Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2011 Mar;49(3):960–967. doi: 10.1128/JCM.01813-10

Identification of Pseudallescheria and Scedosporium Species by Three Molecular Methods▿

Qiaoyun Lu 1,2, A H G Gerrits van den Ende 2, J M J E Bakkers 3, Jiufeng Sun 2,4, M Lackner 2,5,6, M J Najafzadeh 2,7,8, W J G Melchers 3, Ruoyu Li 1,*, G S de Hoog 1,2,7,*
PMCID: PMC3067705  PMID: 21177887

Abstract

The major clinically relevant species in Scedosporium (teleomorph Pseudallescheria) are Pseudallescheria boydii, Scedosporium aurantiacum, Scedosporium apiospermum, and Scedosporium prolificans, while Pseudallescheria minutispora, Petriellopsis desertorum, and Scedosporium dehoogii are exceptional agents of disease. Three molecular methods targeting the partial β-tubulin gene were developed and evaluated to identify six closely related species of the S. apiospermum complex using quantitative real-time PCR (qPCR), PCR-based reverse line blot (PCR-RLB), and loop-mediated isothermal amplification (LAMP). qPCR was not specific enough for the identification of all species but had the highest sensitivity. The PCR-RLB assay was efficient for the identification of five species. LAMP distinguished all six species unambiguously. The analytical sensitivities of qPCR, PCR-RLB, and LAMP combined with MagNAPure, CTAB (cetyltrimethylammonium bromide), and FTA filter (Whatman) extraction were 50, 5 × 103, and 5 × 102 cells/μl, respectively. When LAMP was combined with a simplified DNA extraction method using an FTA filter, identification to the species level was achieved within 2 h, including DNA extraction. The FTA-LAMP assay is therefore recommended as a cost-effective, simple, and rapid method for the identification of Scedosporium species.

INTRODUCTION

Pseudallescheria species and their anamorphs in the genus Scedosporium classically are known as traumatically inoculated molds causing subcutaneous infections; in both of these genera, systemic diseases, eventually with neurotropic involvement, have become significant (16). The fungi are regularly encountered in the lungs of patients with cystic fibrosis (CF) or chronic suppurative lung disease (5, 7, 8, 17, 37), being the second most frequent fungal colonizer. However, upon isolation with routine media these species are outcompeted by Aspergillus and Candida spp. (7, 31), and their frequency is severely underestimated. In addition to selective isolation (31), the development of non-culture-based detection methods would provide better insight into their clinical relevance. For example, using counterimmunoelectrophoresis, scedosporiosis was found in 21.1% of patients serologically (7), while with an oligonucleotide array a 30.7% frequency of Scedosporium apiospermum was recently noted (5). Diabetes is a common complication of cystic fibrosis, and lung transplantation remains the ultimate treatment for the disease; in both situations there is a risk of dissemination of fungal colonizers in the lungs, such as Scedosporium (35). Overall, mortality for systemic scedosporiosis is 46.9%, but with disseminated disease and concomitant cerebral infection (33) the mortality may be as high as 87.5% (32).

Several recent studies demonstrated a significant phylogenetic distance within the Microascaceae between two main groups with anamorphs in Scedosporium. Scedosporium aurantiacum, S. apiospermum, and S. dehoogii were members of a clade (I) with Pseudallescheria teleomorphs (P. boydii and P. minutispora), whereas S. prolificans and relatives were found in a clade (II) with Petriella teleomorphs (M. Lackner, A. H. G. Gerrits van den Ende, G. S. de Hoog, and J. Kaltseis, submitted for publication). The great majority of subcutaneous and systemic strains are concentrated in four species located in these main clades, including S. aurantiacum, S. apiospermum, P. boydii, and S. prolificans (12, 14). Lackner (26) found that S. apiospermum and P. boydii had very similar antifungal susceptibility profiles, while profiles of S. aurantiacum, S. prolificans, and S. dehoogii were deviant from each other. Given the differences in virulence, metabolic abilities, and antifungal susceptibility between most species (3, 13, 15, 20), it is significant to detect and identify individual taxa within the clades. Morphological recognition of Scedosporium species is impossible due to a lack of phenetic characters and a high degree of morphological plasticity. New methods for routine identification are therefore needed. Several molecular methods targeting the internal transcribed spacer (ITS) region have been described, but with insufficient resolution to differentiate all clinical species of the two clades. The methods applied thus far include the use of sequencing (9, 12), random amplified polymorphic DNA (8), restriction fragment length polymorphism (9; Lackner et al., submitted), M13 PCR fingerprinting (9), amplified fragment length polymorphism (9), quantitative PCR (6), microarrays (5), specific PCR (Lackner et al., submitted), and rolling-circle amplification (27, 38). Lackner et al. (submitted) designed a set of ITS primers specific for most of the species, but for the identification for the most common taxa, S. apiospermum and P. boydii, partial β-tubulin gene (BT2) primers were needed. Gilgado et al. (12) noted that β-tubulin provided more information than ITS as a target for the identification of Scedosporium species.

In the present study, we developed three methods to identify closely related species of the Scedosporium species complex down to the species level using quantitative real-time PCR (qPCR), PCR-based reverse line blotting (PCR-RLB), and loop-mediated isothermal amplification (LAMP) combined with different DNA extraction methods, including a MagNAPure LC Isolation station, cetyltrimethylammonium bromide (CTAB), and Whatman FTA filter papers (FTA).

MATERIALS AND METHODS

Strains.

Sixty strains covering the entire diversity of the species of Scedosporium and nine strains from other related Pseudallescheria and Scedosporium species, as well as 10 non-Pseudallescheria and non-Scedosporium fungal isolates were obtained from the collection of the Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre (CBS) (Table 1). The Pseudallescheria and Scedosporium species tested included S. aurantiacum, S. apiospermum, P. boydii, P. angusta, P. ellipsoidea, P. fusoidea, S. prolificans, S. dehoogii, and P. minutispora; Parascedosporium tectonae, Lophotrichus fimeti, Petriellopsis africana, Petriella setifera, Petriella sordida, Petriella guttulata, Petriellopsis desertorum, Pithoascus langeronii, Graphium penicillioides, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Candida albicans, Fusarium solani, Rhizopus oryzae, Cryptococcus neoformans, and Exophiala dermatitidis were also tested. Since P. angusta, P. ellipsoidea, and P. fusoidea could not be clearly distinguished from P. boydii, we reduced them to the P. boydii complex. All strains belonging to Pseudallescheria and Scedosporium species were sequenced for both the ITS regions and the partial BT2 gene which comprised exons 2 to 4, generated and sequenced with primers Bt2a and Bt2b.

Table 1.

Summary of the strains used in this study

Species Straina Country of isolation Source
Scedosporium aurantiacum CBS 116910 (T) Spain Clinical
CBS 101726 Netherlands Mud
CBS 117423 France Sputum, cystic fibrosis
DH 16589 Austria Soil
DH 16457 Austria Soil
DH 16443 Austria Soil
DH 16452 Austria Soil
DH 16532 Austria Soil
DH 16634 Austria Soil
DH 16495 Austria Soil
Scedosporium apiospermum CBS 116899 (T) France Sputum, cystic fibrosis
CBS 101725 Netherlands Mud
CBS 695.70 Ukraine Pig, nasal cavity
CBS 948.87 India Human (male), mycetoma pedis
CBS 116403 Germany Human (male), fatal cerebral infection, brain
CBS 116779 China Human (male), sinus
DH 16618 Austria Soil
DH 16481 Austria Soil
DH 16473 Austria Soil
DH 16544 Austria Soil
Pseudallescheria boydii CBS 101.22 (T) United States Human (male), mycetoma
CBS 116894 Thailand Soil
CBS 120157 France Human (male), lung, leukemia
CBS 116892 France Sputum, cystic fibrosis
DH 16566 Austria Soil
DH 16549 Austria Soil
DH 16539 Austria Soil
CBS 117390 Zaire Forest soil
Pseudallescheria angusta CBS 254.72 (T) United States Sewage half digestion tank
CBS 108.54 Zaire Soil
Pseudallescheria ellipsoidea CBS 418.73 (T) Tajikistan Soil
Pseudallescheria fusoidea CBS 106.53 (T) Panama Soil
Scedosporium prolificans CBS 467.74 (T) Belgium Greenhouse soil
CBS 100391 Germany Human (male), disseminated infection in patient with AIDS and Burkitt lymphoma
CBS 114.90 United States Human (male), bone biopsy
CBS 116900 Spain Human (male), blood
CBS 116901 Spain Soil
CBS 116902 Spain Human (male), blood
CBS 116903 Spain Air
CBS 116904 Spain Human (male), blood
CBS 116906 France Sputum, cystic fibrosis
CBS 116908 Spain Human (male), blood
Scedosporium dehoogii CBS 117406 (T) Spain Soil
CBS 101723 Netherlands Mud
CBS 101720 Netherlands Sandy soil of polluted ditch
CBS 101721 Netherlands Mud
CBS 499.90 Netherlands Mud of tropical pond
CBS 100.26 Unknown Clinical
DH 16629 Austria Soil
DH 16645 Austria Soil
DH 16644 Austria Soil
DH 16451 Austria Soil
Pseudallescheria minutispora CBS 116911 (T) Spain River sediment
CBS 116595 Belgium Fuel oil
DH 16625 Austria Soil
DH 16628 Austria Soil
DH 16629 Austria Soil
DH 16569 Austria Soil
DH 16631 Austria Soil
DH 16357 Austria Soil
Parascedosporium tectonae CBS 108.10 (T) France Human (male), foot
Lophotrichus fimeti CBS 129.78 (T) India Dung of goat
Petriellopsis africana CBS 311.72 (T) Namibia Brown sandy soil
Petriella setifera CBS 265.64 Japan Soil
Petriella sordida CBS 385.87 Finland Human (male), nail
Petriella guttulata CBS 362.61 (T) Germany Dung of partridge
Petriellopsis desertorum CBS 489.72 (T) Kuwait Salt-marsh soil
Pithoascus langeronii CBS 203.78 (T) India Dung of herbivore
Graphium penicillioides CBS 320.72 Solomon Islands Forest soil
Aspergillus fumigatus CBS 133.61 United States Chicken, lung
Aspergillus flavus CBS 100927 Pacific Islands Cellophane
Aspergillus nidulans CBS 565.70 United Kingdom Cotton yarn
Aspergillus niger CBS 554.65 United States Fermentation
Aspergillus terreus CBS 469.81 Thailand Human (male), cardiac valve
Candida albicans CBS 8758 unknown Disseminated candidiasis
Fusarium solani CBS 108942 Netherlands Human (male), big toe
Rhizopus oryzae CBS 112.07 (T) Netherlands Unknown
Cryptococcus neoformans CBS 10513 United States Unknown
Exophiala dermatitidis CBS 207.35 Japan Human (male), facial chromomycosis
a

Abbreviations: (T), ex-type strain; CBS, Centraalbureau voor Schimmelcultures, Utrecht, Netherlands.

Primer design.

Primers and probes (Table 2) were designed on the basis of ∼300 BT2 sequences in an internal research database of Pseudallescheria and Scedosporium available at CBS which included all known ex-type strains. For qPCR, four species-specific primers and 5′-FAM-labeled TaqMan probes were designed. For RLB, a group-specific primer PS_F specific for S. aurantiacum, S. apiospermum, P. boydii, S. dehoogii, P. minutispora, and Petriellopsis desertorum and Pro_F specific for S. prolificans were designed as forward primers with 5′-biotin-labeled T2_Bas reverse primer. Six species-specific probes and a group-specific probe PS_P specific for S. aurantiacum, S. apiospermum, P. boydii, S. dehoogii, P. minutispora, and Petriellopsis desertorum were labeled with C6-amino linker at the 5′ end. The melting temperatures of the probes were optimized at ca. 60°C by Sigma-Aldrich (http://www.sigma-genosys.com/calc/DNACalc.asp). Briefly, the design of the two outer primers, F3 and B3, is the same as that of regular PCR primers, while the design of the forward inner primer (FIP; F1c + F2) and backward inner primer (BIP; B1c + B2) is different from that of PCR (Fig. 1). Primers for six species of interest were designed by using PrimerExplorer v.4 (http://primerexplorer.jp/e/). All primers and probes were BLAST searched against nucleotide databases available at GenBank, as well as the CBS database, to verify specificity.

Table 2.

Primers and probes designed in this studya

Primer or probe Oligonucleotides (5′–3′) Position Specificity
Primers and probes used for qPCR
    Forward primer TGGCGAGCACGGTCTTG 136–152a
    Aura_P FAM-TAGCAACGGAATGTATGGACTCCCCCT-BBQ 154–180a S. aurantiacum
    Aura_R CGTCGACTGCTGCTGCT 215–199a S. aurantiacum
    Apioboy_P FAM-TAGCAACGGAGTGTACGGAACCACCC-BBQ 120–145b S. apiospermum and P. boydii
    Apioboy_R ACATTCACGGCAGACACTGATT 216–195b S. apiospermum and P. boydii
    Pro_P FAM-CAGCAATGGCGTGTATGGCTTCCC-BBQ 121–144d S. prolificans
    Pro_R GCCTTTACCTCTGGTGATTTGG 176–155d S. prolificans
    Minu_P FAM-TAGCAACGGAGTGTACGGCCCCC-BBQ 72–94f P. minutispora
    Minu_R TAATGCCAGTCACATCGACTAGTG 134–111f P. minutispora
Primers and probes used for PCR-RLB
    PS_F CAAAGTTACAATGGCACTTCTG 269–290a
    Pro_F GTTACAATGGAACATCCGAACTCC 239–262d
    T2_B biotin-TAGTGACCCTTGGCCCAGTTG 586–566a
    Aura_P amino-CAGCCTATCTATGTTGCGG 375–393a S. aurantiacum
    Apio_P amino-GAGGTAAGTTTTTGGCTAAAGC 286–307b S. apiospermum
    Boy_P amino-CGAGGTAAGTTTTTGGTTCAAA 272–293c P. boydii
    Pro_P amino-ATAGCGAGCCATAAATCCG 313–331d S. prolificans
    Deho_P amino-CAGAAATACTAACGTCTTGGTTACCT 339–364e S. dehoogii
    Minu_P amino-GGTATGTTTTTGGTTAAAGCCAT 237–259f P. minutispora
    PS_P amino-TAGGCTTCGGGCAACA 426–441a S. aurantiacum, S. apiospermum, P. boydii, S. dehoogii, P. minutispora, and P. desertorum
Primers used for LAMP
    Aura_F3 CCATTTCTGGCGAGCACG 129–146a S. aurantiacum
    Aura_B3 ACCTCGTTGAAGTAGACGCT 330–311a S. aurantiacum
    Aura_F2 TGTATGGACTCCCCCTTTCC 165–184a S. aurantiacum
    Aura_F1c GAGAGCAGCAGCAGCAGCAG 233–214a S. aurantiacum
    Aura_B2 AGCTGGAGTTCAGAAGTGC 300–282a S. aurantiacum
    Aura_B1c AACCGCAGAGACTGATTGTCCC 239–260a S. aurantiacum
    Apio_F3 ATGGCACTTCTGAACTCCAG 221–240b S. apiospermum
    Apio_B3 GGGCTCGAGATCTACAAGGA 419–400b S. apiospermum
    Apio_F2 CTTGAGCGCATGAGCGTC 241–258b S. apiospermum
    Apio_F1c CAACCGGCCCGTGGCTTTAG 302–283b S. apiospermum
    Apio_B2 TTTGTTGCCCGAAGCCTAT 383–365b S. apiospermum
    Apio_B1c GTGTCATCCGGCCTCCGTTG 308–327b S. apiospermum
    Boy_F3 ATGGCACTTCTGAACTCCAG 226–245c P. boydii
    Boy_B3 CGAGATCTACAAGGACAGCG 419–400c P. boydii
    Boy_F2 CTTGAGCGCATGAGCGTT 246–263c P. boydii
    Boy_F1c AACCAGCCCGTGGTTTGAACC 306–286c P. boydii
    Boy_B2 TTTGTTGCCCGAAGCCTAT 388–370c P. boydii
    Boy_B1c GTGTGGTGTCATCCAGCCTCC 308–328c P. boydii
    Pro_F3 ACAGGCAAACCATTTCCGG 89–107d S. prolificans
    Pro_B3 GCTCAAGCTGGAGTTCGG 273–256d S. prolificans
    Pro_F2 CGAGCACGGTCTTGACAG 108–125d S. prolificans
    Pro_F1c AGAGGTAAAGGCGGGGGTGG 168–149d S. prolificans
    Pro_B2 ACACGCAGAGGAAAATCAGT 236–217d S. prolificans
    Pro_B1c GGTGATTTGGCGTATTGGGCTG 169–190d S. prolificans
    Deho_F3 AGGCAAACCATTTCTGGCG 78–96e S. dehoogii
    Deho_B3 ACCTCGTTGAAGTAGACGCT 280–261e S. dehoogii
    Deho_F2 AGCACGGTCTTGATAGCA 97–114e S. dehoogii
    Deho_F1c TGGCATTAGGGGGGTTTAAGGG 159–138e S. dehoogii
    Deho_B2 CAAGCTGGAGCTCAGAAG 252–235e S. dehoogii
    Deho_B1c TGCTGCTCTCGCATTAACGACA 174–195e S. dehoogii
    Minu_F3 GCACGGTCTTGATAGCAACG 60–79f P. minutispora
    Minu_B3 GGTCGGATGACACCACATC 287–269f P. minutispora
    Minu_F2 CCTCATCCCTTACCCCCTA 94–113f P. minutispora
    Minu_F1c AGGGACAATCAGTGTCTGCCGT 170–149f P. minutispora
    Minu_B2 CAGCCCATGGCTTTAACCA 265–247f P. minutispora
    Minu_B1c TGGCACTTCTGAACTCCAGCTT 189–210f P. minutispora
a

Abbreviations: Aura, S. aurantiacum; Apio, S. apiospermum; Boy, P. boydii; Pro, S. prolificans; Deho, S. dehoogii; Minu, P. minutispora; PS, Pseudallescheria/Scedosporium; F, forward primer; B, backward primer; P, probe; c, complementary; BBQ, BlackBerry Quencher. Superscript letters denote the following: a, β-tubulin sequence of S. aurantiacum, GenBank accession number GU126389; b, β-tubulin sequence of S. apiospermum, GenBank accession number FJ904910; c, β-tubulin sequence of P. boydi, GenBank accession number AJ889863; d, β-tubulin sequence of S. prolificans, GenBank accession number AB362937; e, β-tubulin sequence of S. dehoogii, GenBank accession number GU126407; and f, β-tubulin sequence of P. minutispora, GenBank accession number AM409107.

Fig. 1.

Fig. 1.

Nucleic acid sequences of minimum P. boydii-specific LAMP reaction unit of different haplotypes. Abbreviations: H, haplotype; F, forward primer; B, backward primer; c, complementary. Sequences: H1, CBS 101.22 (T); H2, CBS 117390; H3, DH 16566; H4, CBS 254.72; H5, CBS 116892. LAMP inner (FIP and BIP) and outer (F3 and B3) primer pairs are indicated by arrows. The FIP (BIP) primer consists of F1c (or B1c) and F2 (B2). In the first step of a LAMP reaction, new DNA strands were synthesizes from the F3 and B3 primers. In the next step, the newly synthesized strands would be recognized by FIP and BIP which bound both sense and antisense strands of target DNA in order to start loop-mediated autocycling amplification.

DNA extraction.

A MagNAPure LC isolation station was used for the DNA extraction for qPCR. 200 μl of the conidial suspension was transferred to MagNA Lyser Green bead tubes (Roche Applied Science) and homogenized for 20 s at 6,500 rpm by using the MagNA Lyser instrument and subsequently processed with a total nucleic acid isolation kit according to the manufacturer's protocol (Roche Applied Science) (1). Nucleic acids were resuspended in 50 μl of elution buffer. The DNA extraction for RLB was the CTAB (cetyltrimethylammonium bromide) method as previously described (11). Briefly, this method combines enzymatic (proteinase K) and mechanical steps (glass beads) in the presence of CTAB. For DNA extraction for LAMP, a simple method with Whatman FTA filter papers was used. Aqueous suspensions (100 μl) containing conidia and hyphal fragments were first treated by three to four freeze-thaw cycles coupled with vortex mixing for 30 s in the presence of 20 to 40 acid-washed glass beads (diameter, 425 to 600 μm; Sigma). The suspensions were then applied directly to FTA filters, and punches (2 mm in diameter) were removed from dried FTA filters and washed twice with 100 μl of sterile water. After the washing step, the filters were again air dried, and LAMP reagents were added directly to the FTA filters (4).

qPCR.

Quantitative real-time PCR was performed in a volume of 25 μl, consisting of 12.5 μl of LightCycler 480 master mix (Roche Applied Science), 2 μM concentrations of each primer, 0.8 μM concentrations of each probe, and 2.5 μl of template. The PCR thermal profile consisted of an initial incubation at 95°C for 10 min, followed by 45 cycles 95°C for 15 s and 64°C for 30 s. Species were detected separately. Amplification, detection, and data analysis were executed by the LightCycler 480 system (Roche Applied Science). A Cp (crossing point) value more than 40 was considered negative. The master mix was prepared in a biosafety cabinet. The qPCR was run in a room separate from where the PCR master mix or DNA was prepared.

PCR-RLB.

Duplex-PCR amplification of BT2 was performed at 94°C for 5 min, followed by 35 cycles 94°C for 45 s, 56°C for 45 s, and 72°C for 90 s, followed in turn by an elongation step at 72°C for 7 min in a mixture of of 1× GoTaq Green Master Mix (Promega), 400 nM primers, and 1 μl of template. RLB was modified as described by Bergmans et al. (2) using a top-down hybridization temperature and a critical washing temperature, as well as adjustment of sodium dodecyl sulfate (SDS) and probe concentrations. Briefly, solutions with 5′-amino-linked oligonucleotide probes ranging from 50 to 2,500 pmol/lane were coupled covalently to an activated Biodyne C membrane in a line pattern with a miniblotter (Immunetics). The membrane was incubated in 0.1 M NaOH for 10 min at room temperature, washed in 2× SSPE (360 mM NaCl, 20 mM Na2HPO4 · H2O, 2 mM EDTA) with 0.1% SDS at 42°C. Then, 10-μl portions of the biotin-labeled PCR products were diluted in 150 μl of 2× SSPE–0.1% SDS, denatured at 100°C for 10 min, and applied to the membrane immediately in a perpendicular way, without chilling on ice. Afterward, the membrane was incubated in the miniblotter for 10 min at 70°C to maintain denaturation of the high-GC-content PCR products and subsequently hybridized for 30 min at 50°C. The membrane was removed from the miniblotter and washed twice in 2× SSPE–0.1% SDS for 10 min at 60°C exactly. Subsequently, the membrane was incubated for 30 min at 42°C with streptavidin-peroxidase (Boehringer), diluted 1:4,000 in 2× SSPE–0.5% SDS, washed twice for 6 min in 2× SSPE–0.5% SDS, and twice for 6 min in 2× SSPE. The membrane was then incubated with ECL detection liquid (GE Healthcare) and exposed to an ECL hyperfilm (GE Healthcare) for 2 to 10 min. After routine development and fixing, hybridization signals were visible by naked eye. The membrane with probes could be reused at least 20 times after stripping off the PCR products by incubation of the membrane for 2 × 10 min at 80°C in 1% SDS.

LAMP.

The LAMP reaction was conducted in a reaction mixture with 0.4 μM concentrations (each) of F3 and B3, 1.6 μM concentrations (each) of FIP and BIP, 200 μM deoxynucleoside triphosphates, 0.8 M betaine (Sigma), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 4 mM MgSO4, 0.1% Triton X-100, 8 U of the Bst DNA polymerase large fragment (New England Biolabs), and one punch of an FTA card or 1 μl of genomic DNA as a template. The reaction mixture without Bst DNA polymerase was first incubated at 95°C for 5 min and chilled on ice; 8 U of Bst DNA polymerase was then added, followed by incubation at 63°C for 60 min and heating at 85°C for 2 min to terminate the reaction (34). The reactions were carried out either in a water bath or in a PCR machine. Species-specific reactions were carried out in separate tubes. Temperatures ranging from 60 to 70°C were tested to find the optimal condition, which was determined to be 63°C for all sets. The resulting amplicons were detected either by visual observation after the addition of 1 μl of 1/10 dilution of SYBR green I (Cambrex Bioscience) or by gel electrophoresis in 1% agarose gels stained with ethidium bromide. Careful precautions against cross-contamination were taken during sample collections and preparations by using separated rooms and filtered tips.

RESULTS

qPCR.

Identification down to the species level was possible with the probes for S. aurantiacum, S. prolificans, and P. minutispora. Since S. apiospermum and P. boydii share the same primers and probe, differentiation between them is impossible. The probes for S. aurantiacum and S. prolificans did not cross-react with other Pseudallescheria and Scedosporium spp., but S. apiospermum, P. boydi, and P. minutispora cross-reacted with each other (data not shown).

PCR-RLB.

Duplex-PCR amplification of BT2 yielded clear Pseudallescheria and Scedosporium-specific bands (data not shown). Although the closely related species Petriellopsis desertorum was also amplified, it gave a signal only with the group-specific probe PS_P on the blot (data not shown). This assay was specific for five species except S. dehoogii. Nonspecific signals were found with S. dehoogii strains with probes of S. apiospermum, P. boydii, and P. minutispora. Nonspecific signals varied among different haplotypes due to nucleotide variation at the probe region. However, each S. dehoogii strain was identified correctly according to the strongest signal. The group-specific probe matched well with the five species-specific probes (Fig. 2).

Fig. 2.

Fig. 2.

Results of reverse line blot of PCR products. Abbreviations: P, probe. Horizontal lanes indicate the species-specific probes and a group-specific probe (PS_P) (three lanes per probe). Vertical lanes indicate PCR products from isolates (seven strains per species): lanes 1 to 7, S. dehoogii; lanes 8 to 14, S. aurantiacum; lanes 15 to 21, S. apiospermum; lanes 22 to 28, P. boydii; lanes 29 to 35, S. prolificans; and lanes 36 to 42, P. minutispora.

LAMP.

All primers hybridized specifically with their respective DNA targets from each haplotype (data not shown). In all cases, we could distinguish LAMP-positive samples from LAMP-negative samples simply by visual observation after the addition of SYBR green I or gel electrophoresis. There was an agreement in the detection of the amplification product by gel electrophoresis and the addition of SYBR green I. The identification was shortened to 2 h starting from DNA extraction by FTA filters.

Analytical specificity.

To determine the analytical performance of these methods, DNAs from 60 CBS reference strains covering each haplotype of the species of interest were tested. Nine strains from other related Pseudallescheria and Scedosporium species were analyzed in order to examine the specificity. For comparison, genomic DNAs of 10 non-Pseudallescheria and Scedosporium fungal isolates, including Aspergillus, Candida, and Exophiala spp., were subjected to the detection methods outlined above. No cross-reaction with other related Pseudallescheria and Scedosporium species or non-Pseudallescheria/non-Scedosporium fungal isolates was observed.

Analytical sensitivity.

Analytical sensitivity was evaluated both by conidial spiking and DNA dilution. Ex-type strains of each species of interest were cultured in potato dextrose agar (PDA) and incubated at 37°C for 1 week. Conidia were harvested in 5 ml of 0.85% sterile saline–0.01% Tween 80 solution and filtered through an 11-μm-pore-size filter (6). Serial 10-fold dilutions of conidia and DNA were prepared in duplex in culture-negative and PCR-negative sputum samples from CF patients to achieve final concentrations ranging from 5 × 103 to 5 cells/μl and 10 ng/μl to 10 fg/μl. The detection limit was 5 × 103 cells/μl, as well as 20 pg of pure DNA for PCR-RLB and 50 cells/μl for qPCR. The LAMP assay reliably yielded positive signals from one punch of FTA paper with spiked sputum samples containing 5 × 102 cells/μl conidia, as well as 5 × 103 cells/μl conidia and 20 pg of pure DNA extracted by CTAB (Fig. 3). No difference between species was found (data not shown). The qPCR combined with MagNAPure appeared to be the most sensitive method, followed by LAMP and PCR-RLB combined with FTA and CTAB, respectively.

Fig. 3.

Fig. 3.

Electrophoresis and visible assay of LAMP products. Genome DNAs from 10-fold diluted conidia of S. aurantiacum (CBS 116910) extracted by FTA cards were used as templates. (A) Lane 1, smart DNA marker; lanes 2 to 6, 5 × 103 cells/μl, 5 × 102 cells/μl, 50 cells/μl, 5 cells/μl, and a tube without DNA template, respectively. (B) Tubes 1 to 5, visual appearance by the naked eye, 5 × 103 cells/μl, 5 × 102 cells/μl, 50 cells/μl, 5 cells/μl, and a tube without DNA template, respectively; tubes 6 to 10, under UV transillumination, 5 × 103 cells/μl, 5 × 102 cells/μl, 50 cells/μl, 5 cells/μl, and a tube without DNA template, respectively.

DISCUSSION

Scedosporium strains are known to exhibit a high degree of genetic variability (8, 39). Different numbers of haplotypes of these species are known to exist, with a maximum of 16 within P. boydii (Lackner et al., submitted). Only S. prolificans is relatively homogeneous, being recognizable by a set of stable diagnostic features (36). Due to the limited difference between species and significant variation within species, the ITS region appeared to be inadequate for primer and probe design for the methods applied in the present study. Even with BT2, the regions selected for potential primers and probes differed by only one or few nucleotides for some of the species pairs. Particularly, the complex of P. boydii and its heterothallic sister species S. apiospermum are very close to each other. Conversely, there is significant variation within both species. Five haplotypes were found within P. boydii at the primer region of LAMP (Fig. 1). With qPCR no specific primers and probes could be found in ITS or BT2 to distinguish between them, Pseudallescheria boydii sharing the same set of primers and probes with S. apiospermum. In addition, S. apiospermum, P. boydii, and P. minutispora cross-reacted with each other. For RLB, we found a unique potential probe region with three nucleotides difference between P. boydii and S. apiospermum. Thus, they were clearly distinguished by each of the probes. Pseudallescheria angusta, P. ellipsoidea, and P. fusoidea were recognized by the P. boydii probe. Scedosprium dehoogii was the most difficult species for identification. Two different primers were necessary to amplify all ITS haplotypes within this species (Lackner et al., submitted). For qPCR also two sets of primers and probes were required. With PCR-RLB, all nonspecific signals were due to S. dehoogii. Reliable differentiation of S. prolificans and S. aurantiacum was achieved by all three methods. LAMP provided very specific results, recognizing each haplotype of all six species despite low ratios of interspecific diversity and intraspecific variability. The efficiency and sensitivity of LAMP to recognize different, closely related entities with a single primer agreed with what was found in previous publications (18, 19, 24).

Castelli et al. (6) developed two real-time PCR-based assays using molecular beacon probes targeting the ITS1 region of ribosomal DNA for the detection of S. prolificans and S. apiospermum DNA. When Pseudallescheria and Scedosporium species other than S. prolificans and S. apiospermum were encountered, false-negative results could be obtained. The reason a false-negative result was obtained by microarrays developed by Bouchara et al. was that the probes designed could not detect all of these species (5). In our study, with the limitations in adequate probe design, qPCR was unable to distinguish all species. This included S. apiospermum and P. boydii, which are the prevalent clinical species of the genus. However, the sensitivity is the highest. It is probably better to use qPCR as a monitoring technique once the pathogen has been diagnosed, taking advantage of the high sensitivity and quantification. The PCR-RLB assay was able to identify five species except S. dehoogii. The latter species has not been proven to have clinical relevance, and thus PCR-RLB is sufficient for use in clinical diagnostics. If S. dehoogii strains are also present, correct signals were always stronger than nonspecific signals. The nonspecific signals caused by S. dehoogii were due to insufficient differences with S. apiospermum, P. boydii, and P. minutispora at the probe regions. Thus, every species could easily be distinguished, making the technique also suitable for identification of environmental isolates. Up to 43 targets in 43 individual specimens can be compared simultaneously (23). LAMP is one of the nucleic acid amplification tests applicable to microbial identification in various fields, such as diagnosis of infections (22). Using a set of two specifically designed inner primers and two outer primers that recognize six distinct regions of the target DNA, LAMP was easily performed isothermally for ∼1 h. The target sequence specificity of a LAMP reaction appears to be higher than that of PCR (29). Also, LAMP has the advantages that the specificity and sensitivity of detection appears not to be affected by the presence of known PCR inhibitors (10, 21, 29, 30). The LAMP assays developed in the present study readily distinguished six species of interest with high specificity.

To simplify DNA extraction for LAMP, we used commercially available Whatman FTA filters. The filter matrices are fibrous cards impregnated with chelators and denaturants that lyse and inactivate most microorganisms. Released large nucleic acids become physically trapped within the fibers of the FTA matrix and are preserved intact, while cellular debris can be removed by simple washes of the inoculated card. A recent study (4) evaluated the possibility of using prepunched Whatman FTA filter paper with fungal suspensions subjected to PCR. This material was sequenced successfully, targeting the partial β-tubulin gene (TUB). We found that with prepunched FTA filters the sensitivity was lower due to the small volume of samples added. A 100-μl droplet at the center of FTA filters and a punch removed from the center afterward was recommended for the detection of a few targets (28). FTA-LAMP was found to be significantly more sensitive than FTA-PCR (24) and ten times more sensitive than CTAB-LAMP.

Useful characteristics of FTA-LAMP as described here particularly concern the combination of highly sensitive and specific DNA amplification, as well as extraction simplicity for individual strains. PCR and other sensitive molecular techniques are best conducted in well-equipped laboratories only. In contrast, FTA-LAMP may also be used at local clinics. Thus, we conclude that—based on economics, practicality, and need—the FTA-LAMP assay is recommended for the identification of Pseudallescheria and Scedosporium species.

ACKNOWLEDGMENTS

This project was funded by a Special Scientific Research Project and Public Welfare Project of Health Profession of China, 11th Five-Year Key Special Subject for Science and Technical Research of China, and the China Scholarship Council. This study was carried out in cooperation with the ECMM-ISHAM working group on Pseudallescheria and Scedosporium infections.

We gratefully acknowledge the technical assistance of Judith Kuijpers and Arjan de Jong in the Department of Medical Microbiology at Radboud University Nijmegen Medical Centre, Nijmegen, Netherlands, for excellent cooperation and assistance on the qPCR analyses. In addition, we thank Anneke Bergmans in the Laboratory of Medical Microbiology at Franciscus Hospital, Roosendaal, Netherlands, and Mark Fraser at Mycology Reference Laboratory, Health Protection Agency, South-West Regional Laboratory, Bristol, United Kingdom, for helpful discussions on PCR-RLB and FTA filters, respectively.

Footnotes

▿

Published ahead of print on 22 December 2010.

REFERENCES

  • 1. Arendrup M. C., et al. Development of azole resistance in Aspergillus fumigatus during azole therapy associated with change in virulence. PLoS One 5:e10080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Bergmans A. M., et al. 2008. Validation of PCR-reverse line blot, a method for rapid detection and identification of nine dermatophyte species in nail, skin and hair samples. Clin. Microbiol. Infect. 14:778–788 [DOI] [PubMed] [Google Scholar]
  • 3. Borman A. M., Campbell C. K., Linton C. J., Bridge P. D., Johnson E. M. 2006. Polycytella hominis is a mutated form of Scedosporium apiospermum. Med. Mycol. 44:33–39 [DOI] [PubMed] [Google Scholar]
  • 4. Borman A. M., Fraser M., Linton C. J., Palmer M. D., Johnson E. M. An improved protocol for the preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA filter papers. Mycopathologia 169:445–449 [DOI] [PubMed] [Google Scholar]
  • 5. Bouchara J. P., et al. 2009. Development of an oligonucleotide array for direct detection of fungi in sputum samples from patients with cystic fibrosis. J. Clin. Microbiol. 47:142–152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Castelli M. V., et al. 2008. Development and validation of a quantitative PCR assay for diagnosis of scedosporiosis. J. Clin. Microbiol. 46:3412–3416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Cimon B., et al. 2000. Clinical significance of Scedosporium apiospermum in patients with cystic fibrosis. Eur. J. Clin. Microbiol. Infect. Dis. 19:53–56 [DOI] [PubMed] [Google Scholar]
  • 8. Defontaine A., et al. 2002. Genotyping study of Scedosporium apiospermum isolates from patients with cystic fibrosis. J. Clin. Microbiol. 40:2108–2114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Delhaes L., et al. 2008. Molecular typing of Australian Scedosporium isolates showing genetic variability and numerous S. aurantiacum. Emerg. Infect. Dis. 14:282–290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Enosawa M., et al. 2003. Use of loop-mediated isothermal amplification of the IS900 sequence for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. J. Clin. Microbiol. 41:4359–4365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Gerrits van den Ende A. H. G., de Hoog G. S. 1999. variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana. Stud Mycol. 43:151–162 [Google Scholar]
  • 12. Gilgado F., Cano J., Gené J., Guarro J. 2005. Molecular phylogeny of the Pseudallescheria boydii species complex: proposal of two new species. J. Clin. Microbiol. 43:4930–4942 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Gilgado F., Cano J., Gené J., Serena C., Guarro J. 2009. Different virulence of the species of the Pseudallescheria boydii complex. Med. Mycol. 47:371–374 [DOI] [PubMed] [Google Scholar]
  • 14. Gilgado F., Cano J., Gené J., Sutton D. A., Guarro J. 2008. Molecular and phenotypic data supporting distinct species statuses for Scedosporium apiospermum and Pseudallescheria boydii and the proposed new species Scedosporium dehoogii. J. Clin. Microbiol. 46:766–771 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Gilgado F., Serena C., Cano J., Gené J., Guarro J. 2006. Antifungal susceptibilities of the species of the Pseudallescheria boydii complex. Antimicrob. Agents Chemother. 50:4211–4213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Guarro J., et al. 2006. Scedosporium apiospermum: changing clinical spectrum of a therapy-refractory opportunist. Med. Mycol. 44:295–327 [DOI] [PubMed] [Google Scholar]
  • 17. Horré R., Marklein G., Siekmeier R., Nidermajer S., Reiffert S. M. 2009. Selective isolation of Pseudallescheria and Scedosporium species from respiratory tract specimens of cystic fibrosis patients. Respiration 77:320–324 [DOI] [PubMed] [Google Scholar]
  • 18. Ihira M., et al. 2008. Loop-mediated isothermal amplification for discriminating between human herpesvirus 6 A and B. J. Virol. Methods 154:223–225 [DOI] [PubMed] [Google Scholar]
  • 19. Iseki H., et al. Evaluation of a loop-mediated isothermal amplification method as a tool for diagnosis of infection by the zoonotic simian malaria parasite Plasmodium knowlesi. J. Clin. Microbiol. 48:2509–2514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kaltseis J., Rainer J., De Hoog G. S. 2009. Ecology of Pseudallescheria and Scedosporium species in human-dominated and natural environments and their distribution in clinical samples. Med. Mycol. 47:398–405 [DOI] [PubMed] [Google Scholar]
  • 21. Kaneko H., Kawana T., Fukushima E., Suzutani T. 2007. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70:499–501 [DOI] [PubMed] [Google Scholar]
  • 22. Karanis P., Ongerth J. 2009. LAMP–a powerful and flexible tool for monitoring microbial pathogens. Trends Parasitol. 25:498–499 [DOI] [PubMed] [Google Scholar]
  • 23. Kong F., Gilbert G. L. 2006. Multiplex PCR-based reverse line blot hybridization assay (mPCR/RLB): a practical epidemiological and diagnostic tool. Nat. Protoc. 1:2668–2680 [DOI] [PubMed] [Google Scholar]
  • 24. Kuboki N., et al. 2003. Loop-mediated isothermal amplification for detection of African trypanosomes. J. Clin. Microbiol. 41:5517–5524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Reference deleted.
  • 26. Lackner M. 2010. Molecular diagnostics and drug resistance in emerging opportunists of Scedosporium. Ph.D. thesis University of Innsbruck, Innsbruck, Austria [Google Scholar]
  • 27. Lackner M., de Hoog G. S., Sun J., Lu Q., Najafzadeh M. J. Rapid RCA screening of environmental contaminants. Appl. Environ. Microbiol., in press [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Lu Q., et al. 2011. A rapid DNA extraction method for molecular identification of pathogenic fungi. Chin. J. Mycol. 5:139–140 [Google Scholar]
  • 29. Notomi T., et al. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:E63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Poon L. L., et al. 2005. Evaluation of real-time reverse transcriptase PCR and real-time loop-mediated amplification assays for severe acute respiratory syndrome coronavirus detection. J. Clin. Microbiol. 43:3457–3459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Rainer J., Kaltseis J., de Hoog G. S., Summerbell R. C. 2008. Efficacy of a selective isolation procedure for members of the Pseudallescheria boydii complex. Antonie Van Leeuwenhoek 93:315–322 [DOI] [PubMed] [Google Scholar]
  • 32. Rodriguez-Tudela J. L., et al. 2009. Epidemiology and outcome of Scedosporium prolificans infection, a review of 162 cases. Med. Mycol. 47:359–370 [DOI] [PubMed] [Google Scholar]
  • 33. Satirapoj B., et al. 2008. Pseudallescheria boydii brain abscess in a renal transplant recipient: first case report in Southeast Asia. Transplant Proc. 40:2425–2427 [DOI] [PubMed] [Google Scholar]
  • 34. Sun J., Najafzadeh M. J., Vicente V., Xi L., de Hoog G. S. 2010. Rapid detection of pathogenic fungi using loop-mediated isothermal amplification, exemplified by Fonsecaea agents of chromoblastomycosis. J. Microbiol. Methods 80:19–24 [DOI] [PubMed] [Google Scholar]
  • 35. Symoens F., et al. 2006. Disseminated Scedosporium apiospermum infection in a cystic fibrosis patient after double-lung transplantation. J. Heart Lung Transplant. 25:603–607 [DOI] [PubMed] [Google Scholar]
  • 36. Tintelnot K., et al. 2009. A review of German Scedosporium prolificans cases from 1993 to 2007. Med. Mycol. 47:351–358 [DOI] [PubMed] [Google Scholar]
  • 37. Williamson E. C., et al. 2001. Molecular epidemiology of Scedosporium apiospermum infection determined by PCR amplification of ribosomal intergenic spacer sequences in patients with chronic lung disease. J. Clin. Microbiol. 39:47–50 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Zhou X., et al. 2008. Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling-circle amplification. J. Clin. Microbiol. 46:2423–2427 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Zouhair R., et al. 2001. Typing of Scedosporium apiospermum by multilocus enzyme electrophoresis and random amplification of polymorphic DNA. J. Med. Microbiol. 50:925–932 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES