succinate dehydrogenase on succinate production in a sake yeast strain. J. Biosci. Bioeng. 90:619-624. [DOI] [PubMed] [Google Scholar]
  • 27.Lang, C., and A. C. Looman. 1995. Efficient expression and secretion of Aspergillus niger RH5344 polygalacturonase in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 44:147-156. [DOI] [PubMed] [Google Scholar]
  • 28.Lascaris, R., et al. 2003. Hap4p overexpression in glucose-grown Saccharomyces cerevisiae induces cells to enter a novel metabolic state. Genome Biol. 4:R3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lascaris, R., et al. 2004. Overexpression of HAP4 in glucose-derepressed yeast cells reveals respiratory control of glucose-regulated genes. Microbiology 150:929-934. [DOI] [PubMed] [Google Scholar]
  • 30.Leech, A., N. Nath, R. R. McCartney, and M. C. Schmidt. 2003. Isolation of mutations in the catalytic domain of the snf1 kinase that render its activity independent of the snf4 subunit. Eukaryot. Cell 2:265-273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lemire, B. D., and K. S. Oyedotun. 2002. The Saccharomyces cerevisiae mitochondrial succinate:ubiquinone oxidoreductase. Biochim. Biophys. Acta 1553:102-116. [DOI] [PubMed] [Google Scholar]
  • 32.Lombardo, A., K. Carine, and I. E. Scheffler. 1990. Cloning and characterization of the iron-sulfur subunit gene of succinate dehydrogenase from Saccharomyces cerevisiae. J. Biol. Chem. 265:10419-10423. [PubMed] [Google Scholar]
  • 33.Ludin, K., R. Jiang, and M. Carlson. 1998. Glucose-regulated interaction of a regulatory subunit of protein phosphatase 1 with the Snf1 protein kinase in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U. S. A. 95:6245-6250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lundin, M., J. O. Nehlin, and H. Ronne. 1994. Importance of a flanking AT-rich region in target site recognition by the GC box-binding zinc finger protein MIG1. Mol. Cell. Biol. 14:1979-1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.McCartney, R. R., and M. C. Schmidt. 2001. Regulation of Snf1 kinase. Activation requires phosphorylation of threonine 210 by an upstream kinase as well as a distinct step mediated by the Snf4 subunit. J. Biol. Chem. 276:36460-36466. [DOI] [PubMed] [Google Scholar]
  • 36.Nath, N., R. R. McCartney, and M. C. Schmidt. 2003. Yeast Pak1 kinase associates with and activates Snf1. Mol. Cell. Biol. 23:3909-3917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Neigeborn, L., and M. Carlson. 1984. Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae. Genetics 108:845-858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Otterstedt, K., et al. 2004. Switching the mode of metabolism in the yeast Saccharomyces cerevisiae. EMBO Rep. 5:532-537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Polakowski, T., U. Stahl, and C. Lang. 1998. Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl. Microbiol. Biotechnol. 49:66-71. [DOI] [PubMed] [Google Scholar]
  • 40.Przybyla-Zawislak, B., D. M. Gadde, K. Ducharme, and M. T. McCammon. 1999. Genetic and biochemical interactions involving tricarboxylic acid cycle (TCA) function using a collection of mutants defective in all TCA cycle genes. Genetics 152:153-166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Raab, A. M., G. Gebhardt, N. Bolotina, D. Weuster-Botz, and C. Lang. Metabolic engineering of Saccharomyces cerevisiae for the biotechnological production of succinic acid. Metab. Eng. 12:518-525. [DOI] [PubMed]
  • 41a.Romano, J. D., and R. Kolter. 2005. Pseudomonas-Saccharomyces interactions: influence of fungal metabolism on bacterial physiology and survival. J. Bacteriol. 187:940-948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Santangelo, G. M. 2006. Glucose signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 70:253-282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Sanz, P., G. R. Alms, T. A. Haystead, and M. Carlson. 2000. Regulatory interactions between the Reg1-Glc7 protein phosphatase and the Snf1 protein kinase. Mol. Cell. Biol. 20:1321-1328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Schaaff, I., J. Heinisch, and F. K. Zimmermann. 1989. Overproduction of glycolytic enzymes in yeast. Yeast 5:285-290. [DOI] [PubMed] [Google Scholar]
  • 45.Sutherland, C. M., et al. 2003. Elm1p is one of three upstream kinases for the Saccharomyces cerevisiae SNF1 complex. Curr. Biol. 13:1299-1305. [DOI] [PubMed] [Google Scholar]
  • 46.Tachibana, C., et al. 2005. Combined global localization analysis and transcriptome data identify genes that are directly coregulated by Adr1 and Cat8. Mol. Cell. Biol. 25:2138-2146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Treitel, M. A., and M. Carlson. 1995. Repression by SSN6-TUP1 is directed by MIG1, a repressor/activator protein. Proc. Natl. Acad. Sci. U. S. A. 92:3132-3136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Treitel, M. A., S. Kuchin, and M. Carlson. 1998. Snf1 protein kinase regulates phosphorylation of the Mig1 repressor in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:6273-6280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Tzagoloff, A., and C. L. Dieckmann. 1990. PET genes of Saccharomyces cerevisiae. Microbiol. Rev. 54:211-225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.van Maris, A. J., et al. 2001. Modulating the distribution of fluxes among respiration and fermentation by overexpression of HAP4 in Saccharomyces cerevisiae. FEMS Yeast Res. 1:139-149. [DOI] [PubMed] [Google Scholar]
  • 51.Veen, M., U. Stahl, and C. Lang. 2003. Combined overexpression of genes of the ergosterol biosynthetic pathway leads to accumulation of sterols in Saccharomyces cerevisiae. FEMS Yeast Res. 4:87-95. [DOI] [PubMed] [Google Scholar]
  • 51a.Villas-Boas, S. G., D. G. Delicado, M. Akesson, and J. Nielsen. 2003. Simultaneous analysis of amino and nonamino organic acids as methyl chloroformate derivatives using gas chromatography-mass spectrometry. Anal. Biochem. 322:134-138. [DOI] [PubMed] [Google Scholar]
  • 52.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. [DOI] [PubMed] [Google Scholar]
  • 53.Young, E. T., K. M. Dombek, C. Tachibana, and T. Ideker. 2003. Multiple pathways are coregulated by the protein kinase Snf1 and the transcription factors Adr1 and Cat8. J. Biol. Chem. 278:26146-26158. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES