Abstract
Between February 2006 and October 2009, 38 patients in different wards at the A Coruña University Hospital (northwest Spain) were either infected with or colonized by an epidemic, multidrug-resistant (MDR), and extended-spectrum-β-lactamase (ESBL)-producing strain of Enterobacter cloacae (EbSF), which was susceptible only to carbapenems. Semiautomated repetitive extragenic palindromic sequence-based PCR (rep-PCR) and pulsed-field gel electrophoresis (PFGE) analysis revealed that all of the E. cloacae isolates belonged to the same clone. Cloning and sequencing enabled the detection of the SFO-1 ESBL in the epidemic strain and the description of its genetic environment. The presence of the ampR gene was detected upstream of blaSFO-1, and two complete sequences of IS26 surrounding ampR and ampA were detected. These IS26 sequences are bordered by complete left and right inverted repeats (IRL and IRR, respectively), which suggested that they were functional. The whole segment flanked by two IS26 copies may be considered a putative large composite transposon. A gene coding for aminoglycoside acetyltransferase (gentamicin resistance gene [aac3]) was found downstream of the 3′ IS26. Despite the implementation of strict infection control measures, strain EbSF spread through different areas of the hospital. A case-control study was performed to assess risk factors for EbSF acquisition. A multivariate analysis revealed that the prior administration of β-lactam antibiotics, chronic renal failure, tracheostomy, and prior hospitalization were statistically associated with SFO-1-producing E. cloacae acquisition. This study describes for the first time an outbreak in which an SFO-1-producing E. cloacae strain was involved. Note that so far, this β-lactamase has previously been isolated in only a single case of E. cloacae infection in Japan.
INTRODUCTION
Antimicrobial resistance is a serious problem that affects patients in hospitals worldwide. The production of extended-spectrum β-lactamases (ESBLs) among members of the Enterobacteriaceae has become one of the most difficult clinical problems in relation to therapeutics and epidemiology (35). ESBLs are plasmid-encoded enzymes that are able to hydrolyze a wide variety of penicillins and cephalosporins (1). These plasmids often carry genes for resistance to other types of antibiotics and code for multidrug resistance phenotypes for which treatment options are limited.
Enterobacter cloacae is an emerging clinical pathogen (36) that causes mainly nosocomial infections in critical patients. The detection of ESBLs in Enterobacter spp. is a problem for clinical microbiology laboratories because the main mechanism of resistance is the overproduction of the chromosomal AmpC β-lactamase (13), which may be hiding the expression of ESBL. Microbiology laboratories should be aware of the advent of ESBLs in AmpC-producing E. cloacae strains and of their potential clinical importance (31).
Large outbreaks caused by ESBL-producing Klebsiella pneumoniae and Escherichia coli strains have been described worldwide (3–5, 24, 26, 43, 44); however, few outbreaks have been reported to be caused by ESBL-producing E. cloacae strains (14, 15, 20, 27, 29). To date, only one outbreak has been described in Spain (20), between July and September 2005, involving seven patients admitted to a cardiothoracic intensive care unit (ICU).
In 2006, a multidrug-resistant (MDR) ESBL-producing E. cloacae strain (EbSF), susceptible only to carbapenems, emerged in the A Coruña University Hospital.
We performed the present study with the aim of analyzing the molecular basis for antibiotic resistance as well as the clinical and molecular epidemiology of ESBL-producing E. cloacae. Furthermore, the risk factors for the acquisition of the epidemic strain and clinical and microbiology factors were also considered.
MATERIALS AND METHODS
Study site, subjects, and variables.
This study was conducted at the A Coruña University Hospital, a 1,200-bed tertiary-level hospital serving a population of 516,000 in northwest Spain. Between February 2006 and October 2009, 38 patients were either infected with or colonized by an epidemic strain called EbSF. For every case patient, EbSF was detected in clinical samples that were taken with the objective to diagnose or exclude an infection.
Study variables included the type of sample from which EbSF was isolated, microbiological cultures used for monitoring of patients, and the type of presentation (infection or colonization). Nosocomial acquisition of infection was defined as an infection that occurred >48 h after admission to the hospital or an infection that occurred <48 h after admission to the hospital if the patient had been hospitalized within the 30 days before admission (12). The criteria for infection were defined in accordance with criteria of the Centers for Disease Control and Prevention (8). Patients who did not meet the criteria for infection were considered to be colonized.
A case-control study was performed to define the risk factors for the acquisition of the ESBL-producing E. cloacae strain. The 24 patients infected with or colonized by EbSF, which had been isolated from clinical samples during 2006 and 2007, were designated cases. The control group included three controls per case patient and per unit. The admission period was at least 2 days and up to 15 days prior to the first isolation of EbSF. The control group consisted of 80 patients, because 3 of the case patients were admitted in two different wards in the previous 15 days of isolation, and in 1 case we could obtain only 2 controls with the inclusion criteria. We did not consider whether the controls had infection criteria, but no ESBL-producing E. cloacae was isolated from any of the control subjects.
A retrospective review of the 24 patients was conducted, and data were recorded. The variables reviewed included demographic characteristics (age and gender), severity of underlying conditions (as indicated by the Charlson comorbidity score [23]), and underlying diseases (gastrointestinal tract disease, diabetes mellitus, solid tumor, cardiovascular disease, chronic pulmonary disease, chronic renal failure, transplantation, and immunodeficiency). Data for the following extrinsic factors were collected for the 30-day period prior to isolation during hospitalization: prior surgery, hospitalization in an intensive care unit, invasive procedures, prior hospitalization (2 years before), and prior antibiotic therapy (defined as antibiotics given for at least 2 days within the 30 days preceding the isolation of the organism). Antibiotic data were grouped into antimicrobial classes for statistical analysis. All case patients were observed until hospital discharge or death.
Control measures taken.
The patients were isolated in single rooms (whenever possible), and standard and contact isolation precautions were strengthened. Contact isolation was stopped when there were three consecutive negative screening cultures (usually rectal swabs and surgical wound cultures if there was one). The screening cultures were performed every 48 h. The roommates were also screened (usually rectal swabs), but these patients were not included in our study, although some of them had positive cultures.
There was an active surveillance program for the detection of ESBL in strains of the Enterobacteriaceae in the hospital before 2006, when EbSF was detected. No E. cloacae cases with isolates belonging to the outbreak genotype were detected before February 2006.
Statistical analysis.
The data were stored and analyzed by using SPSS software, version 15.0 (SPSS Inc., Chicago, IL). The statistical analysis was restricted to cases reported between 2006 and 2007. A univariate analysis was carried out for the determination of variables significantly associated with colonization or infection by EbSF. Quantitative variable differences between case and control patients were compared by using the Student t test. Qualitative variables were analyzed by a chi-square test or Fisher's exact test. A multiple-regression logistic model was developed to identify the potential independent factors associated with colonization and/or infection by EbSF. The multivariate analysis included all variables with a P value of <0.1 in the univariate analysis, and we followed a forward stepwise strategy. Ninety-five-percent confidence intervals (CIs) were calculated as estimators. The results were considered statistically significant at a P value of <0.05.
Bacterial isolates and susceptibility assays.
A total of 38 clinical ESBL-producing E. cloacae strains isolated from 38 patients admitted to the A Coruña University Hospital (Spain) were studied (Table 1). Bacterial identification was performed with a Micro Scan WalkAway instrument (Siemens HealthCare Diagnostics Inc.) according to the manufacturer's instructions. MICs of several antibiotics (Table 2) were determined by Etest (AB Biodisk, Solna, Sweden). Results were interpreted according to the manufacturer's instructions.
Table 1.
Patients from whom SFO-1-producing E. cloacae was isolateda
| Patient (sex/age [yr]) | Date of first isolation (mo/yr) | Hospital ward | Clinical sample(s) | Other sample(s)b | Colonization/infection type | Patient outcome |
|---|---|---|---|---|---|---|
| 1 (F/54) | 02/2006 | RU | Urine | RS, TS, catheter exudate, WE, BAS | UTI | Alive |
| 2 (M/75) | 02/2006 | Cardiac ICU | BAS | PN | Dead | |
| 3 (M/78) | 03/2006 | Cardiac ICU | BAS | Colonization | Dead | |
| 4 (M/68) | 05/2006 | General surgery | Blood | Feces | Bacteremia | Alive |
| 5 (F/80) | 09/2006 | ICU | Urine | Catheter | UTI | Dead |
| 6 (M/22) | 09/2006 | ICU | Urine | AS | UTI | Dead |
| 7 (M/58) | 10/2006 | ICU | BAS | Colonization | Alive | |
| 8 (F/70) | 11/2006 | Nephrology | WE | Colonization | Alive | |
| 9 (F/76) | 12/2006 | ICU | Urine | Catheter, BAS, AS, feces | Colonization | Alive |
| 10 (F/79) | 03/2007 | Cardiac ICU | Urine | UTI | Alive | |
| 11 (M/80) | 04/2007 | Cardiac ICU | Blood | BAS | Bacteremia | Dead |
| 12 (M/59) | 04/2007 | Cardiac ICU | BAS | Feces | Colonization | Alive |
| 13 (F/50) | 05/2007 | Cardiac surgery | WE | WI | Alive | |
| 14 (M/75) | 06/2007 | Internal medicine | Urine | RS, WE | UTI | Dead |
| 15 (M/73) | 06/2007 | Infectious unit | Urine, blood | Feces, AS | UTI and bacteremia, secondary | Dead |
| 16 (M/55) | 07/2007 | ICU | Urine | Feces, BAS | UTI | Dead |
| 17 (M/53) | 08/2007 | Cardiac ICU | Catheter | Feces | Colonization | Alive |
| 18 (M/72) | 08/2007 | Urology | Urine | UTI | Alive | |
| 19 (M/65) | 08/2007 | Cardiac ICU | Urine | TS, AS | UTI | Alive |
| 20 (M/58) | 08/2007 | Spinal cord | WE | WI | Alive | |
| 21 (F/71) | 08/2007 | Cardiac surgery | WE, blood | WI and bacteremia | Dead | |
| 22 (M/61) | 08/2007 | Nephrology | Urine | UTI | Alive | |
| 23 (F/61) | 10/2007 | Nephrology | Urine | Colonization | Alive | |
| 24 (M/37) | 12/2007 | Thoracic surgery | Urine | RS | Colonization | Alive |
| 25 (M/79) | 01/2008 | Infectious unit | WE | WI | Alive | |
| 26 (M/75) | 02/2008 | Nephrology | Urine | RS | UTI | Alive |
| 27 (F/41) | 05/2008 | ICU | WE, urine | Feces, RS | WI | Alive |
| 28 (F/55) | 12/2008 | ICU | BAS | Feces, AS, RS | PN | Dead |
| 29 (M/67) | 01/2009 | Cardiac surgery | BAS | Aspirate transtracheal, RS | Colonization | Alive |
| 30 (F/59) | 01/2009 | Plastic surgery | WE | Colonization | Alive | |
| 31 (M/75) | 02/2009 | Internal medicine | Urine | UTI | Alive | |
| 32 (M/64) | 02/2009 | ICU | Urine | Perineal smear, AS, BAS, RS | UTI | Alive |
| 33 (F/84) | 03/2009 | Vascular surgery | WE | TS, RS | Colonization | Alive |
| 34 (M/47) | 06/2009 | RU | BAS | Colonization | Alive | |
| 35 (F/85) | 08/2009 | Nephrology | Blood | Catheter | Bacteremia | Alive |
| 36 (M/77) | 08/2009 | Internal medicine | Urine | UTI | Alive | |
| 37 (M/66) | 10/2009 | Neurosurgery | Urine | RS | UTI | Alive |
| 38 (M/63) | 10/2009 | Neumology | Sputum | RS, TS | PN | Alive |
RS, rectal swab; TS, throat smear; BAS, bronchial secretion; AS, axillary smear; WE, wound exudate; UTI, urinary tract infection; PN, pneumonia; WI, wound infection; ICU, intensive care unit; RU, resuscitation unit; M, male; F, female.
Samples used as colonization controls for patients as part of control measures.
Table 2.
Susceptibility profile of epidemic SFO-1-producing multiresistant E. cloacae and other bacterial strains used in this study
| Antibioticc | MIC (μg/ml) forb: |
|||
|---|---|---|---|---|
| EbSFa | TG1-pAF-1 | TG1-pAF-2 | E. coli TG1 | |
| AMX | >256 | >256 | >256 | 1 |
| AMC | >256 | 96 | 16 | 2 |
| PIP | >256 | >256 | >256 | 0.5 |
| CTX | >256 | >256 | >256 | 0.064 |
| CTX/CTX + CLA | >16/>1 | >16/0.032 | >16/0.25 | <0.25/<0.016 |
| CAZ | 16 | 0.75 | 12 | 0.125 |
| CAZ/CAZ + CLA | 16/>4 | 0.5/0.125 | 8/0.5 | <0.5/0.064 |
| FEP | >256 | 64 | >256 | 0.25 |
| FEP/FEP + CLA | >16/0.125 | >16/<0.064 | >16/0.064 | 0.25/<0.064 |
| ATM | >256 | 8 | >256 | 0.094 |
| IPM | 0.5 | 0.25 | 0.25 | 0.25 |
| GEN | >256 | >256 | >256 | 0.064 |
| TOB | >256 | >256 | 4 | 0.125 |
| AMK | >256 | >256 | 0.5 | 0.125 |
| CIP | >32 | 0.032 | 0.016 | 0.016 |
| SXT | >32 | 0.016 | 0.012 | 0.012 |
| TIG | 2 | 2 | 0.25 | 0.25 |
For EbSF, isolate 8 was used as model for the study of the epidemic SFO-1-producing E. cloacae strain.
TG1-pAF-1, E. coli TG1 with clinical plasmid pAF-1 harbored by EbSF; TG1-pAF-2, E. coli TG1 with plasmid pAF-2 derived from pAF-1.
AMX, amoxicillin; AMC, amoxicillin-clavulanic acid; PIP, piperacillin; CTX, cefotaxime; CLA, clavulanic acid; CAZ, ceftazidime; FEP, cefepime; ATM, aztreonam; IPM, imipenem; GEN, gentamicin; TOB, tobramycin; AMK, amikacin; CIP, ciprofloxacin; SXT, trimethoprim-sulfamethoxazole; TIG, tigecycline.
The strains were grown on MacConkey agar plates (BD, NJ) or Luria-Bertani (LB) broth and agar when required. Escherichia coli strain TG1 was used for cloning procedures.
Molecular typing. (i) PFGE.
For pulsed-field gel electrophoresis (PFGE) analysis, genomic DNA from E. cloacae was digested with XbaI (Promega Corporation, Madison, WI) according to standard procedures (10) and the interpretation criteria described previously by Tenover (38). Salmonella enterica serovar Braenderup and a non-ESBL-producing E. cloacae strain were used as controls.
(ii) DiversiLab microbial typing system.
The DiversiLab Enterobacter DNA fingerprinting kit (bioMérieux, France) was used for repetitive extragenic palindromic sequence-based PCR (rep-PCR) amplification of noncoding intergenic repetitive elements in the genomic DNA of 36 E. cloacae strains according to the manufacturer's instructions. The amplicons were analyzed with DiversiLab analysis software (bioMérieux, France) as previously described (39).
E. cloacae ATCC 13847 and two epidemiologically unrelated E. cloacae isolates were included as nonrelated strain controls. The strains were typed in duplicate, with consistent reproducibility.
β-Lactamase characterization.
A preliminary characterization of β-lactamases and their genes was performed by isoelectric focusing (IEF) (21) and PCR assays, respectively. PCRs were performed for families of ESBLs commonly isolated in the hospital (CTX-M group 1, CTX-M group 9, and SHV-12). The primers are described in Table 3. Since no amplicon was obtained, characterization of the β-lactamase gene was performed by cloning procedures.
Table 3.
Oligonucleotides used in this study
| Amplicon | Product size (bp) | Primer (5′–3′) |
|
|---|---|---|---|
| Forward | Reverse | ||
| CTX-M group 1 | 840 | ATGGCGACGGCAACCGTCA | CAAACCGTTGGTGACGATTTTA |
| CTX-M group 9 | 876 | ATGGTGACAAAGAGAGTGC | TTACAGCCCTTCGGCGATG |
| SHV-12 | 147 | GCCGCCATTACCATGAG | AAGCGCCTCATTCAGTTCCG |
| TEM-1 | 551 | TAATTGTTGCCGGGAAG | CCAACTGATCTTCAGCA |
| AmpR-AmpA | 1,878 | TCTGCCGCTTCTTTCAG | GCCCTTCGGTGACAATTTTA |
| IS26A-SFO1 | 2,670 | CTTCTCCAACCCTGACCAGCG | CGCCGTGTTGTCACTGTACT |
| SFO1-IS26B | 2,270 | CATTCCCAGCGATAAGCG | CAGTGCCAGTCGGCCC |
Cloning procedures.
Cloning experiments and nucleotide sequencing were done as previously reported (6).
The plasmidic constructions were sequenced in order to analyze the bla genes and their genetic environments.
The BLAST program at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov) was used to identify the sequences.
Nucleotide sequence accession number.
The nucleotide sequence data for the partial insert of the TG1-pAF2 clone were submitted to the GenBank nucleotide sequence database and assigned accession number FJ848785.
RESULTS
Descriptive clinical study.
During the study period, EbSF was isolated from clinical samples from 38 different patients. Some clinical and epidemiological characteristics of the patients are shown in Table 1. Infection developed in 26 patients (68.4%), most frequently urinary tract infections (54%). At the time of strain isolation, 17 patients were in an intensive care unit (ICU), 12 were in medical wards, and 8 were in surgical wards. The remaining patient was an outpatient who had been hospitalized 9 days earlier in a medical ward. It is remarkable that in all cases the strain was nosocomially acquired.
The isolates were recovered mainly from urine (19 out of 38 patients) and less frequently from other samples (Table 1). In some cases, isolates were recovered from >1 sample from the same patient.
The total mortality was 26% (10 patients), but the deaths were not related directly to infection or colonization by EbSF, or this fact was not reflected in the medical records.
Antimicrobial susceptibility.
The isolates were characterized by high levels of resistance to different families of antibiotics, β-lactams (with the exception of carbapenems), quinolones, aminoglycosides, and cotrimoxazole (trimethoprim-sulfamethoxazole), according to Clinical and Laboratory Standards Institute (CLSI) guidelines (Table 2). In the absence of breakpoints by the CLSI, interpretation for tigecycline (MIC = 2) was performed on the basis of European Committee on Susceptibility (EUCAST) guidelines, and EbSF was categorized as exhibiting intermediate resistance to tigecycline. These results showed that the isolates were MDR. All isolates displayed the same susceptibility pattern. To clarify the mechanism of resistance to β-lactams, isolates were tested by Etest ESBL strips (cefotaxime [CTX]/CTX plus clavulanic acid [CLA], ceftazidime [CAZ]/CAZ plus CLA, and cefepime [FEP]/FEP plus CLA) (Table 2). The cefepime MIC decreased in the presence of clavulanic acid, thus suggesting the presence of an ESBL in these bacterial isolates.
Clonal relatedness.
Of the 38 isolates involved in the outbreak, 36 were available for molecular analysis by rep-PCR. All isolates were considered genetically similar (similarity coefficient of >95%); some of the 36 strains (n = 25) were also studied by PFGE, with identical results and closely related isolates appearing within the same cluster. Only genotypically unrelated E. cloacae isolates (ATCC 13874 and two unrelated clinical E. cloacae strains) yielded a different DNA band profile (data not shown). Rep-PCR was previously used to study the epidemiology of E. cloacae isolates in an outbreak in northwest Spain (39).
The results of the genotyping and the phenotype analysis suggested that the 36 E. cloacae isolates studied probably emerged from the same clone by genetic clonal spread, which enabled us to continue the study with only one strain, from case 8 of the outbreak (EbSF).
Characterization of β-lactamases.
All clinical isolates produced 2 β-lactamases, with isoelectric points of 5.4 and 7.3, which were later identified by sequencing and cloning procedures as being TEM-1 and SFO-1, respectively.
EbSF harbored a plasmid with a size ca. of 60 kbp (pAF-1), which was used to transform E. coli strain TG1, obtaining TG1-pAF1, which displayed an ESBL phenotype and resistance to aminoglycosides and tigecycline (Table 2).
Plasmid pAF-1 was used to clone the ESBL gene. After the selection of transformants, an E. coli TG1 transformant harboring a plasmid with a DNA insert of ca. 24 kbp was obtained (pAF-2), which displayed the same ESBL phenotype. At the end, approximately 10 kbp of the insert was sequenced (Fig. 1), and an SFO-1 ESBL gene was identified (also named ampA). The sequencing of nucleotides also revealed the presence of the ampR gene upstream of blaSFO-1. The genetic environment of the bla gene was sequenced, and two sequences of IS26 surrounding ampR and ampA, showing complete right inverted repeat (IRR) and left inverted repeat (IRL) features, were found. The IRs are inverted repeat sequences found to the right and left of some genes that can be targets for the transposition events. The whole segment flanked by two IS26 copies may be considered a putative large composite transposon (9). Further sequencing revealed the presence of a tniA transposase upstream of the 5′ IS26 and genes involved in mercury resistance (merA, merD, merE, and urf2). A gene coding for aminoglycoside acetyltransferase (gentamicin resistance gene [aac3]) was found downstream of the 3′ IS26 (Fig. 1).
Fig. 1.
Schematic map of the genetic environment surrounding the SFO-1 (ampA) gene and its upstream regulator (ampR) (9,785 bp). Open reading frames and genes are shown as arrows indicating the orientation of each coding sequence, and the gene name is shown over the corresponding box. IRL and IRR motifs of IS26 are indicated by asterisks.
PCR assays for all clinical isolates demonstrated the presence of SFO-1 and its genetic environment in the 38 E. cloacae strains, as expected (data not shown).
Risk factors associated with infection or colonization by EbSF (the epidemic ESBL-producing E. cloacae multidrug-resistant strain).
A case-control study was conducted to identify the risk factors associated with infection or colonization by the MDR ESBL-producing E. cloacae strain. Twenty-four case patients (patients colonized or infected between 2006 and 2007) were compared with 80 control patients in a retrospective study. The results of the comparison between case and control patients by univariate analysis are shown in Table 4. Demographic characteristics and comorbidity were compared between case and control patients, and no significant differences were found.
Table 4.
Univariate analysis of factors associated with colonization or infection with SFO-1-producing E. cloacaea
| Parameter | Value for group |
Matched OR (95% CI) | P value | |
|---|---|---|---|---|
| Cases (n = 24) | Controls (n = 80) | |||
| Demographics | ||||
| Mean age (yr) ± SD | 64.22 ± 14.23 | 59.47 ± 18.27 | NS | |
| No. (%) of male patients | 16 (66.7) | 53 (66.2) | NS | |
| Underlying disease | ||||
| Mean Charlson score ± SD | 5.08 ± 1.99 | 4.70 ± 2.76 | NS | |
| No. (%) of patients with: | ||||
| Diabetes mellitus | 7 (29.2) | 22 (27.5) | 1.09 (0.40–2.97) | NS |
| Solid tumor | 2 (8.3) | 13 (16.2) | 0.47 (0.10–2.24) | NS |
| Gastrointestinal tract disease | 6 (25) | 21 (26.6) | 0.92 (0.32–2.63) | NS |
| Cardiovascular disease | 13 (54.2) | 43 (53.8) | 1.02 (0.41–2.54) | NS |
| Genitourinary tract disease | 10 (41.7) | 19 (23.8) | 2.29 (0.88–5.99) | 0.086 |
| Chronic pulmonary disease | 3 (12.5) | 9 (11.2) | 1.13 (0.28–4.54) | NS |
| Chronic renal failure | 12 (50) | 18 (22.5) | 3.44 (1.32–8.97) | 0.009 |
| Immunodeficiency | 2 (8.3) | 4 (5) | 1.73 (0.30–10.06) | NS |
| Transplantation | 3 (12.5) | 10 (12.5) | 1 (0.26–3.97) | NS |
| No. (%) of patients with risk factor | ||||
| Prior treatment with antibiotics | 20 (87) | 56 (70) | 2.86 (0.77–10.53) | NS |
| Admission to ICU | 7 (30.4) | 24 (30) | 1.02 (0.37–2.80) | NS |
| Admission to ICU, coronary | 8 (34.8) | 28 (35) | 0.99 (0.37–2.62) | NS |
| Recent surgery | 16 (66.7) | 45 (56.2) | 1.56 (0.60–4.05) | NS |
| Central venous catheter | 20 (83.3) | 47 (59.5) | 3.40 (1.06–10.90) | 0.032 |
| Intravascular catheter | 21 (87.5) | 72 (92.3) | 0.58 (0.13–2.53) | NS |
| Urinary catheter | 21 (87.5) | 49 (62.8) | 4.14 (1.14–15.11) | 0.023 |
| Mechanical ventilation | 11 (45.8) | 22 (27.8) | 2.19 (0.85–5.62) | 0.098 |
| Prior hospitalization | 18 (75) | 42 (52.5) | 2.71 (0.98–7.55) | 0.05 |
| Nasogastric tube | 11 (47.8) | 32 (40.5) | 1.35 (0.53–3.42) | NS |
| Parenteral nutrition | 8 (34.8) | 14 (17.5) | 2.54 (0.89–7.07) | 0.075 |
| Thoracic drainage | 9 (37.5) | 24 (30.0) | 1.40 (0.54–3.64) | NS |
| Tracheostomy | 4 (17.4) | 3 (3.8) | 5.40 (1.11–26.20) | 0.022 |
| Treatment with steroids | 6 (33.3) | 23 (29.5) | 1.20 (0.50–3.18) | NS |
| Prior infection | 13 (54.2) | 32 (40) | 1.77 (0.70–4.44) | NS |
| No. (%) of patients with antimicrobial history of: | ||||
| Penicillins, AMC, PIP | 16 (66.7) | 31 (28.8) | 3.16 (1.21–8.26) | 0.016 |
| Narrow-spectrum CPs | 1 (4.2) | 4 (5) | 0.83 (0.09–7.76) | NS |
| Expanded-spectrum CPs | 3 (12.57) | 7 (8.8) | 1.49 (0.35–6.27) | NS |
| Carbapenems | 1 (4.2) | 13 (16.2) | 0.22 (0.3–1.81) | NS |
| Aminoglycosides | 7 (29.2) | 11 (13.8) | 2.58 (0.87–7.65) | 0.08 |
| Quinolones | 9 (37.5) | 13 (16.2) | 3.09 (1.12–8.56) | 0.025 |
| Glycopeptides | 5 (20.8) | 16 (20) | 1.05 (0.34–3.25) | NS |
| Linezolid | 2 (8.3) | 3 (3.8) | 2.33 (0.37–14.85) | NS |
Note that data are percentages of patients or mean values ± standard deviations. Significance was determined by a Student's t test for quantitative variables and a chi-square test or Fisher's exact test for qualitative variables. OR, odds ratio; CI, confidence interval; NS, not significant; PIP, piperacillin; CPs, cephalosporins.
The following factors were associated with infection with or colonization by the epidemic strain: chronic renal failure, the presence of a central venous catheter, urinary catheterization, prior hospitalization, and tracheostomy. Prior administration of β-lactam antibiotics and quinolones was also more frequent in the infected/colonized group.
Multivariable analysis revealed that the factors independently associated with EbSF infection or colonization were chronic renal failure (odds ratio [OR], 4.85; 95% CI, 1.46 to 16.08), tracheostomy (OR, 7.67; 95% CI, 1.10 to 53.39), and prior hospitalization (OR, 3.90; 95% CI, 1.03 to 14.75). Regarding antibiotics, the prior administration of a β-lactam antibiotic (ampicillin, cloxacillin, amoxicillin-clavulanic acid [AMC], and piperacillin [PIP]) was a significant factor in case patients (OR, 4.24; 95% CI, 1.29 to 13.90) (Table 5).
Table 5.
Multivariate analysis of risk factors associated with the isolation of the SFO-1-producing E. cloacae strain
| Risk factor | Adjusted OR (95% CI) | P value |
|---|---|---|
| Chronic renal failure | 4.85 (1.46–16.08) | 0.010 |
| Tracheostomy | 7.67 (1.10–53.39) | 0.040 |
| Prior hospitalization | 3.90 (1.03–14.75) | 0.045 |
| Prior administration of β-lactam | 4.24 (1.29–13.90) | 0.017 |
DISCUSSION
The present study is the first report of a clonal outbreak of infection caused by an MDR E. cloacae strain carrying the SFO-1 β-lactamase. This is also the first report of the SFO-1 β-lactamase in Europe, since this β-lactamase has been described previously only for a single sample from Japan (22).
This is the first description of an SFO-1-producing E. cloacae strain causing epidemiological problems. Documenting of risk factors and identification of vulnerable patient groups are important parts of the management and control of health care-associated infections. We used a case-control study to identify the risk factors associated with the acquisition of ESBL-producing E. cloacae strains. The multivariate analysis revealed that the prior administration of β-lactam antibiotics, tracheostomy, prior hospitalization, and chronic renal failure were statistically associated with SFO-1-producing E. cloacae acquisition. Most of these risk factors were previously described in the literature (17, 19, 28, 40–42). For patients with chronic renal failure, urinary tract pathology is increased, so chronic renal failure may indirectly favor urinary tract infection or colonization by EbSF as an important risk factor.
The options for treating these patients were extremely limited. The drugs of choice are carbapenems (mainly imipenem), although their overuse is cause for concern (35). Also, tigecycline has shown good activity against ESBL-producing Enterobacter spp. (16). However, in this case it cannot be used as an alternative to carbapenems, as EbSF strains showed a tigecycline MIC of 2 μg/ml (resistant according to EUCAST criteria).
The detection of the ESBL phenotype with the cefepime-clavulanate ESBL Etest is more sensitive than others used for E. coli and Klebsiella species, because cefepime is a poor substrate for the AmpC β-lactamases that are produced by Enterobacter species (18). It is very important to remember this special feature in the detection of the ESBL phenotype in Enterobacter species to achieve good practice in microbiology laboratories. The underdetection and underreporting of the spread of ESBL-producing E. cloacae isolates may be causing an incorrectly low incidence. The detection of ESBLs in clinical isolates of E. cloacae also has important clinical implications, because it influences clinical decisions regarding appropriate therapy and also determines infection control measures, such as patient contact isolation.
Cloning procedures showed that the pattern of resistance to β-lactams, tigecycline, and aminoglycosides of the EbSF strains was plasmid encoded (Table 2). This may facilitate spread by horizontal transmission to other enterobacteria, although this hypothesis has not been tested.
SFO-1 is an infrequently isolated β-lactamase, and its genetic environment has never been determined. Interestingly, SFO-1 is flanked by the full insertion element IS26 with both sites (IRR and IRL), which may allow the β-lactamase to spread itself as an autonomous transposable element. IS26 is usually associated with antibiotic resistance genes and may be involved in dissemination via several routes, including the translocation of resistance genes located in the chromosome (7, 25).
The large number of patients involved, 38 patients, was an important factor for the study of the epidemiology of SFO-1-producing E. cloacae, as few reports of E. cloacae causing outbreaks have been reported in the medical literature. The study of clonal relatedness by rep-PCR and PFGE patterns showed that all isolates were genotypically related and probably had originated from the same clone. The PFGE and rep-PCR results and the same antibiotic pattern of multidrug resistance for all E. cloacae isolates provided further evidence for epidemic spread. PFGE is considered the “gold standard” for the typing of medically important bacteria and identification of different clusters or clones (37). The correlation between PFGE and rep-PCR systems was previously demonstrated for E. coli (33) and other members of the Enterobacteriaceae (11), but a similar study has never been reported for E. cloacae. The advantages and the usefulness of rep-PCR were clearly demonstrated in previous studies (11, 33).
This work provides some data on the unknown epidemiology of ESBL-producing E. cloacae strains. The epidemiology of this microorganism is very similar to that of K. pneumoniae, since this microorganism is mainly nosocomially acquired (none of the cases were community acquired), and the isolates are usually clonally related (24).
With regard to the modes of transmission of EbSF strains, the most likely explanation was that they were transmitted from one person to another via the hands of health care personnel. Throughout the study, the presence of colonized patients probably favored the endemic spread of the strain. Many of the patients involved were highly colonized and presented rectal, nasal, and axillary samples that were positive for the epidemic strain (Table 1). The rates of colonization with ESBL-producing E. cloacae are now increasing significantly, as shown by a study from Chicago between 2000 and 2005 (34). Clearly, patients colonized with ESBL-producing E. cloacae strains have an increased risk of developing infection.
The presence of EbSF strains was maintained during a long period, and as some cases still appear, the strain may be endemic in the population. It is very important to monitor emerging infection and/or colonization by ESBL-producing E. cloacae strains in all hospitals, to attempt to identify the mechanism of resistance in clinical microbiology laboratories, and to take strict epidemiological control measures from the beginning to avoid endemicity, because the control of endemic ESBL producers is very difficult (2, 30, 32).
The data presented here confirm that ESBL-producing E. cloacae is emerging as a nosocomial pathogen and demonstrate the epidemic potential of this strain. The emergence of multidrug resistance among nosocomial pathogens such as E. cloacae has important implications for the future ability to treat these infections because of the further limitation of available antibiotic agents.
In summary, an MDR epidemic E. cloacae strain (susceptible only to carbapenems) expressing the unusual SFO-1 ESBL is described for the first time in Europe (Spain) in the context of a hospital outbreak and affecting a large number of patients.
ACKNOWLEDGMENTS
This work was supported by REIPI (Spanish Network for Research in Infectious Diseases), Instituto de Salud Carlos III, Ministerio de Ciencia e Innovación, and A.F. is the receipt of a research support contract (Rio Hortega) from Instituto de Salud Carlos III, Ministerio de Ciencia e Innovación. This work was also funded by FIS grants PI081613, PS09/00687, and PS07/90 and grant 08CSA064916PR from Xunta de Galicia.
Footnotes
Published ahead of print on 12 January 2011.
REFERENCES
- 1. Bradford P. A. 2001. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14:933–951 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Canton R., Coque T. M., Baquero F. 2003. Multi-resistant Gram-negative bacilli: from epidemics to endemics. Curr. Opin. Infect. Dis. 16:315–325 [DOI] [PubMed] [Google Scholar]
- 3. Carrer A., et al. 2009. Outbreak of CTX-M-15-producing Klebsiella pneumoniae in the intensive care unit of a French hospital. Microb. Drug Resist. 15:47–54 [DOI] [PubMed] [Google Scholar]
- 4. Conte M. P., et al. 2005. Extended spectrum beta-lactamase-producing Klebsiella pneumoniae outbreaks during a third generation cephalosporin restriction policy. J. Chemother. 17:66–73 [DOI] [PubMed] [Google Scholar]
- 5. Fang H., et al. 2004. Molecular epidemiological analysis of Escherichia coli isolates producing extended-spectrum beta-lactamases for identification of nosocomial outbreaks in Stockholm, Sweden. J. Clin. Microbiol. 42:5917–5920 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Fernandez A., et al. 2007. Interspecies spread of CTX-M-32 extended-spectrum beta-lactamase and the role of the insertion sequence IS1 in down-regulating bla CTX-M gene expression. J. Antimicrob. Chemother. 59:841–847 [DOI] [PubMed] [Google Scholar]
- 7. Ford P. J., Avison M. B. 2004. Evolutionary mapping of the SHV beta-lactamase and evidence for two separate IS26-dependent blaSHV mobilization events from the Klebsiella pneumoniae chromosome. J. Antimicrob. Chemother. 54:69–75 [DOI] [PubMed] [Google Scholar]
- 8. Garner J. S., Jarvis W. R., Emori T. G., Horan T. C., Hughes J. M. 1988. CDC definitions for nosocomial infections, 1988. Am. J. Infect. Control 16:128–140 [DOI] [PubMed] [Google Scholar]
- 9. Golebiewski M., et al. 2007. Complete nucleotide sequence of the pCTX-M3 plasmid and its involvement in spread of the extended-spectrum beta-lactamase gene blaCTX-M-3. Antimicrob. Agents Chemother. 51:3789–3795 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Gouby A., et al. 1994. Epidemiological study by pulsed-field gel electrophoresis of an outbreak of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a geriatric hospital. J. Clin. Microbiol. 32:301–305 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Grisold A. J., et al. Use of automated repetitive-sequence-based PCR for rapid laboratory confirmation of nosocomial outbreaks. J. Infect. 60:44–51 [DOI] [PubMed] [Google Scholar]
- 12. Hyle E. P., et al. 2005. Risk factors for increasing multidrug resistance among extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella species. Clin. Infect. Dis. 40:1317–1324 [DOI] [PubMed] [Google Scholar]
- 13. Jacoby G. A. 2009. AmpC beta-lactamases. Clin. Microbiol. Rev. 22:161–182 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Jiang X., et al. 2005. Outbreak of infection caused by Enterobacter cloacae producing the novel VEB-3 beta-lactamase in China. J. Clin. Microbiol. 43:826–831 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Kartali G., et al. 2002. Outbreak of infections caused by Enterobacter cloacae producing the integron-associated beta-lactamase IBC-1 in a neonatal intensive care unit of a Greek hospital. Antimicrob. Agents Chemother. 46:1577–1580 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Kelesidis T., Karageorgopoulos D. E., Kelesidis I., Falagas M. E. 2008. Tigecycline for the treatment of multidrug-resistant Enterobacteriaceae: a systematic review of the evidence from microbiological and clinical studies. J. Antimicrob. Chemother. 62:895–904 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kim Y. K., et al. 2002. Bloodstream infections by extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in children: epidemiology and clinical outcome. Antimicrob. Agents Chemother. 46:1481–1491 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Lee C. C., et al. 2010. Bacteremia due to extended-spectrum-beta-lactamase-producing Enterobacter cloacae: role of carbapenem therapy. Antimicrob. Agents Chemother. 54:3551–3556 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Lin M. F., Huang M. L., Lai S. H. 2003. Risk factors in the acquisition of extended-spectrum beta-lactamase Klebsiella pneumoniae: a case-control study in a district teaching hospital in Taiwan. J. Hosp. Infect. 53:39–45 [DOI] [PubMed] [Google Scholar]
- 20. Manzur A., et al. 2007. Nosocomial outbreak due to extended-spectrum-beta-lactamase-producing Enterobacter cloacae in a cardiothoracic intensive care unit. J. Clin. Microbiol. 45:2365–2369 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Mathew A., Harris A. M., Marshall M. J., Ross G. W. 1975. The use of analytical isoelectric focusing for detection and identification of beta-lactamases. J. Gen. Microbiol. 88:169–178 [DOI] [PubMed] [Google Scholar]
- 22. Matsumoto Y., Inoue M. 1999. Characterization of SFO-1, a plasmid-mediated inducible class A beta-lactamase from Enterobacter cloacae. Antimicrob. Agents Chemother. 43:307–313 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. McGregor J. C., et al. 2005. Utility of the chronic disease score and Charlson comorbidity index as comorbidity measures for use in epidemiologic studies of antibiotic-resistant organisms. Am. J. Epidemiol. 161:483–493 [DOI] [PubMed] [Google Scholar]
- 24. Mena A., et al. 2006. Characterization of a large outbreak by CTX-M-1-producing Klebsiella pneumoniae and mechanisms leading to in vivo carbapenem resistance development. J. Clin. Microbiol. 44:2831–2837 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Miriagou V., Carattoli A., Tzelepi E., Villa L., Tzouvelekis L. S. 2005. IS26-associated In4-type integrons forming multiresistance loci in enterobacterial plasmids. Antimicrob. Agents Chemother. 49:3541–3543 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Moissenet D., et al. 2010. Meningitis caused by Escherichia coli producing TEM-52 extended-spectrum beta-lactamase within an extensive outbreak in a neonatal ward: epidemiological investigation and characterization of the strain. J. Clin. Microbiol. 48:2459–2463 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Moriguchi N., et al. 2007. Outbreak of CTX-M-3-type extended-spectrum beta-lactamase-producing Enterobacter cloacae in a pediatric ward. J. Infect. Chemother. 13:263–266 [DOI] [PubMed] [Google Scholar]
- 28. Ortega M., et al. 2009. Analysis of 4758 Escherichia coli bacteraemia episodes: predictive factors for isolation of an antibiotic-resistant strain and their impact on the outcome. J. Antimicrob. Chemother. 63:568–574 [DOI] [PubMed] [Google Scholar]
- 29. Paauw A., Fluit A. C., Verhoef J., Leverstein-van Hall M. A. 2006. Enterobacter cloacae outbreak and emergence of quinolone resistance gene in Dutch hospital. Emerg. Infect. Dis. 12:807–812 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Paauw A., et al. 2007. Failure to control an outbreak of qnrA1-positive multidrug-resistant Enterobacter cloacae infection despite adequate implementation of recommended infection control measures. J. Clin. Microbiol. 45:1420–1425 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Paterson D. L. 2006. Resistance in Gram-negative bacteria: Enterobacteriaceae. Am. J. Infect. Control 34:S20–S28, S64–S73 [DOI] [PubMed] [Google Scholar]
- 32. Paterson D. L., et al. 2001. Control of an outbreak of infection due to extended-spectrum beta-lactamase-producing Escherichia coli in a liver transplantation unit. Clin. Infect. Dis. 33:126–128 [DOI] [PubMed] [Google Scholar]
- 33. Pitout J. D., et al. 2009. Using a commercial DiversiLab semiautomated repetitive sequence-based PCR typing technique for identification of Escherichia coli clone ST131 producing CTX-M-15. J. Clin. Microbiol. 47:1212–1215 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Reddy P., et al. 2007. Screening for extended-spectrum beta-lactamase-producing Enterobacteriaceae among high-risk patients and rates of subsequent bacteremia. Clin. Infect. Dis. 45:846–852 [DOI] [PubMed] [Google Scholar]
- 35. Rodriguez-Bano J., Pascual A. 2008. Clinical significance of extended-spectrum beta-lactamases. Expert Rev. Anti Infect. Ther. 6:671–683 [DOI] [PubMed] [Google Scholar]
- 36. Sanders W. E., Jr., Sanders C. C. 1997. Enterobacter spp.: pathogens poised to flourish at the turn of the century. Clin. Microbiol. Rev. 10:220–241 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Tenover F. C. 2007. Rapid detection and identification of bacterial pathogens using novel molecular technologies: infection control and beyond. Clin. Infect. Dis. 44:418–423 [DOI] [PubMed] [Google Scholar]
- 38. Tenover F. C., et al. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233–2239 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Trevino M., Moldes L., Martinez-Lamas L., Varon C., Regueiro B. J. 2009. Carbapenem-resistant Enterobacter cloacae and the emergence of metallo-beta-lactamase-producing strains in a third-level hospital (Santiago de Compostela, NW Spain). Eur. J. Clin. Microbiol. Infect. Dis. 28:1253–1258 [DOI] [PubMed] [Google Scholar]
- 40. Tumbarello M., et al. 2004. ESBL-producing multidrug-resistant Providencia stuartii infections in a university hospital. J. Antimicrob. Chemother. 53:277–282 [DOI] [PubMed] [Google Scholar]
- 41. Tumbarello M., et al. 2008. Bloodstream infections caused by extended-spectrum-beta-lactamase-producing Escherichia coli: risk factors for inadequate initial antimicrobial therapy. Antimicrob. Agents Chemother. 52:3244–3252 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Tumbarello M., et al. 2006. Bloodstream infections caused by extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae: risk factors, molecular epidemiology, and clinical outcome. Antimicrob. Agents Chemother. 50:498–504 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Velasco C., et al. 2009. Eradication of an extensive outbreak in a neonatal unit caused by two sequential Klebsiella pneumoniae clones harbouring related plasmids encoding an extended-spectrum beta-lactamase. J. Hosp. Infect. 73:157–163 [DOI] [PubMed] [Google Scholar]
- 44. Vranic-Ladavac M., et al. 2010. Clonal spread of CTX-M-15-producing Klebsiella pneumoniae in a Croatian hospital. J. Med. Microbiol. 59:1069–1078 [DOI] [PubMed] [Google Scholar]