Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2011 Feb 4;77(7):2325–2331. doi: 10.1128/AEM.02149-10

Antibacterial Activity and Mechanism of Action of Zinc Oxide Nanoparticles against Campylobacter jejuni ▿

Yanping Xie 1, Yiping He 2,*, Peter L Irwin 2, Tony Jin 3, Xianming Shi 1,*
PMCID: PMC3067441  PMID: 21296935

Abstract

The antibacterial effect of zinc oxide (ZnO) nanoparticles on Campylobacter jejuni was investigated for inhibition and inactivation of cell growth. The results showed that C. jejuni was extremely sensitive to treatment with ZnO nanoparticles. The MIC of ZnO nanoparticles for C. jejuni was determined to be 0.05 to 0.025 mg/ml, which is 8- to 16-fold lower than that for Salmonella enterica serovar Enteritidis and Escherichia coli O157:H7 (0.4 mg/ml). The action of ZnO nanoparticles against C. jejuni was determined to be bactericidal, not bacteriostatic. Scanning electron microscopy examination revealed that the majority of the cells transformed from spiral shapes into coccoid forms after exposure to 0.5 mg/ml of ZnO nanoparticles for 16 h, which is consistent with the morphological changes of C. jejuni under other stress conditions. These coccoid cells were found by ethidium monoazide-quantitative PCR (EMA-qPCR) to have a certain level of membrane leakage. To address the molecular basis of ZnO nanoparticle action, a large set of genes involved in cell stress response, motility, pathogenesis, and toxin production were selected for a gene expression study. Reverse transcription-quantitative PCR (RT-qPCR) showed that in response to treatment with ZnO nanoparticles, the expression levels of two oxidative stress genes (katA and ahpC) and a general stress response gene (dnaK) were increased 52-, 7-, and 17-fold, respectively. These results suggest that the antibacterial mechanism of ZnO nanoparticles is most likely due to disruption of the cell membrane and oxidative stress in Campylobacter.


Directly adding antimicrobial agents to food or into packaging materials during food processing is considered an effective means of controlling microbial contaminants in food and extending the shelf life of fresh produce and meat. In recent years, inorganic antimicrobial agents, such as metal oxides, have received increasing attention in food applications because they are not only stable under high temperatures and pressures that may occur in harsh food-processing conditions, but they are also generally regarded as safe for human beings and animals relative to organic substances (6, 24).

Zinc oxide (ZnO) is listed as “generally recognized as safe” (GRAS) by the U.S. Food and Drug Administration (21CFR182.8991). As a food additive, it is the most commonly used zinc source in the fortification of cereal-based foods. Because of its antimicrobial properties, ZnO has been incorporated into the linings of food cans in packages for meat, fish, corn, and peas to preserve colors and to prevent spoilage. Nano-sized particles of ZnO have more pronounced antimicrobial activities than large particles, since the small size (less than 100 nm) and high surface-to-volume ratio of nanoparticles allow for better interaction with bacteria. Recent studies have shown that these nanoparticles have selective toxicity to bacteria but exhibit minimal effects on human cells (21). ZnO nanoparticles have been shown to have a wide range of antibacterial activities against both Gram-positive and Gram-negative bacteria, including major foodborne pathogens like Escherichia coli O157:H7, Salmonella, Listeria monocytogenes, and Staphylococcus aureus (13, 14), but currently there is no information available on their antibacterial effect against species of Campylobacter. Campylobacter jejuni is a leading cause of microbial foodborne illness worldwide. In fact, it has recently been shown that approximately 80% of poultry products are contaminated with this pathogen (11). Consumption of Campylobacter-contaminated food and water usually causes a mild to severe gastrointestinal infection in humans that can sometimes develop into a life-threatening disease called Guillain-Barré syndrome (28). Therefore, it is important to focus on the use of ZnO particles as a potential food safety intervention technology to effectively control Campylobacter and other microbial contaminants in food.

To make better use of ZnO nanoparticles in food products and to assist in the development of powerful, but nontoxic, antimicrobial derivatives, it is necessary to understand the mechanism of action of ZnO nanoparticles against bacteria, but to date, the process underlying their antibacterial effect is not clear. However, a few studies have suggested that the primary cause of the antibacterial function might be from the disruption of cell membrane activity (4). Another possibility could be the induction of intercellular reactive oxygen species, including hydrogen peroxide (H2O2), a strong oxidizing agent harmful to bacterial cells (13, 22). It has also been reported that ZnO can be activated by UV and visible light to generate highly reactive oxygen species such as OH−, H2O2, and O22−. The negatively charged hydroxyl radicals and superoxides cannot penetrate into the cell membrane and are likely to remain on the cell surface, whereas H2O2 can penetrate into bacterial cells (18). To better understand the nature of the inhibitory and lethal effects of ZnO nanoparticles on bacteria, we used C. jejuni as a model organism to investigate this mechanism. C. jejuni is a Gram-negative, spiral-shaped, highly motile, thermophilic and microaerophilic bacterium that grows optimally in a neutral pH and microaerobic environment at 42°C. Unlike other major foodborne pathogens, such as E. coli O157:H7, Salmonella, and L. monocytogenes, C. jejuni has a low tolerance for oxygen but does require some for growth (i.e., it is microaerophilic). Due to the lack of some important oxidative stress response genes (soxRS and oxyR) and a global stationary-phase stress response gene (rpoS), C. jejuni is extremely sensitive to oxidative stress as well as to other environmental stresses. Exposure of this organism to different stresses results in a remarkable morphological shift from spiral-shaped cells to coccoid forms, which is associated with the loss of culturability (10, 25). Due to these distinguishing characteristics and sensitive stress responses, C. jejuni is highly suitable for studying the modes of action of ZnO nanoparticles against bacterial cells, especially in the assessment of cell membrane integrity and the reactive oxygen species-induced stress response.

The purpose of this research was to evaluate the antibacterial effects and to investigate the mechanism of action of ZnO nanoparticles against C. jejuni by examining cell morphology, membrane permeability, and gene expression through the utilization of scanning electron microscopy as well as advanced molecular methods. The results were compared to those for other foodborne pathogens, including E. coli O157:H7 and Salmonella.

MATERIALS AND METHODS

ZnO nanoparticles.

ZnO nanoparticles (purity over 99.7%) with an average size of ∼30 nm and a Brunauer-Emmett-Teller (BET)-specific surface area of ∼35 m2/g were purchased from Inframat Advanced Materials LLC (Manchester, CT). A stock suspension was prepared by resuspending the nanoparticles in double-distilled water (ddH2O) to yield a final concentration of 100 mg/ml; the suspension was kept at 4°C. Immediately after the suspension was subjected to vigorous vortex mixing, aliquots of the suspension were added into Mueller-Hinton medium (MH; Becton Dickinson Co., Sparks, MD) for the following experiments.

Bacterial culture conditions and antibacterial test.

C. jejuni strains 81-176, ATCC 35918, and ATCC 49943 were grown at 42°C in MH broth in a microaerobic workstation (Don Whitley Scientific Ltd., Shipley, United Kingdom) in which 5% O2, 10% CO2, 85% N2, and 82% relative humidity were maintained. A mixed culture of the three C. jejuni strains was prepared by combining equal volumes (1/3) of each pure culture growing at the late log phase. Salmonella enterica serovar Enteritidis ATCC 13076 and E. coli O157:H7 ATCC 43889 were aerobically grown at 37°C in Luria-Bertani medium (Becton Dickinson). Bacterial growth inhibition was tested by inoculating ca.104 CFUs of C. jejuni cells onto each MH agar plate or into 20 ml of MH broth containing various concentrations (0, 0.025, 0.03, 0.04, 0.05, and 0.10 mg/ml) of ZnO nanoparticles. After the inocula were incubated for 16 h, inhibition of cell growth was determined by counting the numbers of CFUs on the plates or by the turbidities of the cell cultures. The inoculas that showed no cell growth were further verified for cell culturability by spreading 100-μl aliquots of the cultures onto drug-free MH agar plates to determine the bactericidal (bacteria-killing) or bacteriostatic (bacteria-inhibiting) effect of ZnO nanoparticles. The MICs of ZnO nanoparticles for C. jejuni, E. coli O157:H7, and Salmonella were determined using a broth microdilution method reported previously (19). Briefly, serial 2-fold dilutions of nanoparticles ranging from 0.00625 to 1.6 mg/ml were prepared in a 96-well microtiter plate using MH or LB broth. Freshly grown bacterial cells were inoculated into each well to give a final concentration of 104 CFU/ml. After the inocula were incubated microaerobically for 24 h at 42°C for C. jejuni or aerobically for 16 h at 37°C for E. coli O157:H7 and Salmonella, cell growth in each well was monitored and compared with that of the positive-control well to which no ZnO nanoparticles were added. The MIC was recorded as the lowest concentration of ZnO nanoparticles that completely inhibited cell growth.

Examination of cell morphology by scanning electron microscope (SEM).

Mid-log-phase C. jejuni cultures were treated with 0.5 mg/ml of ZnO nanoparticles for 12 h under microaerobic conditions. Aliquots of 200 μl of treated and untreated cell suspensions were deposited on glass coverslips. After being air dried for 1 h, the coverslips were fixed with a primary fixative solution containing 2.5% glutaraldehyde and 0.1 M imidazole buffer solution (pH 7.2) for 2 h. Subsequently, the fixative solution was exchanged for 0.1 M imidazole buffer, followed by dehydration with a series of ethanol solutions (50%, 80%, and 100%), with three ethanol changes at each concentration. Finally, the coverslips were dried by liquid CO2-ethanol exchange in a DCP-1 Critical Point dryer (Denton Vacuum, Inc., Cherry Hill, NJ). The coverslips were mounted on SEM stubs with carbon adhesive tabs and then sputter coated with a thin layer of gold using a Scancoat Six sputter coater (BOC Edwards, Wilmington, MA). Digital images of the treated and untreated C. jejuni cells were acquired using a Quanta 200 FEG scanning electron microscope (FEI, Inc., Hillsboro, OR) at an accelerating voltage of 10 kV and instrumental magnifications of ×25,000.

EMA treatment, DNA isolation, and EMA-qPCR assay.

Ethidium monoazide (EMA) treatment of C. jejuni cells and a follow-up quantitative PCR (qPCR) were carried out as described before (10). Briefly, 1 ml of freshly grown cells was treated with 20 mg/ml of EMA in the dark for 5 min and subsequently exposed to a 600-W halogen light for 1 min. Cells were then immediately washed with phosphate-buffered saline and subjected to DNA extraction using a DNeasy tissue kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. The hipO gene was selected as a target for detection in qPCR because the DNA sequence is unique to C. jejuni. The primers and TaqMan probe of hipO used in this experiment were reported in previous work (9).

RNA preparation and RT-qPCR analysis of gene expression.

To prepare total cellular RNA, 80 ml of the C. jejuni 81-176 culture in the late log phase of growth was treated or not treated with ZnO nanoparticles at 0.1 mg/ml for 30 min. The ZnO concentration used herein was determined from the cell-killing results shown in Fig. 1 A. After the treatment, cells were harvested by centrifugation at 4,000 × g for 10 min at 4°C. RNA isolation was carried out using TRI Reagent according to the manufacturer's instructions (Molecular Research Center, Inc., Cincinnati, OH). DNase I treatment and reverse transcription (RT) of the RNA samples were done as described before (8). Quantification of cDNA was performed on a 7500 real-time PCR system (Applied Biosystems, Foster City, CA). For PCR, all the listed primers were designed using Primer3 software (http://frodo.wi.mit.edu/primer3). Each 20-μl PCR mixture contained 0.25× EvaGreen dye (Biotium, Hayward, CA), 0.25 μM each primer, 2 μl of cDNA template, 5 units of Platinum Taq DNA polymerase, and buffer (Invitrogen, Inc., Carlsbad, CA). The amplification program was 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. The gyrA gene was used as a reference for data normalization. tsf and 16S rRNA housekeeping genes were also included as controls to ensure data reliability. All the samples, including no-RT and no-template controls, were analyzed in triplicate. Data analysis was performed using the 2−ΔΔCT method, where ΔΔCT = ΔCT(treated sample) − ΔCT(untreated sample), ΔCT = CT(target gene) − CT(gyrA), and CT is the threshold cycle value for the amplified gene (15).

FIG. 1.

FIG. 1.

Antibacterial activities of ZnO nanoparticles against C. jejuni, S. enterica serovar Enteritidis, and E. coli O157:H7. Freshly grown bacterial cultures (108 to 109 CFU/ml) were treated with a range of concentrations of ZnO nanoparticles. Culturable cell numbers were determined at the time intervals after treatment shown on the figure. The values for CFU/ml are the means of 12 replicates. Error bars indicate standard deviations of the means.

RESULTS

Growth inhibition of C. jejuni by ZnO nanoparticles.

Growth inhibition of C. jejuni 81-176 was examined both on agar plates and in broth containing a range of concentrations (0, 0.025, 0.03, 0.04, 0.05, and 0.10 mg/ml) of ZnO nanoparticles. On the plates spread with 104 CFU/plate and in the broth inoculated with the equivalent number of cells, bacterial growth was completely inhibited at ≥0.03 mg/ml of ZnO nanoparticles. However, at a concentration of 0.025 mg/ml, ZnO nanoparticles had a modest effect on cell growth, resulting in the recovery of fewer viable cells than from the untreated control suspension. To determine if the growth inhibition was caused by an inhibitory or lethal effect of ZnO nanoparticles, 100-μl aliquots of the treated-cell suspension were spread onto drug-free MH plates. The results showed that the cells treated with ≥0.03 mg/ml of the nanoparticles for 16 h were no longer culturable, suggesting a lethal effect of ZnO nanoparticles against C. jejuni. In addition, the MIC of ZnO nanoparticles for all three C. jejuni strains was determined to be between 0.05 and 0.025 mg/ml, which was 8- to 16-fold lower than that (0.4 mg/ml) for E. coli O157:H7 and S. enterica serovar Enteritidis, clearly indicating a higher level of susceptibility of C. jejuni to ZnO nanoparticles.

Lethal effect of ZnO nanoparticles on C. jejuni.

The lethal effect of ZnO nanoparticles on C. jejuni was further investigated using ca. 108 CFU/ml of freshly grown pure and mixed cultures of C. jejuni strains 81-176, ATCC 35918, and ATCC 49943. Cell culturability of all three C. jejuni strains was affected by ZnO nanoparticles at all concentrations tested (Fig. 1A to D). Most significantly, 0.5, 0.3, and 0.1 mg/ml of ZnO nanoparticles resulted in complete killing (100%) of 108 CFU/ml of C. jejuni cells in 3 h or less. The pure and mixed cultures of three C. jejuni strains showed a similar susceptibility to ZnO nanoparticles. In contrast to the strong and rapid bactericidal action against C. jejuni, 20- to 100-fold-higher concentrations (10 mg/ml) of ZnO nanoparticles caused only a 1- or 2-log reduction in viable E. coli O157:H7 and S. enterica serovar Enteritidis cells after an 8-h exposure (Fig. 1E and F). These results demonstrated that ZnO nanoparticles are effective at killing C. jejuni even at low concentrations.

Morphological analysis of C. jejuni.

Effects of ZnO nanoparticles on C. jejuni cell morphology were examined by scanning electron microscopy. After a 12-h treatment with 0.5 mg/ml of ZnO nanoparticles in MH broth under microaerobic conditions, spiral-shaped C. jejuni cells underwent a dramatic change from spiral to coccoid morphological forms. The SEM image in Fig. 2 A illustrates the dominance of coccoid forms in the treated cells and shows the formation of irregular cell surfaces and cell wall blebs in great detail. These coccoid cells remained intact and possessed sheathed polar flagella. The image of the untreated cells clearly displays spiral shapes (Fig. 2B). Moreover, this ZnO nanoparticle-induced formation of coccoid cells was confirmed by confocal microscopic visualization (data not shown). Not surprisingly, a similar transformation in morphology was observed when C. jejuni was exposed to different environmental stresses, including oxidative stress (10, 25). To determine the bactericidal versus bacteriostatic effect of ZnO nanoparticles, cultures previously exposed to ZnO nanoparticles and exhibiting a coccoid cell morphology were spread plated. No growth of the coccoid cells was observed on drug-free MH plates, confirming that they were no longer culturable. Together these results suggest that ZnO nanoparticles cause not only cell morphology changes but also a lethal effect against C. jejuni.

FIG. 2.

FIG. 2.

Scanning electron microscopic images of C. jejuni. (A) C. jejuni cells in the mid-log phase of growth were treated with 0.5 mg/ml of ZnO nanoparticles for 12 h under microaerobic conditions. (B) Untreated cells from the same growth conditions were used as a control.

EMA-PCR assessment of cell membrane integrity.

EMA selectively enters into membrane-compromised cells and binds to cellular DNA, which subsequently inhibits PCR amplification of the DNA. The reduction in PCR amplification has been used as an indicator of cell membrane leakage (17). To assess the membrane integrity of the coccoid cells, EMA-qPCR was performed on the C. jejuni cultures treated with 0, 0.1, 0.3, and 0.5 mg/ml of ZnO nanoparticles for 12 h. The results in Fig. 3 show that the cells treated with 0.3 and 0.5 mg/ml of ZnO nanoparticles had a >10-fold (1-log) reduction in DNA amplification, indicating increased penetration of EMA into the treated cells. This result demonstrates that the treatment of C. jejuni with ZnO nanoparticles increases cell membrane permeability (i.e., damages membrane integrity).

FIG. 3.

FIG. 3.

EMA-qPCR of C. jejuni membrane integrity. Mid-log-phase cells exposed to different concentrations of ZnO nanoparticles were briefly treated with (black bars) and without (white bars) EMA. Inhibition of DNA amplification was quantified by real-time PCR of the hipO gene. Reduced DNA amplification in cells exposed to 0.3 and 0.5 mg/ml of ZnO nanoparticles indicates a certain degree of membrane leakage in the treated cells.

Gene expression profile of C. jejuni in response to ZnO nanoparticle treatment.

To understand the molecular basis of ZnO nanoparticle action against bacterial cells, a set of C. jejuni genes involved in general and oxidative stress responses, motility, pathogenesis, and toxin production were selected for a gene expression study (Table 1). After late-log-phase cells were exposed to 0.1 mg/ml of ZnO nanoparticles for 30 min, the transcripts of these genes were quantified by RT-qPCR. Most significantly, two oxidative stress genes, katA (encoding catalase) and ahpC (encoding alkyl hydroperoxide reductase), and one general stress gene, dnaK (encoding a chaperone), were found to be upregulated 52-, 7-, and 17-fold, respectively, in response to the treatment. The transcription levels of other stress response genes as well as the analyzed virulence genes were not significantly up- or downregulated (<3-fold) (Fig. 4). As expected, the expression levels of three housekeeping genes (gyrA, which encodes gyrase subunit A; tsf, which encodes elongation factor TS; and 16S rRNA) were not changed regardless of the treatment (Fig. 4). Similar gene expression results were obtained from cells treated with 0.05 mg/ml of ZnO nanoparticles for the same length of time (data not shown). All these results suggest that the antibacterial mechanism of ZnO nanoparticles is likely due to oxidative stress in C. jejuni cells.

TABLE 1.

Genes and primers selected for RT-qPCR

Gene function/protein encodeda Gene Primer Sequence (5′→3′)
Oxidative stress response genes
    Peroxide-sensing regulator perR Forward TTCAATCTCTTTAGCGACGG
Reverse CACATTTGGCGCAAACAACA
    Flavodoxin I fldA Forward TCCACCAAGACTAAGCCCTG
Reverse CAGAAGGAGCGGCTAATACAA
    Iron-binding protein dps Forward CCACTAATGTTAATATGCGTTCC
Reverse TGTGCTTGATAATCTTGCGACAA
    Superoxide dismutase (Fe) sodB Forward TGGCGGTTCATGTCAAAGTA
Reverse ACCAAAACCATCCTGAACCA
    Alkyl hydroperoxide reductase ahpC Forward AGTTGCCCTTCGTGGTTCGT
Reverse ATCGCCCTTATTCCATCCTG
    Catalase katA Forward ACCGTTCATGCTAAGGGAAG
Reverse CCTACCAAGTCCCAGTTTCC
    Nonheme iron-containing ferritin cft Forward TTCTTCTTCGTGTTGTTCGC
Reverse GCTGGAGCCTTCTTGTTTGC
    Ferredoxin fdxA Forward CCCCACTTCTCATATCAGCG
Reverse ATGCGTTGAATGCGTAGGAC
    Rubrerythrin rbr Forward TGCAGCAGTTACTAGGTTTT
Reverse AGACATTTTAGAGAAGCGGC
    Ferric uptake regulator fur Forward CCATTTCTTTTGGTTCAGCAG
Reverse TGCAATCAAGGCTTGCTGTC
    Carbon storage regulator csrA Forward TCAAAGTCGTTCAAACAGGG
Reverse TCATTCTGAACAACAGAATGC
General stress response genes
    Probable thiol peroxidase tpx Forward GCCAGTTACAATGGTGCTGA
Reverse TTTGCCACAAAATCACTTGC
    Cochaperonin groES Forward AAACAACAGCCTCAGGCATAA
Reverse TTCTGTTCCACCGTATTTAGCA
    Chaperonin groEL Forward GCAGGCGATGGAACAACTAC
Reverse TCCATACCGCGTTTTACCTC
    Chaperone dnaK Forward CGGTATGCCACAAATCGAAG
Reverse GCTAAGTCCGCTTGAACCTG
    Cochaperone dnaJ Forward TTTAAAAGGCGGTGGATTTG
Reverse TTTTCTACGACGCGATGATG
    Bacterioferritin comigratory protein homolog BCP Forward ACCCCAGGTTGTACTACAGAAG
Reverse AGCAATCTTACCTGTTTCATCG
    RelA/Spot family protein spoT Forward GCCCCAATAGCCCATAGAC
Reverse ACCCCAAGCAAATCAAGAAC
    Rod shape-determining protein mreB Forward GAGCCTTCTGTTGTGGCAGTT
Reverse AGCGGATCATTTTTTCAGTCAT
    RND efflux system; membrane fusion protein cmeA Forward TATTACGCCGCTAACTTGAG
Reverse CAGCAAAGAAGAAGCACCAA
    RND efflux system; inner membrane transporter cmeB Forward TAATCCAGGTATGGGAGGTA
Reverse GGAAAGATAGAAATGTAAGCG
    RND efflux system; outer membrane lipoprotein cmeC Forward GGACGTTGAAGCAAGATGGT
Reverse AGTTGGCGCTGTAGGTGAAT
    Major outer membrane protein porA Forward TTGATAGCGAACTTGATGAT
Reverse ATACGAAGTCAGCACCAACG
    Inner membrane protein yagU Forward CTATTTCCATACCCCACAGC
Reverse CCTTTAATTGCAGAAGTTCC
    ATP-dependent Clp protease ATP-binding subunit clpA Forward GTAGGAGCTGGAAGCACAGG
Reverse ACGGCGACTTAGGGGTTTAT
Virulence factors and toxins
    Cytolethal distending toxin cluster cdtA Forward TCCACATTTGTGCGTGATTG
Reverse GATTTGGCGATGCTAGAGTTT
cdtB Forward AAAGCATCATTTCCATTGCG
Reverse ACCAAGAACAGCCACTCCAA
cdtC Forward CCAAAAGGAAGTTCATCAGC
Reverse AGCCTTTGCAACTCCTACTG
    Invasion antigen B ciaB Forward CTCATCATTTGGAACGACTTG
Reverse AATTATACTCATGCGGTGGC
    Flagellin A flaA Forward CCAATGTCGGCTCTGATTTG
Reverse GCGCAGGAAGTGGATTTTC
    Flagellin B flaB Forward CCGTTTCCATCACCATCTTC
Reverse ACACGCTTTGAAACAGGAGG
    Outer membrane fibronectin-binding protein cadF Forward TGCTTGTGGAGCTGGACGAG
Reverse TAAAAGCGGTGGATTTGGAC
    N-acetylneuraminic acid synthetase neuB Forward TGTTGAAGTGGGACTAAGCG
Reverse TCTAACTTGCCATCGCCTAA
    Vacuolating cytotoxins vacB Forward AAGGACGAGGTAGCATAGGT
Reverse CAAACGGCGATAGTGTTGAT
Housekeeping genes
    Gyrase subunit A gyrA Forward TGCTAAAGTGCGTGAAATCG
Reverse GCATTGGTGCGTTTTCCTAT
    Elongation factor TS tsf Forward GAACTCCGCGAAAGTACAGG
Reverse TTGCCACAAAATCTGTTTCG
    16S rRNA 16S rRNA gene Forward GCTCGTGTCGTGAGATGTTG
Reverse TCACCGTAGCATGGCTGAT
a

RND, resistance nodulation cell division family.

FIG. 4.

FIG. 4.

Relative gene expression levels of ZnO nanoparticle-treated and untreated C. jejuni. C. jejuni cells in the late log phase of growth were treated with 0 or 0.1 mg/ml of ZnO nanoparticles for 30 min. Transcripts of the selected genes were quantified by RT-qPCR, and data were analyzed using the comparative critical threshold (ΔΔCT) method. The relative expression ratio for each gene is presented as a log2 value in the histogram. A ratio greater than zero (>0) indicates upregulation of gene expression and a ratio below zero (<0) indicates downregulation. Error bars indicate standard deviations for three replicates.

DISCUSSION

ZnO nanoparticles have a broad spectrum of antibacterial activities. At concentrations higher than 0.24 mg/ml, they inhibit the growth of E. coli O157:H7, L. monocytogenes, and S. enterica serovar Enteritidis (12, 14). An inhibitory effect of ZnO nanoparticles on Bacillus subtilis, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, and Enterococcus faecalis has been reported as well (13). In this study, the antibacterial properties of ZnO nanoparticles were first investigated in C. jejuni, the most common foodborne pathogen. Our results showed that C. jejuni is extremely sensitive to ZnO nanoparticles, with a MIC 8- to 16-fold lower than those for E. coli O157:H7 and Salmonella. Antibacterial tests both on agar plates and in broth showed that 0.03 mg/ml of ZnO nanoparticles was sufficient to inactivate C. jejuni, whereas the concentration of nanoparticles needed for 100% inhibition of E. coli O157:H7 growth was between 0.24 and 0.98 mg/ml (4, 14), approximately 8 to 32 times higher than the lethal dosage for C. jejuni. It has previously been reported that the antibacterial activity of ZnO nanoparticles increases with reduction in particle size (16). The number of bacterial cells and the growth media used could also contribute to variation in results. For data consistency, we used 30-nm (average-sized) ZnO nanoparticles to test similar numbers of bacterial cells.

Previously, it was unclear whether ZnO nanoparticles function as a bactericidal or bacteriostatic agent, except for a few reports on the inhibition of bacterial growth (13, 14). In this study, we demonstrated that the action of ZnO nanoparticles on C. jejuni was bactericidal, not bacteriostatic, by showing no recovery of the treated cells on drug-free MH plates as well as by the rapid killing of 108 CFU/ml of freshly grown cells of three different C. jejuni strains. The effectiveness of ZnO nanoparticles in inactivating C. jejuni was also compared with their effectiveness against other major foodborne pathogens. For E. coli O157:H7 and Salmonella, 20- to 100-fold-higher concentrations of ZnO nanoparticles were needed to reduce 1 to 2 logs of viable cells (Fig. 1). Therefore, the bactericidal action of ZnO nanoparticles against C. jejuni was extremely effective.

Although the antibacterial mechanism of ZnO nanoparticles is still unknown, the possibilities of membrane damage caused by direct or electrostatic interaction between ZnO and cell surfaces, cellular internalization of ZnO nanoparticles, and the production of active oxygen species such as H2O2 in cells due to metal oxides have been proposed in earlier studies (6, 24). The generation of H2O2 in ZnO slurries was determined by oxygen electrode analysis and spectrophotofluorometry (23, 27). In examining cell morphology, membrane integrity, and gene expression in C. jejuni, we found that all of these aspects were affected by ZnO nanoparticles. A dramatic change in C. jejuni cell morphology was revealed by SEM by showing the dominance of coccoid forms in the treated cells while the untreated cells remained spiral. This considerable alteration in cell morphology was not only observed in C. jejuni cells treated with ZnO nanoparticles but has also been found in Campylobacter cells and in cells of the closely related genus Helicobacter when cells were exposed to different stresses (1, 5, 10). It might be specific to spiral bacteria, as no significant changes in cell shape were found in E. coli O157:H7 after exposure to ZnO, but the nanoparticles adhered to the cell surface (29). In addition to changing the structure of C. jejuni cells, ZnO nanoparticles resulted in the formation of irregular cell surfaces and membrane blebbing and an increase in membrane permeability. This induced membrane leakage was also consistently observed in E. coli O157:H7 by transmission electron microscopy and Raman spectroscopy when cells were treated with ZnO nanoparticles (14).

When extracellular environments change, bacteria adopt mechanisms that quickly regulate the synthesis of defensive proteins in response to stress. In Campylobacter, a number of genes/proteins that play critical roles in protecting cells from different stresses, especially oxidative stress, have been identified (26). Most importantly, to eliminate reactive oxygen species and to assist the organism in defense against oxidative stress, superoxide dismutase (SodB) breaks down O−2 to H2O2 and O2, catalase (KatA) inactivates H2O2 and interrupts the formation of toxic intermediates, and alkyl hydroperoxide reductase (AhpC) destroys toxic hydroperoxide intermediates and repairs damage to molecules caused by oxidation (3, 20). In addition to these oxidative stress response proteins, general stress response proteins (DnaK, DnaJ, GroES, and GroEL), which act as molecular chaperones and play a critical role in preventing protein aggregation and refolding, are also important for cell survival (2). Analysis of ZnO nanoparticle-modulated stress gene expression showed that the transcription levels of two oxidative stress genes (ahpC and katA) and one general stress response gene (dnaK) were significantly increased, up to 7- to 52-fold, while another 4 stress response genes (sodB, dps, groEL, and groES) were expressed at approximately 2- to 3-times-higher levels. Expression of all other stress response genes was either unchanged or downregulated. Because KatA is a single catalase enzyme whose expression level increases in C. jejuni upon exposure to H2O2 (7), the 52-fold induction of KatA expression suggests a high probability that more intercellular H2O2 is produced in response to the ZnO nanoparticles. From these experiments and the role of the oxidative stress regulatory system in Campylobacter, we can conclude that the antibacterial mechanism of ZnO nanoparticles is very likely through increased levels of oxidative stress in bacterial cells. Furthermore, the expression of a number of virulence factors related to cell motility, toxin production, and adhesion to host cells was also examined in response to ZnO nanoparticles. All of the analyzed virulence genes were found to be downregulated, suggesting decreased pathogenicity of the bacterium after treatment.

In summary, ZnO nanoparticles exhibited remarkable antibacterial activity and demonstrated a lethal effect against C. jejuni, even at low concentrations. ZnO nanoparticles induced significant morphological changes, measurable membrane leakage, and substantial increases (up to 52-fold) in oxidative stress gene expression in C. jejuni. Based on these phenomena and cell responses, a plausible mechanism of ZnO inactivation of bacteria involves the direct interaction between ZnO nanoparticles and cell surfaces, which affects the permeability of membranes where nanoparticles enter and induce oxidative stress in bacterial cells, subsequently resulting in the inhibition of cell growth and eventually in cell death.

Acknowledgments

This research was jointly supported by the Agriculture Research Service, U.S. Department of Agriculture, the Ministry of Science and Technology of China (2009BADB9B01 and 2009BAK43B31), and the Science and Technology Commission of Shanghai Municipality (09DZ0503300).

We thank Guoping Bao of the Microscopy Imaging Facility of the USDA, ARS, ERRC, for technical assistance in acquiring the SEM images and George Paoli of the Molecular Characterization of Food-Borne Pathogens Research Unit of the USDA, ARS, ERRC, for providing the C. jejuni ATCC strains.

Footnotes

▿

Published ahead of print on 4 February 2011.

REFERENCES

  • 1.Adams, B. L., T. C. Bates, and J. D. Oliver. 2003. Survival of Helicobacter pylori in a natural freshwater environment. Appl. Environ. Microbiol. 69:7462-7466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Arsène, F., T. Tomoyasu, and B. Bukau. 2000. The heat shock response of Escherichia coli. Int. J. Food Microbiol. 55:3-9. [DOI] [PubMed] [Google Scholar]
  • 3.Baillon, M. L., A. H. van Vliet, J. M. Ketley, C. Constantinidou, and C. W. Penn. 1999. An iron-regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J. Bacteriol. 181:4798-4804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brayner, R., et al. 2006. Toxicological impact studies based on Escherichia coli bacteria in ultrafine ZnO nanoparticles colloidal medium. Nano Lett. 6:866-870. [DOI] [PubMed] [Google Scholar]
  • 5.Catrenich, C. E., and K. M. Makin. 1991. Characterization of the morphologic conversion of Helicobacter pylori from bacillary to coccoid forms. Scand. J. Gastroenterol. Suppl. 181:58-64. [PubMed] [Google Scholar]
  • 6.Fu, G., P. S. Vary, and C. T. Lin. 2005. Anatase TiO2 nanocomposites for antimicrobial coatings. J. Phys. Chem. B 109:8889-8898. [DOI] [PubMed] [Google Scholar]
  • 7.Grant, K., and S. Park. 1995. Molecular characterization of katA from Campylobacter jejuni and generation of a catalase-deficient mutant of Campylobacter coli by interspecific allelic exchange. Microbiology 141:1369-1376. [DOI] [PubMed] [Google Scholar]
  • 8.He, Y., J. G. Frye, T. P. Strobaugh, and C. Y. Chen. 2008. Analysis of AI-2/LuxS-dependent transcription in Campylobacter jejuni strain 81-176. Foodborne Pathog. Dis. 5:399-415. [DOI] [PubMed] [Google Scholar]
  • 9.He, Y., et al. 2010. Simultaneous detection and differentiation of Campylobacter jejuni, C. coli, and C. lari in chickens using a multiplex real-time PCR assay. Food Anal. Methods 137:168-174. [Google Scholar]
  • 10.He, Y. P., and C. Y. Chen. 2010. Quantitative analysis of viable, stressed and dead cells of Campylobacter jejuni strain 81-176. Food Microbiol. 27:439-446. [DOI] [PubMed] [Google Scholar]
  • 11.Jacobs-Reitsma, W. F., U. Lyhs, and J. Wagenaar. 2008. Campylobacter in the food supply, p. 627-644. In I. Nachamkin, C. M. Szymanski, and M. J. Blaser (ed.), Campylobacter, 3rd ed. ASM Press, Washington, DC.
  • 12.Jin, T., D. Sun, J. Y. Su, H. Zhang, and H. J. Sue. 2009. Antimicrobial efficacy of zinc oxide quantum dots against Listeria monocytogenes, Salmonella Enteritidis, and Escherichia coli O157:H7. J. Food Sci. 74:M46-M52. [DOI] [PubMed] [Google Scholar]
  • 13.Jones, N., B. Ray, K. T. Ranjit, and A. C. Manna. 2008. Antibacterial activity of ZnO nanoparticle suspensions on a broad spectrum of microorganisms. FEMS Microbiol. Lett. 279:71-76. [DOI] [PubMed] [Google Scholar]
  • 14.Liu, Y., et al. 2009. Antibacterial activities of zinc oxide nanoparticles against Escherichia coli O157:H7. J. Appl. Microbiol. 107:1193-1201. [DOI] [PubMed] [Google Scholar]
  • 15.Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402-408. [DOI] [PubMed] [Google Scholar]
  • 16.Nair, S., et al. 2009. Role of size scale of ZnO nanoparticles and microparticles on toxicity toward bacteria and osteoblast cancer cells. J. Mater. Sci. Mater. Med. 20(Suppl. 1):S235-S241. [DOI] [PubMed] [Google Scholar]
  • 17.Nogva, H. K., S. M. Dromtorp, H. Nissen, and K. Rudi. 2003. Ethidium monoazide for DNA-based differentiation of viable and dead bacteria by 5′-nuclease PCR. Biotechniques 34:804-813. [DOI] [PubMed] [Google Scholar]
  • 18.Padmavathy, N., and R. Vijayaraghavan. 2008. Enhanced bioactivity of ZnO nanoparticles—an antimicrobial study. Sci. Technol. Adv. Mater. 9:1-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Petersdorf, R. G., and J. C. Sherris. 1965. Methods and significance of in vitro testing of bacterial sensitivity to drugs. Am. J. Med. 39:766-779. [DOI] [PubMed] [Google Scholar]
  • 20.Purdy, D., S. Cawthraw, J. H. Dickinson, D. G. Newell, and S. F. Park. 1999. Generation of a superoxide dismutase (SOD)-deficient mutant of Campylobacter coli: evidence for the significance of SOD in Campylobacter survival and colonization. Appl. Environ. Microbiol. 65:2540-2546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Reddy, K. M., et al. 2007. Selective toxicity of zinc oxide nanoparticles to prokaryotic and eukaryotic systems. Appl. Phys. Lett. 90:2139021-2139023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sawai, J. 2003. Quantitative evaluation of antibacterial activities of metallic oxide powders (ZnO, MgO and CaO) by conductimetric assay. J. Microbiol. Methods 54:177-182. [DOI] [PubMed] [Google Scholar]
  • 23.Sawai, J., et al. 1996. Detection of active oxygen generated from ceramic powders having antibacterial activity. J. Chem. Eng. Jpn. 29:627-633. [Google Scholar]
  • 24.Stoimenov, P. K., R. L. Klinger, G. L. Marchin, and K. J. Klabunde. 2002. Metal oxide nanoparticles as bactericidal agents. Langmuir 18:6679-6686. [Google Scholar]
  • 25.Tangwatcharin, P., S. Chanthachum, P. Khopaibool, and M. W. Griffiths. 2006. Morphological and physiological responses of Campylobacter jejuni to stress. J. Food. Prot. 69:2747-2753. [DOI] [PubMed] [Google Scholar]
  • 26.van Vliet, A. H., J. M. Ketley, S. F. Park, and C. W. Penn. 2002. The role of iron in Campylobacter gene regulation, metabolism and oxidative stress defense. FEMS Microbiol. Rev. 26:173-186. [DOI] [PubMed] [Google Scholar]
  • 27.Yamamoto, O., M. Komatsu, J. Sawai, and Z. E. Nakagawa. 2004. Effect of lattice constant of zinc oxide on antibacterial characteristics. J. Mater Sci. Mater. Med. 15:847-851. [DOI] [PubMed] [Google Scholar]
  • 28.Yuki, N., and M. Koga. 2006. Bacterial infections in Guillain-Barré and Fisher syndromes. Curr. Opin. Neurol. 19:451-457. [DOI] [PubMed] [Google Scholar]
  • 29.Zhang, L. L., Y. H. Jiang, Y. L. Ding, M. Povey, and D. York. 2007. Investigation into the antibacterial behavior of suspensions of ZnO nanoparticles (ZnO nanofluids). J. Nanopart. Res. 9:479-489. [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES