Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2011 Feb 10;286(14):11997–12005. doi: 10.1074/jbc.M110.195446

The Proximal Hydrogen Bond Network Modulates Bacillus subtilis Nitric-oxide Synthase Electronic and Structural Properties

Albane Brunel 1, Adjélé Wilson 1, Laura Henry 1, Pierre Dorlet 1, Jérôme Santolini 1,1
PMCID: PMC3069402  PMID: 21310962

Abstract

Bacterial nitric-oxide synthase (NOS)-like proteins are believed to be genuine NOSs. As for cytochromes P450 (CYPs), NOS-proximal ligand is a thiolate that exerts a push effect crucial for the process of dioxygen activation. Unlike CYPs, this catalytic electron donation seems controlled by a hydrogen bond (H-bond) interaction between the thiolate ligand and a vicinal tryptophan. Variations of the strength of this H-bond could provide a direct way to tune the stability along with the electronic and structural properties of NOS. We generated five different mutations of bsNOS Trp66, which can modulate this proximal H-bond. We investigated the effects of these mutations on different NOS complexes (FeIII, FeIICO, and FeIINO), using a combination of UV-visible absorption, EPR, FTIR, and resonance Raman spectroscopies. Our results indicate that (i) the proximal H-bond modulation can selectively decrease or increase the electron donating properties of the proximal thiolate, (ii) this modulation controls the σ-competition between distal and proximal ligands, (iii) this H-bond controls the stability of various NOS intermediates, and (iv) a fine tuning of the electron donation by the proximal ligand is required to allow at the same time oxygen activation and to prevent uncoupling reactions.

Keywords: Biophysics, Electron Paramagnetic Resonance (EPR), Metalloproteins, Nitric-oxide Synthase, Oxidative Stress, Raman Spectroscopy, Molecular Mechanism

Introduction

Nitrogen monoxide (NO) is a well described radical molecule (1) that has been shown to exert major physiological functions in mammals, ranging from signaling processes to cytotoxic activities (25). It is exclusively synthesized by a family of enzymes named nitric-oxide synthases (NOSs)2 that have been cloned and characterized in the early 1990s (69). With the emergence of efficient DNA sequencing techniques, the accessibility of an increasing number of genomes led to an unprecedented quest for new NOSs in other organisms. Although no NOSs have been found so far in plants and yeasts (10, 11), random BLAST analyses of several bacterial genomes led to the discovery of new NOS-like proteins, mostly in Gram-positive bacteria (12). These proteins correspond to the partially truncated oxygenase domain of mammalian NOSs (mNOSs). Because of the dominant structure-function approach, the first works on bacterial NOS-like proteins (bacNOSs) aimed at highlighting the similarities between mammalian and bacterial NOSs. Indeed, the crystallographic structures of NOSs from Bacillus subtilis (bsNOS (13)), Staphylococcus aureus (saNOS (14)), or Geobacillus stearothermophilus (15) were perfectly superimposable to the three-dimensional structure of mNOSs with the exception of a portion of the N-terminal region involved in BH4 binding and in the formation of the zinc-tetrathiolate complex (12). In addition, the first enzymological experiments suggested that bacNOSs, similarly to mNOSs, had the capacity to catalyze oxygen activation and to metabolize l-Arg, the natural substrate of mNOSs, into citrulline and NO (16, 17). However, despite such an assignment of bacNOSs as genuine NO synthases, their in vivo function has been poorly investigated and remains a matter of debate. The first investigations on the biological function of bacNOSs suggested a contribution to the biosynthesis of a phytotoxin (thaxtomin A) of Streptomyces turgidiscabies, presumably via the nitration of a Trp-like residue on a diketopiperazine precursor (18, 19). This metabolic role seemed to extend to the Deinococcus radiodurans NOS, which seemed able to associate with the tryptophanyl-tRNA synthetase and to nitrate Trp amino acids (20, 21). Following different hypotheses, Nudler and colleagues (2224) proposed that bacNOSs could intervene in a series of functions related to host-pathogen interaction such as protection against oxidative stress (22), pathogen survival and virulence (23), or defense against antibiotics (24). Recently, Crane suggested that D. radiodurans NOS could intervene in the recovery processes of bacteria subject to a UV stress (25). Because NO production is primarily used by the host as a bactericidal weapon, we feel that NO is not the most appropriate molecule to elicit a concerted response against the host immune system. In fact, our recent data suggest that bsNOS is more likely to intervene in NO and peroxynitrite detoxification (26). This raises the following question about the in vivo enzymatic activity of bacNOSs. Are they genuine nitric-oxide synthases?

In comparison with mNOSs, the catalytic mechanism of bacNOSs has not been intensely investigated, but the results obtained so far stress numerous differences between mNOSs and bacNOSs. On top of them, bacNOSs are lacking an effective electron donor. The absence of a dedicated reductase partner (27) should prevent an efficient first electron transfer, although flavodoxins have been reported to support bsNOS-mediated NO production (28). No strong evidence has been reported so far for the implication of a pterin in the second fast electron transfer. The natural pterin is presumably not synthesized by these bacteria, and although BH4 and tetrahydrofolate increase the rate of decay of the FeIIO2 complex of several bacNOSs (16, 29, 30), no pterin radical has been identified in bacNOSs catalysis so far. Another problematic issue is the NO dissociation rate of the bsNOS FeIIINO complex. Indeed, the Val → Ile substitution observed in the bacNOSs heme pocket seems to impede a fast NO release (30), which is mandatory for NO synthesis (31, 32). Indeed, the Val → Ile mutation dramatically diminishes NO production by inducible NOS (iNOS) and converts iNOS into a NO dioxygenase (33). Similarly, the isomerization of peroxynitrite by bsNOS, in contrast with iNOS-mediated peroxynitrite activation, might reflect modification of the heme distal pocket that leads to a transient capture of NO or any other reactive nitrogen species within the catalytic site, which in turn could lead to additional chemical reactions. Considering these points, one could legitimately question the role of bacNOSs as authentic NO-releasing oxygenase enzymes.

In this regard, mNOSs catalysis is highly related to the oxygen activation mechanism described for cytochromes P450 (3437). It is characterized by two synergetic processes that allow the O–O bond cleavage, namely the “push-pull” effects (38). The pull effect engages the distal H-bond network that mediates the two proton transfers required for oxygen activation and, for NOS, l-Arg hydroxylation. The resonance Raman fingerprints of numerous saNOS (3941) and bsNOS (42, 43) complexes reveal no significant differences in the heme distal environment of bacNOSs and mNOSs (4446). Some subtle differences have been observed between the x-ray structures of FeIINO complexes of bsNOS (47) and neuronal NOS (nNOS) (48, 49) in the presence of NOHA and l-Arg, but they should not significantly affect the proton transfer processes. In fact, the variability of the heme distal structure is greater within mNOSs than between bacNOSs and mNOSs.

However, we previously noticed a difference in the “push” effect. We reported that the proximal Fe–S bond was stronger for bsNOS than for mNOSs, suggesting a modulation of the electron donation exerted by the thiolate ligand (43). This regulation pattern seems to be inherent to mNOSs. Unlike P450s, the sulfur atom of NOS-proximal thiolate is naturally engaged in a strong H-bond interaction with the nitrogen proton of the indole ring of the vicinal tryptophan (Scheme 1). Modification of this H-bond alters mNOS mechanism and catalysis. Thus, the loss of this H-bond for the W409F/Y mutant of nNOS increases the rate of FeIINO oxidation (50, 51). The proposed strengthening of this H-bond, in the case of the W188H mutant of iNOS, results in a slower oxygen activation process (52). If bacNOSs are bona fide oxygenases, the same regulation pattern should prevail. This has been suggested by Couture and co-workers (53), who showed that the suppression of the Trp-Cys H-bond in saNOS seemed to modify its proximal Fe–S bond.

SCHEME 1.

SCHEME 1.

Crystallographic structure of the active site of bsNOS highlighting the interactions between the heme, the proximal thiolate, and tryptophan 66. This structure was generated from the crystallographic structure of native bsNOS (Protein Data Bank entry 1M7V) (13) by using the Swiss-Pdb viewer Deepview and PovRay software (both available on the World Wide Web). This image illustrates the H-bond between Trp66 and the thiolate ligand, as well as the π-stacking between the tryptophan and the porphyrin.

We report here a comprehensive investigation of the modulation of the interaction between the proximal cysteine ligand and the vicinal Trp for bsNOS. We analyzed the effects of several mutations (W66A/L/F/Y/H) on the spectral fingerprints of bsNOS key species by using a combination of resonance Raman, ATR-FTIR, and EPR spectroscopies. Our results show that the modulation of this interaction not only modifies the electron donation of the thiolate ligand but also affects the electronic structure of the FeIINO complex. This seems to indicate that the reactivity of NOS major reactive intermediates (FeIIO2 and FeIINO) is controlled by the same means (the proximal H-bond network) in bacterial and mammalian NOSs.

EXPERIMENTAL PROCEDURES

Chemicals

All chemicals were purchased from Sigma-Aldrich. BH4 and Nω-hydroxy-l-arginine were purchased from Enzo Life Sciences (Enzo Life Sciences Inc., Farmingdale, NY). NO and CO gases were purchased from Messer France SA (Asnières, France). NO-saturated solutions were freshly prepared by flushing NO gas through a previously degassed 100 mm potassium phosphate (KPi) buffer at pH 7.4.

Molecular Biology

The bsNOS gene was a kind gift of Dr. Dennis J. Stuehr (16).3 Wild-type bsNOS and mutants containing a His6 tag attached to their N terminus were overexpressed in Escherichia coli strain BL21 (DE3) using a pET15B expression vector as described (16). Trp66 mutations were added in the bsNOS gene using the QuikChange XL site-directed mutagenesis kit from Stratagene and synthetic mutagenic oligonucleotides. Oligonucleotides used to construct site-directed mutants in bsNOS were synthesized by Eurofins MWG. Silent mutations coding for the disappearance of the EcoRI (GAATTC) restriction site were incorporated into the oligonucleotides to aid in screening. Mutations (boldface type), the EcoRI restriction site (underlined), and their corresponding oligonucleotides were as follows: W66F, TCTGCCGATGCAGCGGTTGCTGTTTCTGAAAGCCATTTTCGCCCCGTG; W66Y, TCTGCCGATGCAGCGGTTGCTGTTTCTATAAGCCATTTTCGCCCCGTG; W66H, TCTGCCGATGCAGCGGTTGCTGTTTCTGTGAGCCATTTTCGCCCCGTG; W66L, TCTGCCGATGCAGCGGTTGCTGTTTCTGAGAGCCATTTTCGCCCCGTG; W66A, TCTGCCGATGCAGCGGTTGCTGTTTCTCGCAGCCATTTTCGCCCCGTG; W66 sense, CTGCATCGGCAGATTGTTTTGGAACTCGCTGAATGTCATCGACAGAC. Incorporated mutations were confirmed by DNA sequencing. DNAs containing the desired mutations were transformed into E. coli for protein expression.

Protein Expression and Purification

Wild-type and Trp66 mutant bsNOS were expressed in E. coli. 400-ml cultures of terrific broth containing 125 mg/liter ampicillin were initiated with 500 μl of stock glycerol bacterial culture and stirred at 250 rpm at 37 °C. At A600 = 0.8–1, starter cultures (400 ml) were used to inoculate 3.6 liter of the same medium. Protein expression was induced at A600 = 1 by adding 1 mm isopropyl-β-d-thiogalactoside, and the cultures were supplemented with 500 μm δ-aminolevulinic acid. After 12 h of growth at 20 °C, the cells were harvested by centrifugation at 6000 rpm for 20 min at 4 °C and resuspended in ice-cold lysis buffer (0.1 m Tris-HCl, pH 8–9, with 10% glycerol, 1 mm EDTA, and 0.25 m NaCl) containing 1 mg/ml lysozyme, 0.5 μg/ml each leupeptin and pepstatin, 1 mm phenylmethanesulfonyl fluoride (PMSF), 50 units/ml DNase I (bovine pancreas type IV, Sigma) with or without 10 μm H4B and 5 mm l-arginine. Cells were lysed by two cycles of French press at 700 p.s.i. The lysate was centrifuged at 16,000 rpm for 45 min at 4 °C. (NH4)2SO4 (50–55% w/v, final concentration) was added. After mixing for 30 min and centrifugation (30 min, 16,000 rpm at 4 °C), the pellet was resuspended in binding buffer (0.1 m Tris-HCl, pH 8–9, 10% glycerol, 0.25 m NaCl, 1 mm PMSF with or without 10 μm H4B and 5 mm l-arginine). The supernatant was loaded on a column of Ni-ProBond resin (Invitrogen) pretreated with binding buffer containing 10 mm imidazole (buffer A). The column was washed with 10 volumes of buffer A. Bound protein was eluted with binding buffer containing 200 mm imidazole. Column fractions were pooled and were concentrated using Centriprep (10 units) (Millipore, Bedford, MA) with centrifugation at 5000 rpm. The concentrated proteins were dialyzed at 4 °C against 2 liters of 0.1 m KPi buffer, pH 8–9, containing 10% glycerol, 0.25 m NaCl, 1 mm PMSF, and 3 mm DTT in the presence or absence of 10 μm H4B and 10 mm l-arginine for 24 h. After one change of buffer overnight, the protein was checked for heme content and purity by SDS-PAGE and stored at −80 °C.

Preparation of WT and Mutant bsNOS Complexes

Samples were reconditioned in a KPi (100 mm, pH 7.4) buffer in the presence of different combinations of Arg (10 mm) and/or BH4 (100 μm to 1 mm) by three successive cycles of dilution/centrifugation in the final buffer using MicroCon membrane concentrators with a 30 kDa cut-off (Millipore). For samples containing BH4, a final dilution/concentration cycle with freshly prepared BH4 buffer was performed just before the measurements.

Anerobic ferric NOS (FeIII) was first prepared by 100–200 cycles of alternate vacuum and argon refilling, directly in a quartz EPR tube (EPR and resonance Raman experiments) or in a quartz cuvette (ATR-FTIR and UV-visible spectrometry), both sealed with air-tight rubber septa. Ferrous samples (FeII) were obtained by reduction of FeIII NOS with the addition of a small volume of dithionite solution (5–100 mm) directly into the EPR tube (or the cuvette) using a gas-tight syringe (Hamilton, Reno, NV). Ferrous heme-CO (FeIICO) samples were then obtained by flushing CO inside the EPR tube (or the cuvette) for 10 min to ensure CO saturation of the solution and complete CO binding to FeII NOS, as verified by UV-visible absorption. Ferrous heme-NO complexes were formed by the addition with a gas-tight syringe of a small volume of a NO-saturated solution (50–500 μm final concentration) to the ferrous NOS solution. The ferric heme-NO (FeIIINO) samples were prepared by the addition of a small volume of a NO-saturated solution (50–500 μm final concentration) to the anaerobic ferric NOS solution. All UV-visible spectra were recorded at room temperature on a Uvikon XL (Secomam, Alès, France).

EPR Spectroscopy

9.4 GHz (X-band) EPR spectra were recorded on a Bruker ELEXSYS 500 spectrometer equipped with a standard TE cavity (Bruker) and an Oxford Instruments continuous flow liquid helium cryostat and a temperature control system. Simulations were performed by using the Easyspin software package (54).

Resonance Raman Spectroscopy

50-μl samples of bsNOS FeIICO complexes solutions at 70–150 μm were prepared in gas-tight quartz EPR tubes and disposed in a homemade spinning cell, at room temperature, to avoid local heating and to prevent photodissociation and degradation. Raman excitation at 441.6 nm was obtained with a helium-cadmium laser (Kimmon, Tokyo, Japan). Resonance Raman spectra were recorded using a modified single-stage spectrometer (Jobin-Yvon T64000, HORIBA Jobin Yvon S.A.S., Chilly Mazarin, France) equipped with a liquid N2-cooled back-thinned CCD detector. Stray scattered light was rejected using a holographic notch filter (Kaiser Optical Systems, Ann Arbor, MI). Spectra were recorded as the co-addition of 40–60 individual spectra with CCD exposure times of 20–30 s each. 3–6 successive sets of such spectra were then averaged. Neutral density filters were used for the FeIICO complexes to decrease laser power (below 5 milliwatts at the sample) and avoid photodissociation and photo-oxidation. Spectral accuracy was estimated to be ±1 cm−1. Spectral resolution was about 3 cm−1. Base-line correction was performed using GRAMS 32 software (Galactic Industries, Salem, NH).

ATR-FTIR Spectroscopy

Room temperature FTIR spectra were recorded using a Bruker IFS 66 Fourier transform infrared spectrometer (Bruker Optik GmbH, Ettlingen, Germany) coupled to a single reflection micro-ATR prism from Pike Technologies (Madison, WI). 30 μl of 500 μm bsNOS FeIICO sample were prepared in a small quartz cuvette as described above. 10 μl were deposited using a gas-tight syringe on the ZnSe crystal surface of the ATR unit. The crystal was sealed within a gas-tight in-house built chamber, which permitted the control of the atmosphere above the sample. Twenty-fold 250 co-added interferograms were averaged for each FTIR measurement. A water vapor spectrum was used for background correction. Base-line correction was achieved using the GRAMS 32 software package (Galactic Industries, Salem, NH). Each spectrum presented in this work corresponds to the averaging of 3–5 individual experiments.

Data Analysis

Identification of spectral components in Raman and/or FTIR bands was achieved as previously described by the combination of Fourier self-deconvolution and second order derivative analysis of the averaged spectra using GRAMS 32 software (Galactic Industries, Salem, NH) (55). The overlapping peaks were resolved by fitting the spectral region to Lorentzian functions using Origin 6.0 (OriginLab Corp., Northampton, MA). The NOS Raman bands were assigned following previous assignments on NOS (46, 5560).

RESULTS

Production of Trp66 bsNOS Mutants

The sulfur atom of NOS-proximal thiolate is naturally engaged in a strong H-bond interaction with the nitrogen proton of the indole ring of the vicinal tryptophan (see Scheme 1). In order to check the influence of this H-bond interaction on the proximal thiolate properties, we mutated the bsNOS Trp66 residue into five different amino acids (see “Experimental Procedures”): a phenylalanine (W66F) and a tyrosine (W66Y) to maintain the aromatic ring but remove the H-bond; a histidine (W66H) that is believed to maintain and even strengthen this H-bond (52); a leucine (W66L) to remove both the H-bond interaction and the aromaticity, keeping some hydrophobic environment; and an alanine (W66A), to remove all possible interactions. We slightly modified the expression and purification protocol to take into account the potential fragility of these mutated proteins (see “Experimental Procedures”). The expression of most of the mutant proteins was generally similar to that of wild-type bsNOS and reached around 10–20 mg of heme protein/liter of culture. However, yields of W66A were extremely weak, suggesting that the stability of the heme core was strongly altered by this mutation.

EPR Analysis of Native Wild-type and Mutated bsNOS

Wild-type and mutated bsNOS electronic properties were analyzed by EPR spectroscopy in the absence (Fig. 1A) or presence (Fig. 1B) of l-Arg. In both cases, the dominant features correspond to a signal from the high spin pentacoordinated (HS-5c) FeIII heme moiety. This signal was simulated, taking into account the electronic Zeeman interaction (taken as isotropic) and the zero-field splitting interaction characterized by the parameters D and E. Because the zero-field splitting interaction is largely dominant over the Zeeman interaction, the important parameter obtained from the simulation is the ratio E/D that is listed in Table 1. The simulated spectra are displayed in Fig. 1 together with the experimental data. In the absence of substrate, the E/D value increases in the order WT < W66H < W66Y < W66F < W66L, with the main difference observed between the two groups WT/W66H and W66Y/F/L. The addition of l-Arg to the proteins greatly increases the structural homogeneity of the samples as indicated by the EPR spectra, which now display only a HS-5c FeIII signal with features narrower than those observed in the absence of substrate. The rhombicity of the HS signal varies continuously between the different bsNOS with the order W66H < WT < W66Y < W66F < W66L.

FIGURE 1.

FIGURE 1.

EPR spectra of WT and mutants ferric bsNOS in the absence of substrate and cofactor (A) and in the presence of saturating concentrations of l-Arg (B). Experimental conditions were as follows: microwave frequency, 9.41 GHz; microwave power, 2 milliwatts; field modulation amplitude, 2 mT; field modulation frequency, 100 kHz; temperature, 10 K. The simulated spectra are shown as gray lines. The parameters used for the simulations are given in Table 1. a.u., arbitrary units.

TABLE 1.

Zero-field splitting rhombicity from the simulation of the HS FeIII heme for wild-type and mutated bsNOS

Common simulation parameters of the EPR spectra: g = 2, line width 2 mT, |D| > 180 GHz, D strain 10 GHz. D and E strains are the full width at half-maximum of the Gaussian distributions of the zero-field splitting parameters D and E.

Without arginine
With arginine
E/D E strain (% of E) E/D E strain (% of E)
% %
WT 0.074 15 0.080 15
W66H 0.076 18 0.077 19
W66Y 0.088 30 0.090 11
W66F 0.091 21 0.094 12
W66L 0.104 19 0.105 14

In the absence of substrate, all bsNOSs exhibit a fraction of low spin hexacoordinated (LS-6c) species. This is particularly true in the case of W66Y and W66F, whereas the proportion of LS-6c heme is much lower in the case of WT, W66H, and W66L. The LS-6c EPR spectra are shown in Fig. 2 for WT and W66H/Y/F along with the simulated spectra, and the parameters used for the simulations are listed in Table 2. Also for those low spin species, an effect of the mutation is observed on the EPR spectra, with the W66H mutant being similar to the WT, whereas the W66Y and W66F exhibit lower g-anisotropy and isotropic g. The Trp66 mutation affects the rhombicity of both LS-6c species (in the absence of l-Arg) and HS-5c species (in the absence or presence of l-Arg).

FIGURE 2.

FIGURE 2.

EPR spectra of the low spin FeIII complex of bsNOS mutants in the absence of substrate and cofactor. Experimental conditions were as follows: microwave frequency, 9.41 GHz; microwave power, 0.25 milliwatt; field modulation amplitude, 1 mT; field modulation frequency, 100 kHz; temperature, 10 K. The simulated spectra are shown as gray lines. The parameters used for the simulations are given in Table 2. a.u., arbitrary units.

TABLE 2.

Simulation parameters for the EPR spectra of the LS FeIII heme for wild-type and mutated bsNOS

Shown are the H strain values in MHz (full width at half-height line width describing broadening due to unresolved hyperfine couplings). giso is the average of the three principal values g1, g2, and g3.

g1 (H strain) g2 (H strain) g3 (H strain) giso Δg (g3 − g1)
WT 2.447 (500) 2.292 (0) 1.900 (200) 2.213 0.547
W66H 2.450 (450) 2.288 (0) 1.900 (157) 2.213 0.550
W66Y 2.409 (360) 2.274 (0) 1.928 (103) 2.204 0.481
W66F 2.392 (260) 2.267 (0) 1.931 (77) 2.197 0.461

These EPR results are in agreement with the UV-visible data recorded on wild-type and mutated bsNOS samples that show a predominant HS-5c for all proteins in the presence of substrate and cofactor and the presence of a fraction of LS-6c species in the absence of both cofactor and substrate (see Table 3 and supplemental Fig. S1).

TABLE 3.

Comparison of spectral characteristics of various complexes of wild-type bsNOS and Trp66 mutants

Wild-type and mutant complexes were obtained in saturating conditions of l-Arg and H4B. The top part of the table shows Soret wavelength values (in nm) for different NOS complexes. The bottom part shows wave numbers (in cm−1) of different stretches of FeIICO complexes. 450/420, hexa- and pentacoordinated FeIICO complexes, respectively. Values in parentheses correspond to full width at half-maximum values in cm−1.

WT W66H W66F W66Y
FeIII 396 395 396 396
FeIINO 438 434.5 438 435
FeIIINO 439.5a 433a 435.5a 436a
440 434 435 435.5

FeIICO
    450 446.5 441.5 449 448.5
    420 440a 420.5 419.5
νFe-CO 501 504.5 500 501.5
δFe-C-O 567 567 566 567
νC-O 1917 (9) 1920 (11) 1913 (10) 1913 (11)
1930 (7)

a Complexes obtained in the absence of substrate and cofactor.

UV-visible and Resonance Raman Investigation of the FeIICO Complexes of bsNOS Proteins

We recorded the UV-visible spectrum of wild-type and mutated bsNOS in the presence of both l-Arg and BH4. Characteristic Soret band absorption maxima are listed in Table 3 (see also supplemental Fig. S2). WT and W66H FeIICO complexes are mostly hexacoordinated. W66L FeIICO complex exhibits a Soret band at 420 nm characteristic of a weakening of the proximal ligation (58, 61), supporting a loss of the proximal thiolate ligand (62, 63), whereas the proportion of pentacoordinated P420 complexes remains minor for W66F and W66Y mutants. Trp66 mutation decreases the stability of the proximal thiolate-heme bond along the sequence WT/W66H > W66F/W66Y > W66L. The instability of the proximal bond of the FeIICO complex significantly increases for all proteins in the absence of l-Arg and BH4. The absorbance maximum of the Soret band varies with the mutant (Table 3). Wild-type bsNOS exhibits a Soret wavelength around 446.5 nm. This band is blue-shifted for W66H (441.5 nm) and red-shifted for W66F and W66Y mutants (449 and 448.5 nm, respectively), suggesting again an opposite modification of the electron donation of the proximal ligand for the W66H and the W66F/Y mutants. The binding of l-Arg modifies the equilibrium between the P420 and P450 forms but also the wavelength of the Soret band, confirming that all mutants efficiently bind their natural substrate (Table 3 and supplemental Fig. S2). We also analyzed the binding of imidazole, a distal ligand of ferric NOS. We found that imidazole binds and converts bsNOS WT and W66H/F/Y mutants into a LS-6c complex with a Soret maximum around 426 nm (data not shown), as observed for other bacterial and mammalian NOSs (6467). However, the dissociation constant was found to vary as a function of the Trp66 mutation. The affinity of imidazole was the highest for W66H (Kd = 0.4 mm), followed by WT (Kd = 0.95 mm), W66F (Kd = 3 mm), and finally W66Y (Kd = 6.5 mm).

We recorded the resonance Raman spectra of the FeIICO complex of the W66F, W66Y, and W66H mutants in the presence of both substrate and cofactor. They all indicate the major presence of an LS-6c FeIICO complex, with some minor photodissociation contribution (data not shown) such as what we observed for the wild-type bsNOS (43). We analyzed the 450–600 cm−1 spectral region (Fig. 3B). Spectra were deconvolved by a multi-Lorentzian function as described under “Experimental Procedures.” The peak that corresponds to the δFe-C-O bending mode (40, 43, 45) was observed around 567 cm−1 for wild-type and mutated NOSs (Table 3), indicating the absence of significant alteration of the FeIICO complex geometry. Whereas wild-type FeIICO complex exhibits a νFe-CO frequency around 501 cm−1 (43), this frequency decreases to 500 cm−1 for W66F mutant but increases up to 504.5 cm−1 for W66H bsNOS (Table 3). These data indicate that the Fe–C bond is the strongest for W66H FeIICO complex and then weakens for WT bsNOS and for W66F/Y mutants. Fig. 3A exhibits the ATR-FTIR spectra of the same complexes. We noticed a similar modification of the frequency of the νFe-CO stretching mode that was observed around 1920 cm−1 for W66H mutant, 1917 cm−1 for WT bsNOS, and 1913 cm−1 for W66F/Y mutants (Table 3). The C–O bond is stronger for the W66H FeIICO complex than for WT and weaker for the W66F/Y mutants. The concomitant decrease (respectively increase) of the νFe-CO and νCO stretching frequencies reflects an increase (respectively a decrease) of the σ-competition between the distal and proximal ligands of the W66F/Y (respectively W66H) mutants (43, 45, 55).

FIGURE 3.

FIGURE 3.

Analysis of the effect of the Trp66 mutation on the coordination of the distal CO ligand. A, 1800–2000 cm−1 spectral region of ATR-FTIR spectra of FeIICO complexes for wild-type bsNOS and several bsNOS mutants (W66H, W66F, and W66Y) in the presence of saturating concentrations of l-Arg and H4B. B, 400–600 cm−1 spectral region of resonance Raman spectra of FeIICO complexes for the same bsNOS proteins in the presence of saturating concentrations of l-Arg and H4B. All spectra have been deconvolved with a multi-Lorentzian function to determine the contribution of each conformation (see “Experimental Procedures”); resulting Lorentzian curves are shown as gray lines. a.u., arbitrary units.

Characterization of Heme-NO Complexes of Wild-type and Mutant bsNOS

The FeIIINO complexes of WT and W66H/F/Y mutants were found to be relatively stable both in the absence and presence of substrate and cofactor (see supplemental Fig. S3 for the UV-visible spectra). The mutation mostly affects the values of the Soret band maximum that varies between 433 (W66H) and 440 nm (WT; Table 3). The FeIINO complexes of the bsNOS mutants also display spectral fingerprints similar to those of WT bsNOS in the presence of both l-Arg and BH4. Only the W66Y FeIINO spectrum was found to exhibit a shoulder around 417 nm that is reminiscent of what was observed for the nNOS W409F/Y mutant (60, 68). Here again, the wavelength of the Soret band maximum was observed between 434.5 nm (W66H) and 438 nm (WT; Table 3).

The FeIINO complexes of bsNOS proteins were also analyzed by EPR spectroscopy (Fig. 4). In the presence of l-Arg and BH4, the observed spectra were dominated by the well known rhombic powder pattern with three different g-values and resolved hyperfine coupling with the nitrogen nucleus of the NO ligand (Fig. 4B), characteristic of a hexacoordinated structure (69). This was not the case for W66L (and a negligible fraction of W66Y) FeIINO complex, whose spectrum corresponded to an axial powder pattern, characteristic of a pentacoordinated nitrosyl iron species. The proportion of the pentacoordinated form increased for all proteins in the absence of any substrate and cofactor (Fig. 4A). The trend in the stability/loss of the proximal ligand is similar to the one we observed for the FeIICO complexes; whereas WT and W66H FeIINO complex exhibited an almost completely hexacoordinated structure, W66F/Y FeIINO complexes corresponded to a mixture of hexa- and pentacoordinated species. W66L FeIINO species remained entirely pentacoordinated, as expected. The stability of the proximal ligand seems to obey the following order: (WT/H) > (F/Y) > L, which might reflect the variations in the electronic donation of the proximal ligand induced by the Trp66 mutations.

FIGURE 4.

FIGURE 4.

EPR spectra of WT and Trp66 mutant bsNOS FeIINO complexes in the absence of substrate and cofactor (A) and in the presence of saturating concentrations of l-Arg and H4B (B). Experimental conditions were as follows: microwave frequency, 9.41 GHz, microwave power, 0.004 milliwatt; field modulation amplitude, 0.5 mT; field modulation frequency, 100 kHz; temperature, 10 K. The simulated spectra are shown as gray lines. The parameters used for the simulations are given in Table 4. a.u., arbitrary units.

The EPR spectra were simulated for all hexacoordinated species (WT and W66H/F/Y in the presence of l-Arg and BH4; Fig. 4B) as well as for the pentacoordinated complex of W66L (Fig. 4A), taking into account the Zeeman interaction and the hyperfine coupling to the nitrogen nucleus of the NO ligand. Simulation parameters are reported in Table 4. With respect to the hexacoordinated species (WT and W66H/F/Y), the total g-anisotropy (Δg) of the FeIINO signal increased with the order W66H < WT < W66F < W66Y, whereas the isotropic g-value (giso) decreased in the same order (Table 4). The isotropic hyperfine coupling of the nitrogen nucleus of the NO molecule also decreased in the same order, indicating that the spin density on the NO nitrogen is the greatest on W66H and decreases slightly for WT > W66F > W66Y. This indicates that Trp66 mutations modify the electronic properties of FeIINO complexes.

TABLE 4.

Simulation parameters for the EPR spectra of FeIINO complexes for wild-type and mutated bsNOS

The values Ai correspond to the hyperfine coupling with the nitrogen nucleus of the NO ligand. giso (respectively Aiso) is the average of the three principal values g1, g2, and g3 (respectively A1, A2, and A3). g strain is the full width at half-maximum of the Gaussian distributions of the g principal values.

g1 (g strain) g2 (g strain) g3 (g strain) giso Δg (g3 − g1) A1 A2 A3 Aiso
MHz MHz MHz MHz
WT 2.0816 (0.0075) 2.0046 (0.0010) 1.9671 (0.0054) 2.0178 0.1145 28.8 58.9 32.5 40.1
W66H 2.0808 (0.0075) 2.0046 (0.0010) 1.9737 (0.0064) 2.0197 0.1071 32.0 59.0 37.0 42.7
W66Y 2.0771 (0.0062) 2.0043 (0.0010) 1.9615 (0.0047) 2.0143 0.1156 26.0 57.0 31.0 38.0
W66F 2.0760 (0.0050) 2.0037 (0.0010) 1.9610 (0.0045) 2.0146 0.1150 27.6 60.0 31.1 39.6
W66L 2.1040 (0.010) 2.0094 (0.0030) 2.0094 (0.0030) 2.0409 42.0 50.5 50.5 47.7

DISCUSSION

Trp66 of bsNOS is engaged in an H-bond with the heme proximal ligand that is believed to tune the properties of the NOS Fe–S bond (53). We present here for the first time a comparative analysis of five different mutants of this residue that differentially affect the environment of the proximal ligand: (i) the F and Y mutants, already described for nNOS (70) and recently for eNOS and saNOS (53), correspond to a suppression of the H-bond; (ii) the H mutant, described for iNOS (52), is supposed to induce a strengthening of the H-bond; (iii) finally, the A and L mutants, as yet undescribed, should suppress both H-bond and π-stacking interactions. A comparative analysis of the effects of these different mutations on bsNOS structural and electronic properties should allow a better understanding of the way this H-bond modulates NOS structure and function.

Control of the σ-Competition between NOS-distal and -proximal Ligands

The FeIICO complex is commonly used as a probe to analyze the influence of heme environment on FeIIO2 structure and reactivity (55, 71, 72). Vibrational spectroscopies, such as resonance Raman and FTIR spectroscopies, allow the characterization of νFe-CO and νC-O stretching modes. The frequencies of these modes are sensitive to the electronic properties of the proximal ligand and to polar and/or steric interactions between CO and the heme distal pocket (71, 72). Modifications of the electrostatic/polar distal environment of the CO ligand result in changes in the back donation from the iron dπ* orbital to the empty π* orbital of CO. This leads to the well known inverse correlation between the frequencies of the νFe-CO and νC-O (45). Additionally, there is a competition between the proximal and distal ligands for σ-bonding to the dz2 orbital of the heme iron. Variations in the electronic properties of the proximal ligand will impact this competition and shift the νFe-COC-O correlation curve. Strong electron-donating ligands (such as the thiolate of NOS and cytochromes P450) will shift correlation lines toward low νFe-CO and νC-O frequencies, whereas weak proximal ligand (in the case of globins or some peroxidases) will lead to higher νFe-CO and νC-O frequencies.

Our results suggest that the mutations do not affect FeIICO geometry (no change in the bending modes; Table 3). However, they show an increase in the νFe-CO and νC-O frequencies for the W66H mutant, whereas the W66F and W66Y mutants are characterized by weaker Fe–CO and C–O bonds (Table 3). Plotted in the νFe-COC-O correlation graph (data not shown), these data show a change in the offset of the correlation line, univocally linked to the variation of the proximal ligand strength. This indicates that the mutation directly modifies the electron donating ability of the proximal thiolate; W66F and W66Y are characterized by stronger electron donation (in agreement with the removal of the H-bond), whereas W66H is characterized by weaker electron donation (in agreement with a strengthening of the H-bond).

In this report, using the inverse νFe-COC-O correlation, we are able for the first time to probe within a single NOS protein both the increase and the decrease of this σ-competition and to assign these variations to the modifications of the H-bonding interaction in which the proximal ligand is engaged.

Role of Tryptophan-Thiolate H-bond in bsNOS Stability

This variation in σ-competition has strong effects on the properties of bsNOS complexes, as reflected by the effects of the mutation on FeIINO and FeIICO stability (Fig. 4 and supplemental Figs. S2 and S3). We observed a greater proportion of pentacoordinated forms of these complexes for W66F and W66Y bsNOS (due to a stronger σ-competition), whereas W66H hexacoordinated complex (with a weaker proximal ligand) seems as stable as (if not more stable than) WT complexes. The same trend is observed in the dissociation constants of the FeIII-Im complex. The affinity of imidazole for bsNOS heme is the greatest for W66H (weak σ-competition), decreases for WT, and decreases even more for W66F and W66Y (strong σ-competition). However, we do not observe a better stabilization of FeIICO and FeIINO species for W66Y; no H-bond with the tyrosine proton, such as the one observed for eNOS (53), can be deduced from our data. Our work clearly indicates that the tryptophan-thiolate H-bond interaction controls the stability of bsNOS FeII-XO complexes, such as FeIINO, FeIICO, and most probably FeIIO2.

Additionally, our study reveals that other structural features contribute to bsNOS stability. Indeed, upon binding of a distal ligand, such as CO or NO, the W66L complex is quickly and fully converted into pentacoordinated species, indicating the loss of the proximal thiolate ligand. Compared with W66F and W66Y, this further decrease in stability might arise from the loss of specific interactions that stabilize NOS heme, such as the π-stacking between the tryptophan indole ring and the porphyrin cofactor (Scheme 1). Furthermore, the W66A mutant exhibits a critical instability of the protein, as illustrated by the severe difficulties of purification. Accordingly, the EPR spectrum of the W66A ferric enzyme (data not shown) suggests a complete unfolding of the protein and a partial loss of the heme.

Effect of Trp66 Mutations on the Electronic Structures of FeII-XO Complexes

The variations in the electron-donating properties of the proximal thiolate seem to also exert an impact on the electronic structure of bsNOS complexes. For example, the Soret maximum of the FeIICO spectra is red-shifted for W66F and W66Y mutants (a stronger electron-donating ligand) and blue-shifted for W66H bsNOS (weaker proximal ligand). These variations are also reflected by the shifts of the Soret maxima of FeIIINO and FeIINO complexes (Table 3) and to a lesser extent by the modification of the low spin/high spin equilibrium. The variations of bsNOS electronic properties can also be appreciated by EPR spectroscopy. The g-anisotropy of LS-6c FeIII species, the minor fraction of native bsNOS, is greater for W66H/WT than for W66F/W66Y (Fig. 2 and Table 2). A similar distinction between W66F/W66Y on one hand and W66H/WT on the other hand is observed for the zero-field splitting rhombicity of the prevalent FeIII HS-5c species. Indeed, the E/D value is clearly greater for the W66F/W66Y mutants than for W66H and WT (Fig. 1 and Table 1). The same variations are observed for hexacoordinated FeIINO complex. The anisotropy is greater for W66F/W66Y than for W66H and WT bsNOS (Table 4).

The effects of the variation of the proximal bond on the detailed electronic structure of FeIINO complexes are more difficult to analyze. However, the comparison of the EPR fingerprints for this series of mutants indicates a significant contribution of the proximal H-bond in the distribution of the electronic density on the FeIINO moiety. The spin density on the NO nitrogen seems maximal for W66H and decreases as the hydrogen bond strength on the proximal thiolate ligand is decreased (Table 4). These results show that changes in the electron-donating properties of the proximal ligand drastically modify the electronic structure of FeIII and FeIINO complexes.

Influence of the Proximal H-bond on FeII-XO Reactivity

The variations of NOS electronic structure induced by the changes in the proximal H-bond interactions are believed to modify its catalytic activity. Indeed, the rates of FeIIO2 autoxidation and FeIINO oxidation increase for W409F/Y nNOS (31, 70). Reciprocally, the strengthening of this H-bond in the case of W188H iNOS induces a decrease of FeIIO2 autoxidation and activation rates that eventually allow the observation of new reaction intermediates (52).

All of these results suggest that bacterial NOSs use the same regulation feature, the “push effect” (73), to finely tune its oxidative chemistry. They also underline the necessity to precisely delimit the proximal ligand electron donation. A too strong electron donation (e.g. for Phe/Tyr mutants) exacerbates the instability of NOS reaction intermediates and mostly leads to uncoupling processes and reactive nitrogen and oxygen species production. A weak electron donation (e.g. for the His mutant) leads to an insufficient reactivity of iron-oxo complexes (74). The functional analysis of our panel of mutants by the Griess assay (see supplemental Fig. S4 and Table S1) confirms this model. On one hand, the W66H mutant exhibits an extremely weak nitrite synthase activity (6 × 10−4 s−1), which corresponds to around 5% of WT standard activity. On the other hand, W66F activity remains comparable with that of WT bsNOS (around 50%). This difference could arise from uncoupling reactions due to a stronger electron density on the heme intermediates.

CONCLUSION

We present here a comprehensive analysis of the role of the H-bond in the control of NOS structural and electronic properties. We analyzed the effects of both suppression (W66F/Y) and strengthening (W66H) of this H-bond on FeIII, FeIICO, and FeIINO spectroscopic fingerprints.

We evidenced for the first time a tight correlation between the proximal H-bond network, the electron-donating properties of the proximal ligand, and the stability and reactivity of NOS. Our data indicate that the removal of the H-bond (W66F/Y) increases the electron donation properties of the proximal ligand, which in turn induces an increased σ-competition on the iron orbitals. This competition leads to the destabilization of FeII-XO complexes, such as FeIINO, FeIICO, and putatively FeIIO2. This destabilization is reverted when the Phe/Tyr residues are replaced by a histidine that restores (and even strengthens) the proximal H-bond and thus diminishes the σ-competition. These results confirm and complete previous information obtained for the Phe/Tyr mutants of saNOS (Trp56), eNOS (Trp180) (53), and nNOS (Trp409) (60, 68) and highlight the crucial role of this proximal H-bond in the stability of NOS reactive intermediates.

Additionally, our results suggest that bacterial NOSs are genuine oxygenases that seem to utilize the electron donation from the thiolate to activate distal ligands, such as O2 and NO, and to use the same regulation feature, namely the proximal H-bond to tune and control their catalytic activity. This pattern could also intervene in the interaction between NOS and other reactive ligands, such as peroxynitrite. A comparative analysis of the role of this H-bond in the mechanisms of dioxygen activation, of FeIINO oxidation, or of peroxynitrite activation could help understand the biological specificities of mammalian and bacterial NOSs.

Acknowledgments

We thank Dr. François André for help in modeling the structural effect of the Trp66 mutation. We also thank Isabelle Boisdé for technical support.

Inline graphic

The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1–S4 and Table S1.

3

It should be noted that the bsNOS used in Stuehr's laboratory (strain spizizenii W23) differs slightly from the one used in Crane's laboratory (strain 168) by a small N-terminal extension, leading to a shift in the residue numbering.

2
The abbreviations used are:
NOS
nitric-oxide synthase
bacNOS
bacterial NOS-like protein
eNOS
endothelial nitric-oxide synthase
iNOS
inducible nitric-oxide synthase
mNOS
mammalian nitric-oxide synthase
nNOS
neuronal nitric-oxide synthase
bsNOS
NOS-like protein isolated from B. subtilis
saNOS
NOS-like protein isolated from S. aureus
ATR
attenuated total reflection
FeIINO
ferrous heme-nitrosyl complex
FeIICO
ferrous heme-carbon monoxide complex
FeIIO2
ferrous heme-oxygen complex
FeIIINO
ferric heme-nitrosyl complex
XO
either NO, CO, or O2
HS-5c and LS-6c
high spin pentacoordinated and low spin hexacoordinated, respectively
KPi
inorganic phosphate buffer
P420
thiolate-free coordination of the heme
mT
millitesla(s)
H-bond
hydrogen bond
H4B
BH4, tetrahydrobiopterin, (6R)-5,6,7,8-tetrahydro-l-biopterin.

REFERENCES

  • 1. Hughes M. N. (2008) Methods Enzymol. 436, 3–19 [DOI] [PubMed] [Google Scholar]
  • 2. Ignarro L. J. (2002) J. Physiol. Pharmacol. 53, 503–514 [PubMed] [Google Scholar]
  • 3. Bogdan C. (2001) Nat. Immunol. 2, 907–916 [DOI] [PubMed] [Google Scholar]
  • 4. Bredt D. S. (2003) J. Cell Sci. 116, 9–15 [DOI] [PubMed] [Google Scholar]
  • 5. Pacher P., Beckman J. S., Liaudet L. (2007) Physiol. Rev. 87, 315–424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Sessa W. C. (2004) J. Cell Sci. 117, 2427–2429 [DOI] [PubMed] [Google Scholar]
  • 7. Lowenstein C. J., Padalko E. (2004) J. Cell Sci. 117, 2865–2867 [DOI] [PubMed] [Google Scholar]
  • 8. Mungrue I. N., Bredt D. S. (2004) J. Cell Sci. 117, 2627–2629 [DOI] [PubMed] [Google Scholar]
  • 9. Ghosh D. K., Salerno J. C. (2003) Front. Biosci. 8, d193–d209 [DOI] [PubMed] [Google Scholar]
  • 10. Moreau M., Lee G. I., Wang Y., Crane B. R., Klessig D. F. (2008) J. Biol. Chem. 283, 32957–32967 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Zemojtel T., Fröhlich A., Palmieri M. C., Kolanczyk M., Mikula I., Wyrwicz L. S., Wanker E. E., Mundlos S., Vingron M., Martasek P., Durner J. (2006) Trends Plant Sci. 11, 524–525; author reply 526–528 [DOI] [PubMed] [Google Scholar]
  • 12. Sudhamsu J., Crane B. R. (2009) Trends Microbiol. 17, 212–218 [DOI] [PubMed] [Google Scholar]
  • 13. Pant K., Bilwes A. M., Adak S., Stuehr D. J., Crane B. R. (2002) Biochemistry 41, 11071–11079 [DOI] [PubMed] [Google Scholar]
  • 14. Bird L. E., Ren J., Zhang J., Foxwell N., Hawkins A. R., Charles I. G., Stammers D. K. (2002) Structure 10, 1687–1696 [DOI] [PubMed] [Google Scholar]
  • 15. Sudhamsu J., Crane B. R. (2006) J. Biol. Chem. 281, 9623–9632 [DOI] [PubMed] [Google Scholar]
  • 16. Adak S., Aulak K. S., Stuehr D. J. (2002) J. Biol. Chem. 277, 16167–16171 [DOI] [PubMed] [Google Scholar]
  • 17. Adak S., Bilwes A. M., Panda K., Hosfield D., Aulak K. S., McDonald J. F., Tainer J. A., Getzoff E. D., Crane B. R., Stuehr D. J. (2002) Proc. Natl. Acad. Sci. U.S.A. 99, 107–112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Kers J. A., Wach M. J., Krasnoff S. B., Widom J., Cameron K. D., Bukhalid R. A., Gibson D. M., Crane B. R., Loria R. (2004) Nature 429, 79–82 [DOI] [PubMed] [Google Scholar]
  • 19. Johnson E. G., Sparks J. P., Dzikovski B., Crane B. R., Gibson D. M., Loria R. (2008) Chem. Biol. 15, 43–50 [DOI] [PubMed] [Google Scholar]
  • 20. Buddha M. R., Keery K. M., Crane B. R. (2004) Proc. Natl. Acad. Sci. U.S.A. 101, 15881–15886 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Buddha M. R., Tao T., Parry R. J., Crane B. R. (2004) J. Biol. Chem. 279, 49567–49570 [DOI] [PubMed] [Google Scholar]
  • 22. Gusarov I., Nudler E. (2005) Proc. Natl. Acad. Sci. U.S.A. 102, 13855–13860 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Shatalin K., Gusarov I., Avetissova E., Shatalina Y., McQuade L. E., Lippard S. J., Nudler E. (2008) Proc. Natl. Acad. Sci. U.S.A. 105, 1009–1013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Gusarov I., Shatalin K., Starodubtseva M., Nudler E. (2009) Science 325, 1380–1384 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Patel B. A., Moreau M., Widom J., Chen H., Yin L., Hua Y., Crane B. R. (2009) Proc. Natl. Acad. Sci. U.S.A. 106, 18183–18188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Maréchal A., Mattioli T. A., Stuehr D. J., Santolini J. (2010) FEBS J. 277, 3963–3973 [DOI] [PubMed] [Google Scholar]
  • 27. Gusarov I., Starodubtseva M., Wang Z. Q., McQuade L., Lippard S. J., Stuehr D. J., Nudler E. (2008) J. Biol. Chem. 283, 13140–13147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Wang Z. Q., Lawson R. J., Buddha M. R., Wei C. C., Crane B. R., Munro A. W., Stuehr D. J. (2007) J. Biol. Chem. 282, 2196–2202 [DOI] [PubMed] [Google Scholar]
  • 29. Reece S. Y., Woodward J. J., Marletta M. A. (2009) Biochemistry 48, 5483–5491 [DOI] [PubMed] [Google Scholar]
  • 30. Wang Z. Q., Wei C. C., Sharma M., Pant K., Crane B. R., Stuehr D. J. (2004) J. Biol. Chem. 279, 19018–19025 [DOI] [PubMed] [Google Scholar]
  • 31. Stuehr D. J., Santolini J., Wang Z. Q., Wei C. C., Adak S. (2004) J. Biol. Chem. 279, 36167–36170 [DOI] [PubMed] [Google Scholar]
  • 32. Santolini J., Meade A. L., Stuehr D. J. (2001) J. Biol. Chem. 276, 48887–48898 [DOI] [PubMed] [Google Scholar]
  • 33. Wang Z. Q., Wei C. C., Stuehr D. J. (2010) J. Inorg. Biochem. 104, 349–356 [DOI] [PubMed] [Google Scholar]
  • 34. Sono M., Roach M. P., Coulter E. D., Dawson J. H. (1996) Chem. Rev. 96, 2841–2888 [DOI] [PubMed] [Google Scholar]
  • 35. Meunier B., de Visser S. P., Shaik S. (2004) Chem. Rev. 104, 3947–3980 [DOI] [PubMed] [Google Scholar]
  • 36. Denisov I. G., Makris T. M., Sligar S. G., Schlichting I. (2005) Chem. Rev. 105, 2253–2277 [DOI] [PubMed] [Google Scholar]
  • 37. Poulos T. L. (2007) Drug Metab. Rev. 39, 557–566 [DOI] [PubMed] [Google Scholar]
  • 38. Poulos T. L. (1996) J. Biol. Inorg. Chem. 1, 356–359 [Google Scholar]
  • 39. Chartier F. J., Blais S. P., Couture M. (2006) J. Biol. Chem. 281, 9953–9962 [DOI] [PubMed] [Google Scholar]
  • 40. Chartier F. J., Couture M. (2004) Biophys. J. 87, 1939–1950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Chartier F. J., Couture M. (2007) J. Biol. Chem. 282, 20877–20886 [DOI] [PubMed] [Google Scholar]
  • 42. Chartier F. J., Couture M. (2007) Biochem. J. 401, 235–245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Santolini J., Roman M., Stuehr D. J., Mattioli T. A. (2006) Biochemistry 45, 1480–1489 [DOI] [PubMed] [Google Scholar]
  • 44. Li D., Kabir M., Stuehr D. J., Rousseau D. L., Yeh S. R. (2007) J. Am. Chem. Soc. 129, 6943–6951 [DOI] [PubMed] [Google Scholar]
  • 45. Rousseau D. L., Li D., Couture M., Yeh S. R. (2005) J. Inorg. Biochem. 99, 306–323 [DOI] [PubMed] [Google Scholar]
  • 46. Fan B., Wang J., Stuehr D. J., Rousseau D. L. (1997) Biochemistry 36, 12660–12665 [DOI] [PubMed] [Google Scholar]
  • 47. Pant K., Crane B. R. (2006) Biochemistry 45, 2537–2544 [DOI] [PubMed] [Google Scholar]
  • 48. Doukov T., Li H., Soltis M., Poulos T. L. (2009) Biochemistry 48, 10246–10254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Li H., Igarashi J., Jamal J., Yang W., Poulos T. L. (2006) J. Biol. Inorg. Chem. 11, 753–768 [DOI] [PubMed] [Google Scholar]
  • 50. Adak S., Stuehr D. J. (2001) J. Inorg. Biochem. 83, 301–308 [DOI] [PubMed] [Google Scholar]
  • 51. Adak S., Wang Q., Stuehr D. J. (2000) J. Biol. Chem. 275, 17434–17439 [DOI] [PubMed] [Google Scholar]
  • 52. Tejero J., Biswas A., Wang Z. Q., Page R. C., Haque M. M., Hemann C., Zweier J. L., Misra S., Stuehr D. J. (2008) J. Biol. Chem. 283, 33498–33507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Lang J., Driscoll D., Gélinas S., Rafferty S. P., Couture M. (2009) J. Inorg. Biochem. 103, 1102–1112 [DOI] [PubMed] [Google Scholar]
  • 54. Stoll S., Schweiger A. (2006) J. Magn. Reson. 178, 42–55 [DOI] [PubMed] [Google Scholar]
  • 55. Giroud C., Moreau M., Mattioli T. A., Balland V., Boucher J. L., Xu-Li Y., Stuehr D. J., Santolini J. (2010) J. Biol. Chem. 285, 7233–7245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Wang J., Stuehr D. J., Ikeda-Saito M., Rousseau D. L. (1993) J. Biol. Chem. 268, 22255–22258 [PubMed] [Google Scholar]
  • 57. Wang J., Rousseau D. L., Abu-Soud H. M., Stuehr D. J. (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 10512–10516 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Wang J., Stuehr D. J., Rousseau D. L. (1995) Biochemistry 34, 7080–7087 [DOI] [PubMed] [Google Scholar]
  • 59. Wang J., Stuehr D. J., Rousseau D. L. (1997) Biochemistry 36, 4595–4606 [DOI] [PubMed] [Google Scholar]
  • 60. Couture M., Adak S., Stuehr D. J., Rousseau D. L. (2001) J. Biol. Chem. 276, 38280–38288 [DOI] [PubMed] [Google Scholar]
  • 61. Martinis S. A., Blanke S. R., Hager L. P., Sligar S. G., Hoa G. H., Rux J. J., Dawson J. H. (1996) Biochemistry 35, 14530–14536 [DOI] [PubMed] [Google Scholar]
  • 62. Presta A., Siddhanta U., Wu C., Sennequier N., Huang L., Abu-Soud H. M., Erzurum S., Stuehr D. J. (1998) Biochemistry 37, 298–310 [DOI] [PubMed] [Google Scholar]
  • 63. Abu-Soud H. M., Wu C., Ghosh D. K., Stuehr D. J. (1998) Biochemistry 37, 3777–3786 [DOI] [PubMed] [Google Scholar]
  • 64. Berka V., Tsai A. L. (2000) Biochemistry 39, 9373–9383 [DOI] [PubMed] [Google Scholar]
  • 65. Gorren A. C., Schmidt K., Mayer B. (2002) Biochemistry 41, 7819–7829 [DOI] [PubMed] [Google Scholar]
  • 66. Chabin R. M., McCauley E., Calaycay J. R., Kelly T. M., MacNaul K. L., Wolfe G. C., Hutchinson N. I., Madhusudanaraju S., Schmidt J. A., Kozarich J. W., Wong K. K. (1996) Biochemistry 35, 9567–9575 [DOI] [PubMed] [Google Scholar]
  • 67. Salard I., Mercey E., Rekka E., Boucher J. L., Nioche P., Mikula I., Martasek P., Raman C. S., Mansuy D. (2006) J. Inorg. Biochem. 100, 2024–2033 [DOI] [PubMed] [Google Scholar]
  • 68. Voegtle H. L., Sono M., Adak S., Pond A. E., Tomita T., Perera R., Goodin D. B., Ikeda-Saito M., Stuehr D. J., Dawson J. H. (2003) Biochemistry 42, 2475–2484 [DOI] [PubMed] [Google Scholar]
  • 69. Migita C. T., Salerno J. C., Masters B. S., Martasek P., McMillan K., Ikeda-Saito M. (1997) Biochemistry 36, 10987–10992 [DOI] [PubMed] [Google Scholar]
  • 70. Adak S., Crooks C., Wang Q., Crane B. R., Tainer J. A., Getzoff E. D., Stuehr D. J. (1999) J. Biol. Chem. 274, 26907–26911 [DOI] [PubMed] [Google Scholar]
  • 71. Ray G. B., Li X. Y., Ibers J. A., Sessler J. L., Spiro T. G. (1994) J. Am. Chem. Soc. 116, 162–176 [Google Scholar]
  • 72. Spiro T. G., Wasbotten I. H. (2005) J. Inorg. Biochem. 99, 34–44 [DOI] [PubMed] [Google Scholar]
  • 73. Poulos T. L. (2005) Drug Metab. Dispos. 33, 10–18 [DOI] [PubMed] [Google Scholar]
  • 74. Ogliaro F., de Visser S. P., Shaik S. (2002) J. Inorg. Biochem. 91, 554–567 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES