Skip to main content
NCBI home page
Infection and Immunity logoLink to Infection and Immunity
. 2011 Jan 31;79(4):1451–1457. doi: 10.1128/IAI.01274-10

The OspE-Related Proteins Inhibit Complement Deposition and Enhance Serum Resistance of Borrelia burgdorferi, the Lyme Disease Spirochete ▿

Melisha R Kenedy 1, Darrin R Akins 1,*
PMCID: PMC3067540  PMID: 21282413

Abstract

Borrelia burgdorferi, the Lyme disease spirochete, binds the host complement inhibitors factor H (FH) and FH-like protein 1 (FHL-1). Binding of FH/FHL-1 by the B. burgdorferi proteins CspA and the OspE-related proteins is thought to enhance resistance to serum-mediated killing. While previous reports have shown that CspA confers serum resistance in B. burgdorferi, it is unclear whether the OspE-related proteins are relevant in B. burgdorferi serum resistance when OspE is expressed on the borrelial surface. To assess the role of the OspE-related proteins, we overexpressed them in a serum-sensitive CspA mutant strain. OspE overexpression enhanced serum resistance of the CspA-deficient organisms. Furthermore, FH was more efficiently bound to the B. burgdorferi surface when OspE was overexpressed. Deposition of complement components C3 and C5b-9 (the membrane attack complex), however, was reduced on the surface of the OspE-overexpressing strain compared to that on the CspA mutant strain. These data demonstrate that OspE proteins expressed on the surface of B. burgdorferi bind FH and protect the organism from complement deposition and subsequent serum-mediated destruction.

The pathogenic spirochete Borrelia burgdorferi is the causative agent of Lyme disease, which is the most common arthropod-borne illness in the United States (37). B. burgdorferi is maintained in nature through a complex enzootic cycle in which spirochetes are transmitted horizontally between infected Ixodes tick vectors and mammalian hosts (36). When humans become infected with B. burgdorferi, a rash, termed erythema migrans, may develop locally, followed by chronic symptoms of the heart, nervous system, and joints (35).

Despite a vigorous antibody response during mammalian infection, B. burgdorferi survives within the host, suggesting that the spirochete can evade the host immune response. Interestingly, several B. burgdorferi surface lipoproteins have been implicated in immune evasion (17, 21, 26, 44, 47). In fact, B. burgdorferi lipoproteins can bind the host complement proteins factor H (FH) and FH-like protein 1 (FHL-1), which are negative regulators of the alternative pathway of complement (17, 21, 26). By binding soluble FH/FHL-1 from serum, it is thought that B. burgdorferi inhibits the activation of complement on the surface of the bacterial cell and promotes serum resistance of B. burgdorferi. Accordingly, B. burgdorferi sensu stricto organisms are resistant to the killing activity of human serum (3, 5). The FH/FHL-1 binding lipoproteins of B. burgdorferi include CspA, CspZ, and the OspE-related proteins (17, 21, 26). CspA inhibits complement deposition and enhances serum resistance of B. burgdorferi in vitro (8, 24). Conversely, CspZ is not surface exposed and is not required for serum resistance or experimental murine infection (12). While Hellwage et al. previously reported that a recombinant form of OspE from B. burgdorferi strain N40 can bind FH, the importance of OspE expression on the surface of the organism in relation to serum resistance has yet to be defined (21). In the B. burgdorferi type strain B31, there are three OspE-related proteins encoded by open reading frames bbl39, bbn38, and bbp38 (10). bbl39 and bbp38 are 100% identical in nucleotide sequence, and bbn38 is ∼80% identical to bbl39 and bbp38 (10). Interestingly, the OspE-related proteins and CspA are differentially regulated surface lipoproteins. During in vitro cultivation of B. burgdorferi, CspA is readily expressed and is downregulated when spirochetes are cultivated in dialysis membrane chambers (DMC) and in the presence of human blood (7, 8, 24, 45). Correspondingly, CspA is abundantly expressed in the tick and then downregulated and not expressed during mammalian infection (7, 9, 28, 30, 45). The OspE proteins, however, are upregulated by elevated temperature in vitro and are upregulated during tick feeding and expressed throughout mammalian infection (18-20, 33, 38, 41).

Previously, we inactivated CspA in a serum-resistant, avirulent strain of B. burgdorferi and demonstrated that the CspA mutant was sensitive to serum-mediated destruction (8). Furthermore, we have shown that CspA binds FH from serum to the borrelial surface and is required for protecting B. burgdorferi from deposition of the complement components C3, C6, and C5b-9 (24). To further these prior studies, we assessed the role of the OspE-related proteins in serum resistance and complement deposition. Because CspA is expressed during in vitro cultivation and OspE is not reproducibly expressed by all B. burgdorferi organisms in vitro, we utilized a unique approach in examining the importance of OspE in protecting B. burgdorferi from serum-mediated destruction. To characterize the role of the B. burgdorferi B31 OspE paralogs in serum resistance, we overexpressed the OspE-related proteins in a CspA mutant strain (8). Overexpression of the OspE-related proteins enhanced serum resistance and FH binding in CspA-deficient spirochetes. Additionally, OspE was required for evading complement deposition on the B. burgdorferi surface. Taken together, these data indicate that OspE binds FH from serum to the borrelial surface and protects B. burgdorferi from serum-mediated destruction and deposition of complement components.

MATERIALS AND METHODS

Bacterial strains and human sera.

B. burgdorferi organisms were cultivated at 34°C in BSK-II medium containing 6% heat-inactivated rabbit serum (BSK-II complete) (4). The avirulent B. burgdorferi B31 clone f (cf) strain was provided by Justin D. Radolf (15). The CspA mutant strain was previously generated in our laboratory (8). Normal human serum (NHS) was purchased from PAA Laboratories (New Bedford, MA).

Overexpression of OspE in the B. burgdorferi CspA mutant strain.

Our laboratory previously inactivated cspA in the B. burgdorferi strain cf (8). To overexpress OspE in the CspA mutant strain, the B. burgdorferi B31 OspE paralogs bbl39 and bbn38 were inserted into the borrelial shuttle vector pBSVE (29) and constitutively expressed from the borrelial flgB promoter. The flgB promoter was amplified from the borrelial shuttle vector pBSV2 (43) with primers FlgB 5′ (5′ GCGGGATCCTACCCGAGCTTCAAGGAAGAT 3′) and FlgB 3′ (5′ GCGTCTAGAATGGAAACCTCCCTCATTTAAA 3′). The flgB amplicon and pBSVE were digested with the restriction enzymes BamHI and XbaI, and the amplicon was subsequently inserted into pBSVE. bbl39 was then amplified from B. burgdorferi B31 genomic DNA using specific primers L39 5′ (5′ GCGTCTAGAATGAATAAGAAAATGAAAATGTTTATT 3′) and L39 3′ (5′ GCGCTGCAGCTATTTTAAATTTCTTTTAAGCTCTTCTAGTGA 3′) and cloned into the XbaI and PstI sites of the vector. bbn38 was also amplified from genomic DNA using primers N38 5′ (5′ GCGCTGCAGAGGACTTATGGAGAAATTTATGAA 3′) and N38 3′ (5′ GCGAAGCTTCTATTTTAAATTTTTTTTAAGCACTT 3′), and the amplicon was inserted into the PstI and HindIII restriction sites. For all primer sequences, the restriction sites used for cloning are indicated in bold. The final vector was designated flgB-ospE-pBSVE. Subsequently, bbl39 and bbn38 were subjected to nucleotide sequence analysis to confirm that no mutations were incorporated during cloning assays. To transform B. burgdorferi, flgB-ospE-pBSVE was electroporated into competent CspA mutant cells using methods described previously (34, 46), and clones were selected with kanamycin (200 μg/ml) and erythromycin (80 ng/ml). A single clone was selected, and PCR amplification was performed using primers FlgB 5′ and L39 3′ to confirm that the clone contained the flgB-ospE-pBSVE vector.

Immunoblotting and antibodies.

SDS-PAGE and immunoblotting assays were performed as indicated elsewhere (24). Primary antibodies were used at dilutions of 1:5,000. Rat anti-CspA, rat anti-OspA, rabbit anti-FlaB, rat anti-BBL39, and rat anti-BBN38 antibodies were all previously described (2, 8).

PK surface accessibility assays.

B. burgdorferi cells (2 × 108) were washed three times in 1 ml of phosphate-buffered saline (PBS) (pH 7.4) and pelleted at 4,000 × g for 4 min. Cells were then resuspended in 1 ml of PBS. One 500-μl aliquot was incubated for 1 h with 200 μg of proteinase K (PK; Sigma, St. Louis, MO), while a second 500-μl aliquot was incubated for 1 h in PBS without PK. The PK reaction was stopped with 0.4 mM phenylmethylsulfonyl fluoride (Sigma). Spirochete suspensions were subsequently pelleted by centrifugation at 10,000 × g for 10 min. The final pellets were resuspended in final sample buffer for immunoblot analysis using a pool of rat anti-BBL39 and rat anti-BBN38 antibodies. Membranes were also subjected to immunoblotting with rat anti-OspA and rabbit anti-FlaB antibodies.

ALBI.

FH affinity ligand blot immunoassay (ALBI) was performed for detection of FH binding proteins as described previously (8, 31). Briefly, membranes were incubated for 1 h with 10 μg of human FH (Calbiochem, Gibbstown, NJ). As a control, an equivalent membrane was incubated in buffer without human FH. The membranes were washed three times and then incubated for 1 h with a 1:5,000 dilution of monoclonal anti-human FH antibodies (Quidel, San Diego, CA). After the membranes were washed three times, they were incubated for 45 min in a 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated goat anti-mouse antibodies and washed three more times before being developed using enhanced chemiluminescence (ECL; G-Biosciences, Maryland Heights, MO). To ensure equivalent loading of whole-cell lysates, the membrane was subsequently subjected to immunoblot analysis for the constitutively expressed FlaB protein using rabbit anti-FlaB antibodies. Scanning densitometric analysis of ECL immunoblots was performed using AlphaView software (Alpha Innotech Corporation, San Leandro, CA).

Serum sensitivity assays.

B. burgdorferi cells were grown to mid-exponential phase (∼5 × 107 per ml) and harvested at 4,000 × g for 5 min. Cells were then gently washed three times in BSK-II medium. In triplicate, spirochetes (5 × 106 cells per ml) were incubated at 34°C with either 20% normal human serum (NHS) or 20% heat-inactivated NHS (HI-NHS). The number of motile spirochetes in each sample was enumerated by dark-field microscopy after 2, 4, or 6 h of incubation. Significant differences between samples incubated with NHS and those incubated with HI-NHS were determined using an unpaired, two-tailed Student t test (14).

Serum adsorption assays.

Spirochetes were harvested at 5,000 × g for 20 min and washed three times in PBS. Cells were then enumerated, and 2 × 109 organisms were pelleted by centrifugation at 5,000 × g. The subsequent pellet was resuspended in 850 μl NHS containing 34 mM EDTA. Samples were then incubated at room temperature for 1 h. Cells were subjected to centrifugation before being washed three times in PBS containing 0.02% sodium azide and 0.05% Tween 20. After washing, the final pellet was incubated in 0.1 M glycine-HCl (pH 2.0) for 15 min. The cells were then sedimented at 15,000 × g for 10 min. The supernatant was removed, and supernatant proteins were precipitated using ethanol. Samples were analyzed by SDS-PAGE and subsequent immunoblot analysis with monoclonal anti-human FH antibodies (dilution of 1:5,000 for 1 h) followed by HRP-conjugated goat anti-mouse antibodies (dilution of 1:10,000 for 45 min). The same membrane was also immunoblotted with rabbit anti-FlaB antibodies to ensure equal loading between all samples.

Complement deposition assays.

Spirochetes were grown to mid-exponential phase before cells were harvested at 5,000 × g. Cells were then washed three times in PBS. After washing, the final pellet was resuspended in PBS. Spirochetes (6 × 106) were incubated in PBS containing 25% NHS for 30 min at 37°C. Following the incubation, the cells were washed three times with PBS containing 1% bovine serum albumin (BSA). The pellet was resuspended in 100 μl of the same buffer, and 10 μl of the sample was spotted on microscope slides. Slides were dried overnight, fixed for 10 min with methanol, and blocked for 30 min in PBS containing 1% BSA. Samples were then incubated for 1 h with a 1:400 dilution of polyclonal goat anti-human C3 antibodies (Calbiochem) or polyclonal goat anti-human C5b-9 antibodies (Quidel). After three washes with PBS, the slides were incubated for 45 min with a 1:250 dilution of Alexa Fluor 488-conjugated rabbit anti-goat antibodies (Invitrogen, Carlsbad, CA) before being washed three more time with PBS. Samples were then mounted in buffered glycerol containing DAPI (4′,6-diamidino-2-phenylindole) (Vector Laboratories, Burlingame, CA) and sealed with a coverslip, and images were visualized and captured with an Olympus BX-60 fluorescence microscope (Olympus America Inc., Center Valley, PA).

RESULTS

Overexpression of OspE in the B. burgdorferi CspA mutant strain.

In vitro studies have shown that CspA protein expressed on the surface of B. burgdorferi is required for resisting the bactericidal activity of human serum (8, 24). CspA is highly expressed during in vitro cultivation of B. burgdorferi and is thus easily examined using in vitro analyses (7, 8, 24, 26, 30). OspE, however, is not reproducibly expressed by all B. burgdorferi organisms during in vitro cultivation (18-20, 38, 41), which has hampered efforts to define the role of the OspE-related proteins in relation to binding of FH and enhancing serum resistance when OspE is expressed on the surface of B. burgdorferi (19, 20, 41). Therefore, we undertook a unique strategy to overcome this obstacle and examine the specific role of the OspE paralogs expressed on the surface of B. burgdorferi strain B31 in resisting serum-mediated killing. Specifically, we overexpressed the two unique B. burgdorferi B31 OspE-related proteins, BBL39 and BBN38, in a CspA mutant strain (8). This was done by cloning both bbl39 and bbn38 into the borrelial shuttle vector pBSVE and constitutively expressing them from the B. burgdorferi flgB promoter (Fig. 1 A). It should be noted that bbp38 was not included in the overexpression construct because it is 100% identical to bbl39 (10). The OspE overexpression construct was electroporated into the CspA mutant, and erythromycin-resistant clones were selected. To confirm that the OspE overexpression construct flgB-ospE-pBSVE was maintained in the CspA mutant, PCR analysis was performed to amplify an ∼1-kb fragment from the construct using primers FlgB 5′ and L39 3′. As shown in Fig. 1B, the OspE overexpression construct in the CspA mutant background produced an amplicon of approximately 1 kb, while the wild-type B. burgdorferi and CspA mutant did not yield a PCR product (Fig. 1B).

FIG. 1.

FIG. 1.

Open in a new tab

Overexpression of bbl39 and bbn38 in a B. burgdorferi CspA mutant. (A) bbl39 and bbn38 were expressed from the constitutive B. burgdorferi promoter flgB on the borrelial shuttle vector pBSVE. flgB was inserted into the BamHI (B) and XbaI (X) sites of pBSVE. Subsequently, bbl39 (nucleotides 26382 to 26903 of cp32-8) was amplified and cloned into the XbaI (X) and PstI (P) sites of pBSVE, and bbn38 (nucleotides 26190 to 26770 of cp32-9) was inserted into the restriction sites PstI (P) and HindIII (H). The resulting vector, flgB-ospE-pBSVE, was electroporated into the CspA mutant strain. MCS, multiple-cloning site. (B) To verify that flgB-ospE-pBSVE was electroporated into the CspA mutant strain, PCR amplification was performed using primers FlgB 5′ and L39 3′. The presence of the construct was confirmed by a 1-kb amplicon in the OspE-overexpressing strain (lane 4). As expected, no product was amplified from the wild-type strain (lane 2) or the CspA mutant strain (lane 3). As a negative control, a PCR mixture lacking DNA template was included (lane 1). Molecular size standards, in kb, are indicated at left. (C) Whole-cell lysates (2 × 107) from wild-type, CspA mutant, and OspE-overexpressing strains were immunoblotted with rat anti-BBL39 and rat anti-BBN38 antibodies. Both BBL39 (∼18 kDa) and BBN38 (∼20 kDa) were overexpressed by the OspE-overexpressing strain compared to the wild-type and the CspA mutant strains. The same membrane was also immunoblotted with rabbit anti-FlaB antibodies to verify the equivalent loading of lysates. Equivalent whole-cell lysates were immunoblotted with rat anti-CspA antibodies to confirm the inactivation of cspA in the CspA mutant and the OspE-overexpressing strains.

To confirm that OspE was overexpressed in the CspA mutant strain, immunoblot analysis was performed using a pool of rat anti-BBL39 and rat anti-BBN38 antibodies. As expected, the OspE-overexpressing CspA mutant strain expressed abundant OspE compared to the wild-type and the CspA mutant strains (Fig. 1C, top panel). In fact, both BBL39 (∼18 kDa) and BBN38 (∼20 kDa) were overexpressed. Additionally, only the wild-type strain expressed CspA, confirming that cspA was inactivated in the mutant and OspE-overexpressing strains (Fig. 1C, middle panel). Equivalent loading of whole-cell lysates was confirmed by immunoblotting the same membrane with antibodies against the constitutively expressed flagellin (FlaB) protein (Fig. 1C, bottom panel).

Overexpressed OspE is surface exposed.

The surface localization of OspE has been well documented (16, 19, 27). We next assessed the surface localization of OspE in the OspE-overexpressing strain to confirm that overexpressing OspE resulted in increased protein on the B. burgdorferi surface. To examine OspE surface exposure, we performed proteinase K (PK) surface accessibility assays. The wild-type, CspA mutant, and OspE-overexpressing strains were incubated with PK to digest all surface-localized proteins. The final lysates were analyzed by immunoblotting with rat anti-BBL39 and rat anti-BBN38 antibodies. OspE was degraded from the surface of wild-type and CspA mutant strains when incubated with PK but not when incubated in PBS alone (Fig. 2). OspE from the OspE-overexpressing strain was also degraded, verifying surface localization of the abundantly expressed OspE in this strain (Fig. 2). As expected, the surface lipoprotein OspA was also degraded when incubated with PK and served as a control for PK activity (Fig. 2). To verify that the fragile B. burgdorferi outer membranes remained intact during PK assays, equivalent lysates were also immunoblotted with antibodies directed against the periplasmic FlaB protein. FlaB was not degraded when cells were incubated with PK, confirming that the B. burgdorferi outer membranes were intact throughout the assay (Fig. 2).

FIG. 2.

FIG. 2.

Open in a new tab

OspE is surface localized when overexpressed in the B. burgdorferi CspA mutant. Whole-cell lysates (2 × 108 cells) of wild-type, CspA mutant, and OspE-overexpressing strains were incubated with (+) or without (−) proteinase K to digest borrelial surface proteins. Lysates were analyzed by immunoblotting using rat anti-BBL39 and rat anti-BBN38 antibodies. To ensure equivalent loading and to ensure that outer membranes remained intact, the same membrane was immunoblotted with rabbit anti-FlaB antibodies. As a control, equivalent lysates were also immunoblotted with antibodies for the surface-exposed OspA protein.

FH ALBI.

FH binding of the B. burgdorferi wild-type, CspA mutant, and OspE-overexpressing strains was assessed by FH ALBI analysis as previously described (31). B. burgdorferi FH binding proteins were detected with monoclonal FH antibodies. The wild-type strain expressed an FH binding protein of 27 kDa corresponding to CspA (Fig. 3). The 27-kDa protein was not detected in the CspA mutant or the OspE-overexpressing organisms, consistent with the inactivation of CspA in these strains (Fig. 3). FH binding proteins of approximately 18 kDa and 20 kDa corresponding to BBL39 and BBN38, respectively, were detected only in the OspE-overexpressing strain (Fig. 3). The wild-type and CspA mutant strains also express OspE, but expression was below the level of detection of the FH ALBI. Scanning densitometric analysis confirmed that the wild-type and the OspE-overexpressing strain expressed similar levels of FH binding protein (only ∼11% difference), suggesting that overexpressing OspE restored FH binding to the CspA-deficient organisms. As a control, ALBIs were performed in which equivalent whole-cell lysates were incubated without recombinant FH. No FH binding proteins were detected, verifying the specificity of the monoclonal FH antibodies (data not shown). Equal loading of whole-cell lysates was verified by immunoblot analysis of the same membrane with rabbit anti-FlaB antibodies (Fig. 3).

FIG. 3.

FIG. 3.

Open in a new tab

Factor H affinity ligand blot immunoassay (FH ALBI). Spirochetes (3 × 107) from wild-type, CspA mutant, and OspE-overexpressing strains were subjected to FH ALBI. To detect FH binding proteins, lysates were separated by SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was then incubated with recombinant human FH and probed with monoclonal anti-human FH antibodies. The OspE-overexpressing strain displayed FH binding proteins of approximately 18 kDa and 20 kDa, which are consistent with the sizes of the OspE-related proteins BBL39 and BBN38. Only the wild-type strain expressed the FH binding protein CspA. The membrane was also immunoblotted with rabbit anti-FlaB antibodies to ensure equal loading of whole-cell lysates.

OspE enhances serum resistance in B. burgdorferi.

We have previously shown that the CspA mutant strain is sensitive to the bactericidal activity of human serum in vitro (8, 24). We next assessed whether overexpression of OspE could enhance serum resistance in the CspA mutant strain using serum sensitivity assays. Wild-type, CspA mutant, and OspE-overexpressing strains were incubated in triplicate in medium supplemented with 20% normal human serum (NHS) or 20% heat-inactivated NHS (HI-NHS). Aliquots were removed from each sample after 2, 4, and 6 h, and viable spirochetes that were able to survive when incubated in serum were enumerated by dark-field microscopy. Consistent with prior observations by our laboratory, the wild-type strain was resistant to the bactericidal activity of NHS, while the CspA mutant was killed by NHS (Fig. 4). In fact, all CspA mutant spirochetes were destroyed within 6 h of incubation. Interestingly, the OspE-overexpressing strain survived when incubated in NHS, similarly to the wild-type strain (Fig. 4). Thus, OspE restored serum resistance to the CspA-deficient spirochetes, suggesting that OspE can provide serum resistance in vitro in the absence of CspA.

FIG. 4.

FIG. 4.

Open in a new tab

OspE enhances serum resistance to human serum. Wild-type, CspA mutant, and OspE-overexpressing strains were subjected to serum sensitivity assays to assess serum resistance. Spirochetes (5 × 106 cells/ml) were incubated in triplicate with either 20% normal human serum (NHS) or 20% heat-inactivated NHS (HI-NHS). Aliquots were removed after 2, 4, and 6 h, and viable B. burgdorferi cells were enumerated by dark-field microscopy. Asterisks denote significant differences (P ≤ 0.05) in viability between similar samples incubated with NHS or HI-NHS.

OspE binds factor H to the B. burgdorferi surface.

We next examined whether OspE could enhance FH binding on the B. burgdorferi surface. The ability of OspE to bind FH from NHS to the borrelial surface was assessed by serum adsorption assays. Intact cells were incubated in NHS containing EDTA, and surface-bound serum proteins were eluted from the cell surface. Samples were then analyzed by immunoblotting with monoclonal FH antibodies. Both the wild-type and the OspE-overexpressing strains bound abundant amounts of FH from serum to their surface (Fig. 5, top panel). The CspA mutant strain, however, was much less efficient at accumulating FH on the surface of the cell (Fig. 5, top panel). To confirm that equivalent amounts of samples were analyzed in the serum adsorption experiments, samples were also subjected to immunoblotting with anti-FlaB antibodies (Fig. 5, bottom panel). These data indicate that OspE enhances adsorption of FH from human serum to the B. burgdorferi surface.

FIG. 5.

FIG. 5.

Open in a new tab

OspE enhances FH binding on the borrelial surface. FH bound to the surface of wild-type, CspA mutant, and OspE-overexpressing organisms was detected by immunoblot assay. Spirochetes were washed three times with PBS and pelleted by centrifugation. Cells (2 × 109) were resuspended in NHS containing EDTA before FH was eluted from the borrelial surface. The final supernatant was subjected to SDS-PAGE and, subsequently, immunoblot analysis with monoclonal anti-human FH antibodies. Lysates were also immunoblotted with anti-FlaB antibodies to verify that equivalent amounts of protein were loaded in each lane.

OspE inhibits complement deposition on the surface of B. burgdorferi.

We next assessed the deposition of complement proteins C3 and C5b-9 (i.e., the membrane attack complex) on the borrelial surface. Wild-type, CspA mutant, and OspE-overexpressing strains were incubated in NHS, and C3 or the C5b-9 complex was detected on the B. burgdorferi surface by indirect immunofluorescence assays. Wild-type cells were weakly stained, indicating poor deposition of complement on the borrelial surface (Fig. 6 A and B). In contrast, abundant levels of C3 and C5b-9 could be detected on the surface of the CspA mutant strain (Fig. 6A and B). When OspE was overexpressed in CspA-deficient spirochetes, complement deposition was restored to wild-type levels (Fig. 6A and B). These data indicate that OspE inhibits complement deposition on the surface of B. burgdorferi.

FIG. 6.

FIG. 6.

Open in a new tab

OspE protects B. burgdorferi from complement deposition. Deposition of complement components on the surface of wild-type, CspA mutant, and OspE-overexpressing spirochetes was detected by indirect immunofluorescence. Cells were incubated in 25% NHS, and the complement components C3 (A) and C5b-9 (B) were visualized with specific antibodies. To visualize all spirochetes within a microscopic field, cells were counterstained with DAPI. Merged images are displayed in the bottom panels. Spirochetes were visualized by fluorescence microscopy at a magnification of ×1,000.

DISCUSSION

B. burgdorferi expresses multiple proteins that can bind the complement inhibitors factor H (FH) and FH-like protein 1 (FHL-1). The FH/FHL-1 binding proteins include the OspE-related proteins, CspA, and CspZ (17, 21, 25). It is now clear that CspZ is not required for serum resistance in vitro or for the experimental infection of mice with B. burgdorferi (12). Conversely, our laboratory has previously shown that CspA confers serum resistance and is required for evasion of complement deposition when spirochetes are incubated in human serum (8, 24). While other laboratories have reported that recombinant forms of OspE can bind FH in solution, the relevance of this interaction with regard to FH binding and serum resistance when the OspE-related proteins are actually expressed on the surface of B. burgdorferi has not been addressed (2, 21, 32).

Given that there are multiple OspE-related proteins expressed in all infectious isolates of B. burgdorferi (1, 10, 11, 20, 23, 40, 42), examining the role of the OspE-related proteins in vivo presents significant challenges. Specifically, generation of an OspE mutant in an infectious B. burgdorferi strain is complicated by the multiple OspE genes that must be inactivated. Additionally, a major obstacle in assessing the importance of the OspE-related proteins in B. burgdorferi serum resistance is the fact that CspA is highly expressed during in vitro cultivation, while the OspE-related proteins are poorly expressed or not reproducibly expressed by some B. burgdorferi organisms in vitro (7, 8, 19, 20, 24, 26, 30, 31, 41). Therefore, characterizing the role of the OspE-related proteins in serum resistance and complement deposition has remained elusive. However, by using a CspA-deficient strain, we were able to specifically examine the role of the OspE-related proteins without interference from CspA. Additionally, by constitutively expressing the OspE-related proteins from the B. burgdorferi flgB promoter in CspA-deficient spirochetes, we were able to overcome the poor expression of OspE in the CspA mutant strain. To analyze the role of the OspE-related proteins in serum resistance and complement deposition in vitro, we utilized the CspA mutant strain previously generated in our laboratory (8). The CspA mutant strain used in these studies was generated in the high-passage B. burgdorferi clone f (cf) strain (15), which has lost numerous B. burgdorferi plasmids, including cp32-9, which encodes one of the OspE-related proteins. As described previously, inactivation of CspA in B. burgdorferi strain cf increases the organisms' susceptibility to the bactericidal effects of human serum (8). Interestingly, when OspE was overexpressed in CspA-deficient spirochetes, the OspE-related proteins restored serum resistance to the serum-sensitive CspA mutant strain. The OspE-related proteins also bound FH from serum and inhibited deposition of complement components C3 and C5b-9 (the membrane attack complex) on the B. burgdorferi cell surface.

A recent report also suggests that OspE binds host plasminogen in vitro (6). Plasmin is a host serine protease which may facilitate the degradation of fibrin and the extracellular matrix when bound to the surface of B. burgdorferi (13, 22). Whether OspE binds plasminogen during murine infection has not yet been demonstrated. Intriguingly, the OspE-related proteins may serve multiple purposes in vivo. In fact, OspE can bind plasminogen and FH concurrently at different binding sites (6). The fact that infectious B. burgdorferi strains maintain multiple OspE-related proteins suggests that there is a selective advantage for expressing these proteins, and it is possible that expressing multiple OspE proteins is necessary for fulfilling multiple functions during mammalian infection.

Collectively, we have now demonstrated that OspE binds FH to the B. burgdorferi surface, enhances serum resistance in vitro, and inhibits complement deposition on the borrelial surface. This is consistent with our hypothesis that OspE inhibits serum-mediated destruction during infection. CspA is expressed abundantly in the tick, but it is downregulated soon after tick feeding (7, 9, 28, 30). As CspA is downregulated, the OspE-related proteins are upregulated and are expressed as the spirochete is transmitted to the mammalian host (18-20, 39, 41). Thus, it is likely that upregulation of the OspE-related proteins during mammalian infection is required for adequate FH binding, which would elicit protection from serum-mediated destruction during infection. The role of the OspE-related proteins in serum resistance is consistent with our model that CspA prevents serum-mediated destruction during the tick blood meal, while the OspE-related proteins protect B. burgdorferi from serum killing in the mammalian host.

Acknowledgments

This work was supported in part by grant HR09-002 from The Oklahoma Center for the Advancement of Science and Technology and by grants AI059373 and AI085310 from NIH/NIAID to D.R.A.

Editor: J. B. Bliska

Footnotes

▿

Published ahead of print on 31 January 2011.

REFERENCES

  • 1.Akins, D. R., et al. 1999. Molecular and evolutionary analysis of Borrelia burgdorferi 297 circular plasmid-encoded lipoproteins with OspE- and OspF-like leader peptides. Infect. Immun. 67:1526-1532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alitalo, A., et al. 2002. Complement inhibitor factor H binding to Lyme disease spirochetes is mediated by inducible expression of multiple plasmid-encoded outer surface protein E paralogs. J. Immunol. 169:3847-3853. [DOI] [PubMed] [Google Scholar]
  • 3.Alitalo, A., et al. 2001. Complement evasion by Borrelia burgdorferi: serum-resistant strains promote C3b inactivation. Infect. Immun. 69:3685-3691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Barbour, A. G. 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57:521-525. [PMC free article] [PubMed] [Google Scholar]
  • 5.Breitner-Ruddock, S., R. Wurzner, J. Schulze, and V. Brade. 1997. Heterogeneity in the complement-dependent bacteriolysis within the species of Borrelia burgdorferi. Med. Microbiol. Immunol. 185:253-260. [DOI] [PubMed] [Google Scholar]
  • 6.Brissette, C. A., et al. 2009. Borrelia burgdorferi infection-associated surface proteins ErpP, ErpA, and ErpC bind human plasminogen. Infect. Immun. 77:300-306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Brooks, C. S., P. S. Hefty, S. E. Jolliff, and D. R. Akins. 2003. Global analysis of Borrelia burgdorferi genes regulated by mammalian host-specific signals. Infect. Immun. 71:3371-3383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Brooks, C. S., et al. 2005. Complement regulator-acquiring surface protein 1 imparts resistance to human serum in Borrelia burgdorferi. J. Immunol. 175:3299-3308. [DOI] [PubMed] [Google Scholar]
  • 9.Bykowski, T., et al. 2007. Coordinated expression of Borrelia burgdorferi complement regulator-acquiring surface proteins during the Lyme disease spirochete's mammal-tick infection cycle. Infect. Immun. 75:4227-4236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Casjens, S., et al. 2000. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490-516. [DOI] [PubMed] [Google Scholar]
  • 11.Casjens, S., R. van Vugt, K. Tilly, P. A. Rosa, and B. Stevenson. 1997. Homology throughout the multiple 32-kilobase circular plasmids present in Lyme disease spirochetes. J. Bacteriol. 179:217-227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Coleman, A. S., et al. 2008. Borrelia burgdorferi complement regulator-acquiring surface protein 2 does not contribute to complement resistance or host infectivity. PLoS One 3:3010e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Coleman, J. L., et al. 1995. Borrelia burgdorferi binds plasminogen, resulting in enhanced penetration of endothelial monolayers. Infect. Immun. 63:2478-2484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Daniel, W. W. 1999. Biostatistics: a foundation for analysis in the health sciences. John Wiley and Sons, Inc., New York, NY.
  • 15.Eggers, C. H., et al. 2002. Identification of loci critical for replication and compatibility of a Borrelia burgdorferi cp32 plasmid and use of a cp32-based shuttle vector for the expression of fluorescent reporters in the Lyme disease spirochaete. Mol. Microbiol. 43:281-295. [DOI] [PubMed] [Google Scholar]
  • 16.El-Hage, N., et al. 2001. Surface exposure and protease insensitivity of Borrelia burgdorferi Erp (OspEF-related) lipoproteins. Microbiology 147:821-830. [DOI] [PubMed] [Google Scholar]
  • 17.Hartmann, K., et al. 2006. Functional characterization of BbCRASP-2, a distinct outer membrane protein of Borrelia burgdorferi that binds host complement regulators factor H and FHL-1. Mol. Microbiol. 61:1220-1236. [DOI] [PubMed] [Google Scholar]
  • 18.Hefty, P. S., et al. 2002. OspE-related, OspF-related, and Elp lipoproteins are immunogenic in baboons experimentally infected with Borrelia burgdorferi and in human Lyme disease patients. J. Clin. Microbiol. 40:4256-4265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hefty, P. S., S. E. Jolliff, M. J. Caimano, S. K. Wikel, and D. R. Akins. 2002. Changes in temporal and spatial patterns of outer surface lipoprotein expression generate population heterogeneity and antigenic diversity in the Lyme disease spirochete, Borrelia burgdorferi. Infect. Immun. 70:3468-3478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hefty, P. S., et al. 2001. Regulation of OspE-related, OspF-related, and Elp lipoproteins of Borrelia burgdorferi strain 297 by mammalian host-specific signals. Infect. Immun. 69:3618-3627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hellwage, J., et al. 2001. The complement regulator factor H binds to the surface protein OspE of Borrelia burgdorferi. J. Biol. Chem. 276:8427-8435. [DOI] [PubMed] [Google Scholar]
  • 22.Hu, L. T., G. Perides, R. Noring, and M. S. Klempner. 1995. Binding of human plasminogen to Borrelia burgdorferi. Infect. Immun. 63:3491-3496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Iyer, R., et al. 2003. Linear and circular plasmid content in Borrelia burgdorferi clinical isolates. Infect. Immun. 71:3699-3706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kenedy, M. R., S. R. Vuppala, C. Siegel, P. Kraiczy, and D. R. Akins. 2009. CspA-mediated binding of human factor H inhibits complement deposition and confers serum resistance in Borrelia burgdorferi. Infect. Immun. 77:2773-2782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kraiczy, P., et al. 2004. Immunological characterization of the complement regulator factor H-binding CRASP and Erp proteins of Borrelia burgdorferi. Int. J. Med. Microbiol. 293(Suppl. 37):152-157. [DOI] [PubMed] [Google Scholar]
  • 26.Kraiczy, P., et al. 2004. Complement resistance of Borrelia burgdorferi correlates with the expression of BbCRASP-1, a novel linear plasmid-encoded surface protein that interacts with human factor H and FHL-1 and is unrelated to Erp proteins. J. Biol. Chem. 279:2421-2429. [DOI] [PubMed] [Google Scholar]
  • 27.Lam, T. T., et al. 1994. Outer surface proteins E and F of Borrelia burgdorferi, the agent of Lyme disease. Infect. Immun. 62:290-298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lederer, S., et al. 2005. Quantitative analysis of Borrelia burgdorferi gene expression in naturally (tick) infected mouse strains. Med. Microbiol. Immunol. 194:81-90. [DOI] [PubMed] [Google Scholar]
  • 29.Lenhart, T. R., and D. R. Akins. 2010. Borrelia burgdorferi locus BB0795 encodes a BamA orthologue required for growth and efficient localization of outer membrane proteins. Mol. Microbiol. 75:692-709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.McDowell, J. V., et al. 2006. Evidence that the BBA68 protein (BbCRASP-1) of the Lyme disease spirochetes does not contribute to factor H-mediated immune evasion in humans and other animals. Infect. Immun. 74:3030-3034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.McDowell, J. V., et al. 2003. Comprehensive analysis of the factor H binding capabilities of Borrelia species associated with Lyme disease: delineation of two distinct classes of factor H binding proteins. Infect. Immun. 71:3597-3602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Metts, M. S., J. V. McDowell, M. Theisen, P. R. Hansen, and R. T. Marconi. 2003. Analysis of the OspE determinants involved in binding of factor H and OspE-targeting antibodies elicited during Borrelia burgdorferi infection in mice. Infect. Immun. 71:3587-3596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Miller, J. C., K. von Lackum, K. Babb, J. D. McAlister, and B. Stevenson. 2003. Temporal analysis of Borrelia burgdorferi Erp protein expression throughout the mammal-tick infectious cycle. Infect. Immun. 71:6943-6952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Samuels, D. S. 1995. Electrotransformation of the spirochete Borrelia burgdorferi. Methods Mol. Biol. 47:253-259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Steere, A. C. 1989. Lyme disease. N. Engl. J. Med. 321:586-597. [DOI] [PubMed] [Google Scholar]
  • 36.Steere, A. C. 2005. Borrelia burgdorferi (Lyme disease, Lyme borreliosis), p. 2798-2809. In G. L. Mandell, J. E. Bennett, and R. Dolin (ed.), Principles and practice of infectious diseases, 6th ed. Churchill Livingstone, Philadelphia, PA.
  • 37.Steere, A. C., J. Coburn, and L. Glickstein. 2004. The emergence of Lyme disease. J. Clin. Invest. 113:1093-1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Stevenson, B., J. L. Bono, T. G. Schwan, and P. A. Rosa. 1998. Borrelia burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their synthesis is inducible in cultured bacteria. Infect. Immun. 66:2648-2654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stevenson, B., N. El Hage, M. A. Hines, J. C. Miller, and K. Babb. 2002. Differential binding of host complement inhibitor factor H by Borrelia burgdorferi Erp surface proteins: a possible mechanism underlying the expansive host range of Lyme disease spirochetes. Infect. Immun. 70:491-497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Stevenson, B., and J. C. Miller. 2003. Intra- and interbacterial genetic exchange of Lyme disease spirochete erp genes generates sequence identity amidst diversity. J. Mol. Evol. 57:309-324. [DOI] [PubMed] [Google Scholar]
  • 41.Stevenson, B., T. G. Schwan, and P. A. Rosa. 1995. Temperature-related differential expression of antigens in the Lyme disease spirochete, Borrelia burgdorferi. Infect. Immun. 63:4535-4539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Stevenson, B., W. R. Zuckert, and D. R. Akins. 2000. Repetition, conservation, and variation: the multiple cp32 plasmids of Borrelia species. J. Mol. Microbiol. Biotechnol. 2:411-422. [PubMed] [Google Scholar]
  • 43.Stewart, P., R. Thalken, J. Bono, and P. Rosa. 2001. Isolation of a circular plasmid region sufficient for autonomous replication and transformation of infectious Borrelia burgdorferi. Mol. Microbiol. 39:714-721. [DOI] [PubMed] [Google Scholar]
  • 44.Tilly, K., A. Bestor, M. W. Jewett, and P. Rosa. 2007. Rapid clearance of Lyme disease spirochetes lacking OspC from skin. Infect. Immun. 75:1517-1519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tokarz, R., J. M. Anderton, L. I. Katona, and J. L. Benach. 2004. Combined effects of blood and temperature shift on Borrelia burgdorferi gene expression as determined by whole genome DNA array. Infect. Immun. 72:5419-5432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yang, X. F., U. Pal, S. M. Alani, E. Fikrig, and M. V. Norgard. 2004. Essential role for OspA/B in the life cycle of the Lyme disease spirochete. J. Exp. Med. 199:641-648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang, J. R., J. M. Hardham, A. G. Barbour, and S. J. Norris. 1997. Antigenic variation in Lyme disease Borreliae by promiscuous recombination of Vmp-like sequence cassettes. Cell 89:275-285. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES