Skip to main content
Molecular Therapy logoLink to Molecular Therapy
. 2010 Dec 14;19(4):711–722. doi: 10.1038/mt.2010.275

Retroviral Vectors Induce Epigenetic Chromatin Modifications and IL-10 Production in Transduced B Cells via Activation of Toll-like Receptor 2

Roxana R Ahangarani 1, Wim Janssens 1, Vincent Carlier 1, Luc VanderElst 1, Thierry VandenDriessche 2,3, Marinee Chuah 2,3, Marc Jacquemin 1, Jean-Marie Saint-Remy 1
PMCID: PMC3070090  PMID: 21157434

Abstract

The immune response toward viral vectors used for gene therapy and genetic vaccination appears to be critically important in determining the therapeutic outcome. However, the mechanisms that control the immune response following gene transfer are poorly understood. Unexpectedly, we found that integrating retroviral vector particles induce stable interleukin-10 (IL-10) production in murine (BALB/c H-2d) transduced B cells. This requires a novel mechanism whereby the interaction of retroviral vector particle with its cognate cellular receptor activates intracellular signaling pathways resulting in stable epigenetic modifications. Murine B cells exposed to retroviral vector particles triggered the colocalization of the retroviral cellular receptor [mouse cationic amino acid transporter 1 (mCAT1)] and Toll-like receptor 2 (TLR2) into lipid microrafts, which in turn activated TLR2 signaling pathways. TLR2 activation induced STAT3 phosphorylation and increased phosphorylated histone 3 (H3) at the STAT3-binding site of the IL-10 promoter. In addition, TLR2 activation during transduction activates nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, α (NFKBIA), thereby preventing the translocation of the nuclear factor-κB (NF-κB) complex to the nucleus and the transcription of proinflammatory cytokines. These findings open new perspectives for controlling immune responses following gene therapy and genetic vaccination.

Introduction

Viral vectors have been widely used for gene therapy and for genetic vaccination. However, the immune properties of viral vectors are poorly understood and appear to vary according to several confounding variables including the type of vector used, the route of administration, the nature of the transgene, and the immune status of the host.1 Viral vectors may evoke a complex immune response that involves both adaptive (cellular and humoral) and innate immune reactions directed against the viral particles themselves, the transgene product encoded by the vector and/or the gene-engineered cells. Some of these immune reactions may ultimately prevent stable expression of the potentially therapeutic protein as was shown recently in a gene therapy clinical trial for hemophilia B.2 Indeed, hepatic gene delivery of adeno-associated viral vectors encoding human coagulation factor IX, likely triggered a cellular immune response directed against the viral capsid proteins that resulted in the elimination of the transduced hepatocytes hereby curtailing long-term factor IX expression.3

Interestingly, these considerations are also relevant for genetic vaccination, as recently illustrated by the failure of an HIV vaccination trial4 based on the injection of adenoviral vectors expressing HIV antigens into subjects at high risk of contracting HIV infection. Vaccination with the adenoviral vectors offered no protection or even increased the likelihood that these high-risk individuals would become infected with HIV when presensitization to adenovirus was present, presumably by increasing the capacity of antigen-presenting cells to transmit the HIV virus into CD4+ T cells.5 Similarly, it has been shown in murine models that the persistence of adeno-associated viral vector particles can inhibit T-cell proliferation that undermines the effectiveness of adeno-associated viral prime/adenoviral boost immunization regimens. Thus these viral vectors induce functionally impaired transgene product-specific CD8+ T cells in mice.6 Hence, a better understanding of the mechanisms that control the immune response following gene transfer is warranted.

In the course of studies on induction of antigen-specific tolerance, in which we made use of Moloney murine leukemia virus-based retroviral vectors for efficient transduction of B cells, we discovered that in vitro retroviral transduction resulted in the induction of interleukin-10 (IL-10) in transduced B cells. The potential of IL-10 as an immunomodulatory cytokine and the consequences it could bear on the immune response toward both the vector and the transgene products prompted us to identify the molecular events that contributed to constitutive IL-10 production in transduced B cells.

We hereby describe a novel mechanism whereby the interaction of an integrating retroviral vector particle with its cognate cellular receptor can activate intracellular signaling pathways resulting in epigenetic modifications that stably affected the properties of the target cells. Given the immunoregulatory role of IL-10, this novel principle opens new ways for controlling untoward immune responses to transgene products and viral vector proteins.

Results

B-cell transduction results in constitutive long-term IL-10 expression

As retroviral transduction needs dividing cells, B cells were first activated with lipopolysaccharide (LPS) yielding a stable transduction efficiency of >50% in the presence of polybrene that typically enhances vector-target cell interactions after 24 hours. Retroviral vectors were pseudotyped with an ecotropic envelope and contained a transgene composed of the gp75 endosomal targeting sequence (to ensure efficient presentation in the context of major histocompatibility complex class II determinants) and the p21–35 allergen-derived T-cell epitope. To determine whether transduction had altered the phenotype of such B cells, we evaluated the production of cytokines (IL-2, IL-4, IL-5, IL-10, and tumor necrosis factor-α) after 36 hours in the supernatants by enzyme-linked immunosorbent assay. Remarkably, IL-10 was the only detectable cytokine present. The amount of IL-10 was then compared in transduced B cells with that of cells only exposed to LPS or to polybrene without viral particles. Figure 1a shows that viral transduction elicited a significant threefold (t-test: P < 0.002) increase of IL-10 production over that observed with LPS without transduction, and incubation with polybrene elicited no IL-10 production. We subsequently confirmed by intracellular staining using an anti-IL-10 antibody that 30% of actually transduced B cells (versus 11% of LPS-activated cells) contained detectable IL-10, with a fluorescence intensity of 2.5-fold higher than B cells only activated by LPS (Figure 1b). We therefore concluded that transduction per se induced IL-10 production. IL-10 was also produced in B cells transduced with retroviral vectors containing an alternative transgene (p71–85, an alternative T-cell epitope of the same allergen; Figure 1a), or green fluorescent protein (GFP) (Figure 1c) indicating that this effect was transgene independent.

Figure 1.

Figure 1

Stable production of interleukin-10 (IL-10) in lipopolysaccharides (LPS)-activated retrovirally transduced B cells. (a) Concentrations of IL-10 were evaluated by enzyme-linked immunosorbent assay (ELISA) after 36 hours culture in supernatants of resting B cells (rest), resting B cells in the presence of polybrene (polybrene), B cells activated by LPS (LPS), LPS-activated B cells exposed to the nonintegrating particles with ecotropic envelope (LPS-empty particle), p21gp75 construct (LPS-p21gp75), or the p71gp75 construct (LPS-p71gp75). Results are expressed in pg/ml. Data is shown as mean ± SD. (b) The intracellular production of IL-10 in CD19+ cells was assessed by fluorescence-activated cell sorting (FACS) in resting B cells (upper panel), LPS-activated B cells (lower panel), and B cells activated by LPS and transduced with MNDp211gp75 vector (24 hours after transduction). Percentages of cells positive for IL-10 expression are shown. (c) The intracellular production of IL-10 in CD19+ cells was assessed by FACS in B cells activated by LPS and transduced with the MND-GFP vector (12 hours after transduction). Percentages of cells positive for IL-10 expression are shown. (d) Concentrations of IL-10 were evaluated by enzyme-linked immunosorbent assay ELISA after 36 hours culture in supernatants of LPS-activated B cells exposed to the particles with ecotropic envelope (LPS-ecotropic-GFP), particles pseudotyped with alternative envelopes (LPS-amphotropic-GFP), lentiviral vectors pseudotyped with vesicular stomatitis virus G glycoprotein (LPS-VSV-G-GFP) or adeno-associated viral vectors (LPS-AAV8-GFP). Results are expressed in pg/ml. Data is shown as mean ± SD. (e) The intracellular production of IL-10 in CD19+ cells was assessed by FACS, 12 hours after transduction, in B cells activated by LPS (upper panel) and LPS-activated and transduced (12 hours after transduction) with the MND-GFP vector (middle panel), and LPS-activated and transduced with the MND-GFP vector with ecotropic envelope (middle panel), and LPS-activated and transduced with the MND-GFP vector and VSV-G envelope (lower panel). Percentages of cells positive for IL-10 expression are shown. (f) VSV-G-GFP-transduced 293T cells as observed by confocal microscopy (Zeiss CLM510; ×10 magnitude) 12 hours after transduction. Bar = 20 µm. (g) In vitro semiquantitative RT-PCR analysis for vector-specific transgene transcript. The result demonstrates presence of vector-specific transgene in p21gp75-transduced B cells from wild-type BALB/c [wild type (wt)] and IL-10 knockout (KO) mice. Marker (DNA ladder mix), (N) negative and (P) positive control. (h) Ex vivo semiquantitative RT-PCR analysis for vector-specific transgene transcript (left) or IL-10 transcript (right). The results demonstrates presence of vector-specific transgene and IL-10 transcripts in p21gp75 (4) and p71gp75 (5) transduced B cells isolated by Ficoll density gradient purification and subsequently enriched by positive selection using magnetic beads coupled with antibodies to CD19 (purity 95%), from the spleen 1 month after transduced B cell transfer, no detectable vector-specific transgene or IL-10 transcripts in mice transferred with resting B cells (1), LPS-activated B cells (2), or B cells exposed to the empty particles (3). M: MW marker (smart ladder); lanes −, +: negative and positive controls, positive controls compared to both pMND-p21gp75 and pMND-p71-85gp75 plasmid as they have the same PCR product size (left side) and synthetic double-stranded DNA for IL-10 (right side), respectively.

To confirm that IL-10 was produced by those cells that were actually transduced, we assessed the presence of intracellular IL-10 in cells expressing a GFP reporter gene. Figure 1c shows 43% of transduced GFP+ B cells produced IL-10, compared to only 4.5% in GFP, nontransduced B cells. We subsequently verified whether IL-10 was produced as a result of a mere physical contact between B cells and the viral vector particles or whether this was dependent of intracellular integration of genomic viral vector RNA or cDNA. We therefore measured IL-10 produced by LPS-activated B cells exposed to so-called nonintegrating “empty” particles that are devoid of viral genomes. Interestingly, empty particles induced comparable IL-10 levels, as those of integrating particles, suggesting that early induction of IL-10 were independent of reverse transcription or genomic integration. We also assessed the induction of IL-10 in B cells transduced with retroviral vectors pseudotyped with alternative envelopes (i.e., amphotropic envelope), lentiviral vectors pseudotyped with vesicular stomatitis virus G glycoprotein or adeno-associated viral vectors 8. None of these alternative vectors and envelopes induced IL-10 (Figure 1d). Compatible with these results fluorescence-activated cell sorting (FACS) analysis searching for GFP-fluorescent cells showed a very low transduction efficiency using vesicular stomatitis virus G glycoprotein pseudotyped vector compared with ecotropic pseudotyped in B cells (Figure 1e) after 12 hours, however, the same vesicular stomatitis virus G glycoprotein pseudotyped vector transduced 293T cells (used as a positive control) efficiently (Figure 1f).

LPS activation leads to the temporary IL-10 expression in proportion of polyclonal B cells (depend on their maturation state) purified from the spleen. To investigate that whether IL-10 expression by these LPS-activated B cells has any effect on the transduction efficiency, we transduced LPS-activated B cells from IL-10 knockout and wild-type mice with p21gp75 construct. Figure 1g shows the presence of p21gp75 transcript in both transduced B cells from IL-10 knockout and wild-type mice, ruling out the possible effect of IL-10 production of LPS-activated B cells on transduction efficiency and further IL-10 production by these cells.

To investigate further the phenotype of IL-10-producing B cells following retroviral transduction, we first checked the expression of CD5 on the p21gp75-transduced B cells. CD5 is a characteristic marker of regulatory B cells expressing IL-107 designated as B10 cells. However, in contrast to B10 cells, CD5 expression was negative in the transduced IL-10 producing B cells (data not shown). We then compared the expression of five surface activation markers by FACS analysis of resting B cells, LPS-activated and transduced B cells, and B cells only activated by LPS, respectively. LPS activation upregulated CD40 (60% of cells) and CD86 (57%) but not CD80, major histocompatibility complex-class II or CD54. Transduction further increased expression of CD40 and CD86, with 97 and 93% of transduced cells rendered positive, respectively (data not shown).

To determine whether IL-10 production induced by transduction was sustained, as opposed to a transitory increase due to LPS activation,8 a group of three naive BALB/c mice were adoptively transferred with p21gp75-transduced B cells (1.5 × 107 cells/mouse injected intravenously). B cells from the spleen (as an example of easily accessible secondary lymphoid organ) were isolated 1 month later by Ficoll density gradient purification and subsequently enriched by positive selection using magnetic beads coupled with antibodies to CD19 for semiquantitative PCR analysis. Control groups included adoptive transfer of resting B cells, LPS-activated nontransduced B cells, B cells transduced with nonintegrating viral particles, and B cells transduced with an alternative transgene, as described above. Figure 1h shows that the only B cells that expressed IL-10 transcripts were those transduced with the p21gp75 or p71gp75 retroviral vectors providing compelling evidence that the integrating transduction itself was responsible for increased IL-10 production, irrespective of the transgene. Using the same method, we found no evidence of transcripts for interferon-γ, IL-2, IL-12p40, IL-4, or IL-13 in p21gp75-transduced B cells after adoptive transfer (data not shown). Interestingly, IL-10 production by B cells exposed to nonintegrating, “empty” viral particles devoid of viral genomes was seen just in vitro as we did not find the IL-10 signal in vivo therefore we hypothesized that either viral particles devoid of viral genomes did not suffice to yield sustained IL-10 production in vivo, showing viral integration is necessary for persistence of IL-10 production, or B cells exposed to these particles were not accumulated in the spleen where we searched for IL-10 signal. To check this further we adoptively transferred SNARF-1 labeled LPS-activated B cells exposed to the empty particle to naive BALB/c mice (n = 2). A control group was added in which first recipient mice were reconstructed with SNARF-1 labeled p21gp75-transduced B cells. One month after this adoptive transfer B cells (CD19+) from the spleen of these mice were purified and checked for the presence of SNARF-1 labeled cells by FACS analysis. The result of this experiment has been shown in Figure 2a showing the absence of SNARF-1-labeled LPS-activated B cells exposed to the empty particle in contrary to the presence of p21gp75-transduced B cells in the spleen.

Figure 2.

Figure 2

Transduced B cells localize and remain within the spleen marginal zone. (a) The presence of N, N-dimethyldodecylamine-N-oxide succinimidyl ester (DDAO-SE) CD19+ cells was assessed by fluorescence-activated cell sorting (FACS) analysis in cells recovered from the spleen of mice reconstituted with naive B cells (left panel), DDAO-SE labeled p21gp75-transduced B cells (middle panel), and B cell exposed to empty particles and labeled with DDAO-SE (right panel). Percentages of cells positive for DDAO are shown. (b) Spleen as observed by confocal microscopy (Zeiss CLM510; ×20 magnitude) 3 days after intraperitoneal transfer of SNARF-1 stained transduced B cells (10–15 × 106). The white pulp is delineated by using the MOMA-1 antibody specific for metallophilic macrophages and Alexa 488-labeled goat anti-rat immunoglobulin G (IgG) (green) as secondary antibody; SNARF-1 stained cells appear in red. Bar = 50 µm. (c) The intracellular production of interleukin-10 (IL-10) in CFSE-labeled p21gp75-transduced CD19+ cells recovered from the spleen of BALB/c recipient mice three days after adoptive transfer was assessed by FACS analysis. Percentages of cells positive for IL-10 expression are shown for CFSE+ and CFSE B cells.

As sustained production of IL-10 by B cells would be particularly relevant if B cells were to locate to microenvironments where they could effectively interact with T cells, we therefore tried to further locate the integrating-transduced B cells in the spleen by adoptively transferring (intraperitoneal injection) SNARF-1-labeled transduced B cells into naive BALB/c mice. Three days after this adoptive transfer, the spleen was removed and frozen tissue sections were fixed and stained with MOMA-1 antibody, a white pulp marker. Tissue sections (Figure 2b) analyzed by fluorescence microscopy showed the localization of SNARF-1 labeled B cells (red) within the white pulp (green). This suggested that IL-10-producing B cells were located in an optimal microenvironment that fostered T–B cell interactions. We subsequently ascertained that the transduced B cells that located into the spleen also produced IL-10. We therefore labeled transduced B cells with CFSE before passive transfer to naive mice. Cells were recovered from the spleen 3 days after transfer and assessed for the presence intracellular IL-10. It showed (Figure 2c) that 15% of CFSE+ cells produced IL-10, whereas only 1% of unlabeled cells were IL-10+.

Retrovirally transduced B cells show IL-10 transcription factor-binding sites remodeling

These findings prompted us to determine how retroviral transduction increased IL-10 transcription. The latter depends on activation of STAT3 and/or Sp1 transcription factors,9,10 though the effect of none of these is limited to IL-10. Western blot analysis carried out 36 hours after transduction showed production of both STAT3 and Sp1; as compared to resting B cells and LPS-activated cells (Figure 3a). The anti-STAT3 antibody is specific for the phosphorylated form of the factor, thereby indicating its activation state. As the anti-Sp1 antibody did not distinguish between the phosphorylated and nonphosphorylated states, we carried out additional experiments in which Sp1 was treated with phosphatase. Western blots made on phosphatase-treated Sp1 showed an identical migration pattern and density as compared to untreated samples, indicating that Sp1 was not activated (Figure 3b).

Figure 3.

Figure 3

Production of interleukin-10 (IL-10) by p21gp75-transduced B cells. (a) Western blot showing the presence of Sp1 and p-STAT3 in p21gp75-transduced B cells. Nuclear protein was extracted from (A) resting, (B) lipopolysaccharides (LPS)-activated, and (C) p21gp75-transduced B cells. Sp1 and STAT3 proteins were immunoblotted with anti-Sp1 and anti-phospho-STAT3 antibodies, respectively. (b) Western blot with anti-Sp1 antibody on the nuclear extract of (A, D) resting, (B, E) LPS-activated, and (C, F) p21gp75-transduced B cells (A, B, C) before and (D, E, F) after dephosphorylation, respectively. (c) Chromatin immunoprecipitation (ChIp) analysis of histone 3 (H3) modifications at the IL-10 promoter site for STAT3 binding in resting, LPS-activated and transduced B cells. Immunoprecipitations were performed using antibodies specific to acetylated or phosphorylated H3, and conventional semiquantitative PCR was performed using primers specific for STAT3. From left: MW marker (100-bp DNA ladder); lane 1, negative control; lanes 2–4: input DNA; lanes 5–7: STAT3-specific PCR product for acetylated H3; and lanes 8–10 STAT3 transcript for phosphorylated H3. R: resting; LPS: LPS-activated; and T: transduced B cells. (d) ChIp analysis of H3 modifications at the IL-10 promoter site for Sp1 binding in resting, LPS-activated and transduced B cells. Immunoprecipitations were performed using Abs specific to acetylated or phosphorylated H3, and conventional semiquantitative PCR was performed using primers specific for Sp1. Legend as in c.

Histone 3 (H3) phosphorylation is associated with increased accessibility of binding sites for STAT3 and Sp1.11 We therefore evaluated changes in H3 phosphorylation across the IL-10 gene in transduced B cells. To this end, we generated chromatin fragments of 300 bp average sizes for high resolution profiling of histone modifications across the first 1,600 bases of the IL-10 promoter. A comparison was run between resting, nontransduced and transduced B cells for phosphorylation at serine 10 using the chromatin immunoprecipitation assay. A substantial increase in phosphorylated H3 binding was noted at STAT3-binding site (Figure 3c), but not at SP1-binding sites (Figure 3d), in transduced B-cells compared to nontransduced or resting B-cells. Hence, retroviral transduction of B cells resulted in epigenetic imprinting at the level of binding sites for IL-10 transcription factors, particularly STAT3, which reflected chromatin remodeling in the IL-10 promoter.

IL-10 induction by retroviral vectors is TLR2-dependent

The chromatin remodeling seemingly resulted from the initial contact between the viral vector particle and the cell surface. This was likely mediated by the interaction of the retroviral envelope protein with its cognate cellular receptor, mouse cationic amino acid transporter 1 (mCAT1).12 As the SU-domain of the viral envelope is a glycoprotein,13 we hypothesized that the retroviral envelope could activate Toll-like receptor 2 (TLR2). We tested this hypothesis by using blocking antibodies to TLR2 or TLR3 (as a control) before and during transduction. The production of IL-10 and its transcription as assessed by reverse transcription-PCR were completely abolished when transduced B cells were incubated with a TLR2-specific blocking antibody, but not with a TLR3-specific antibody, or control antibodies (Figure 4a,b). The production of IL-10 as a result of LPS activation of B cells (see Figure 1a) was not, or only marginally blocked by addition of TLR2-specific antibodies (Figure 4c).

Figure 4.

Figure 4

Interleukin-10 (IL-10) transcription is mediated by Toll-like receptor 2 (TLR2) signaling. (a) Concentrations of IL-10 as evaluated by enzyme-linked immunosorbent assay (ELISA) in cell supernatants. Results obtained after 24 and 48 hours are expressed in pg/ml ± SD in duplicate; B cells activated by lipopolysaccharides (LPS) and incubated in the presence of antibodies to either (A) CD180, (C) TLR3, (D) TLR2 before and during transduction with the MND-p21gp75 vector. Controls included an (B) IgG2a isotype control antibody, (E) no antibody, and (F) nontransduced LPS-activated B cells. (b) Reverse transcription-PCR (RT-PCR) analysis showing the presence of IL-10 transcripts. Lane 1: MW marker (smart ladder); lanes 2–6: HPRT for groups A to E, respectively; (−) and (+): negative and positive control for IL-10, respectively; lanes 9–13: IL-10 transcripts for groups A to E, respectively; lane 14: MW marker (100-bp DNA ladder). Positive control (+) is a part of the human IL-10 sequence DNA, which has a slightly larger MW than mouse IL-10 band. (c) B cells activated by LPS were incubated either in the presence or absence of MND-p21gp75 viral vector, empty particle or blocking antibodies to TLR2 or both, before and during transduction and concentrations of IL-10 as evaluated by BD Cytometric Bead Array Analysis in cell supernatants. Results obtained after 24 hours are expressed in pg/ml. (d) Left panel: RT-PCR analysis showing the presence of IL-10 transcripts. Lane 1: marker (DNA ladder mix); (N) and (P): negative and positive control for IL-10, respectively; lanes 1 and 3: IL-10 transcripts from mice adoptively transferred with transduced B cells; lane 2 and 4: IL-10 transcripts from mice adoptively transferred with anti-TLR2 blocking-treated transduced B cells. Positive control (P) is a part of the human IL-10 sequence DNA, which has a slightly larger MW than mouse IL-10 band. Middle panel: β-actin RT-PCR for groups 1–4, respectively. Right panel: RT-PCR analysis showing the presence of transgene (p21gp75) transcript. Lane 1: marker (DNA ladder mix); (N) and (P): negative and positive control for p21gp75, respectively; lanes 1 and 3: p21gp75 transcripts from mice adoptively transferred with transduced B cells; lane 2 and 4: p21gp75 transcripts from mice adoptively transferred with anti-TLR2 blocking-treated transduced B cells. (e) Incubation of LPS-activated B cells with different dilutions of anti-TLR2-blocking antibodies before and during transduction with viral particles encoding green fluorescent protein (GFP). Percentages of labeled cells were evaluated by fluorescence-activated cell sorting (FACS).

To determine whether TLR2 involvement in IL-10 production requires retroviral integration or not, we used blocking antibodies to TLR2 before and during the time, we exposed LPS-activated B cells to nonintegrating empty particles. The production of IL-10 as assessed by enzyme-linked immunosorbent assay was completely abolished when these B cells were incubated with a TLR2-specific blocking antibody, comparable to those from integrating-transduced B cells (Figure 4c), showing that IL-10 induction by TLR2 activation does not require retroviral integration. To further check the role of TLR2 activation, leading to epigenetic modification induction, as responsible element in persistent of IL-10 production, BALB/c mice (n = 4) were adoptively transferred with either transduced B cells or transduced B cells that were incubated with a TLR2-specific blocking antibody before and during the transduction, and a month after this adoptive transfer B cells were purified and checked for the presence of IL-10 transcript. Figure 4d comparing transduced B cells exposed to TLR2-blocking antibody or not shows that in transduced B cells exposed to TLR2-blocking antibodies before and during transduction, IL-10 transcript is absent even a month after adoptive transfer, building the fact that TLR2 involvement is responsible for the constitutive IL-10 production by transduced B cells.

The question remained whether the transduction itself was also TLR2-dependent. We therefore transduced LPS-activated B cells with retroviral vector encoding GFP, in the presence of different dilutions of the TLR2-blocking antibody. The results showed that TLR2 has no significant effect on viral transduction (Figure 4e).

A link was therefore established between the production of IL-10 and TLR2 activation. Experiments reported above showed that 1 month after transfer transduced B cells showed no transcription of proinflammatory cytokines, though IL-10 transcription was maintained at significant levels. These findings suggested that activation of nuclear factor-κB (NF-κB) was somehow inhibited. We therefore first confirmed that B cells incubated with LPS alone produced IL-6, IL-12p40, and tumor necrosis factor-α, as a reading of NF-κB activation. However upon transduction with p21gp75 retroviral vector no such cytokines were detected (data not shown), consistent with the lack of transcription of proinflammatory cytokines (ex vivo data) obtained 1 month after adoptive transfer. We next used a PCR array to determine whether components of the NF-κB complex were activated. The findings showed (Figure 5a) that B cells activated by LPS, as well as transduced B cells had increased RelB transcription, but that transduced B cells showed in addition an increased transcription of nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, α (NFKBIA), which inactivates NF-κB by trapping it in the cytoplasm (Figure 5b). This suggested that transduction inhibited the translocation of NF-κB. This was checked by determining the level of cytoplasmic versus nuclear RelB proteins. Figure 5c shows that transduced B cells, comparable to resting B cells, had only very low levels of RelB at both cytoplasmic and nucleus locations, consistent with the high induction of NFKBIA in transduced B cells, in contrast to LPS-activated B cells that showed high levels of RelB at both locations. These findings strongly suggest that transduction inhibits the translocation of NF-κB to the nucleus, thereby preventing the production of proinflammatory cytokines.

Figure 5.

Figure 5

Toll-like receptor 2 (TLR2) and nuclear factor-κB (NF-κB) activation in resting and retrovirally transduced B cells. (a) Reverse transcription-PCR (RT-PCR) analysis showing the activation of RelB transcription (as a marker for NF-κB) in lipopolysaccharides (LPS)-activated and p21gp75-transduced B cells compared to the resting B cells. (b) RT-PCR showing increase of NFKBIA (nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, α) transcription as a result of full transduction of B cells with the p21gp75 construct, as compared to LPS-activated and resting B cells. (c) Western blot showing the presence of RelB protein. Cytoplasmic (Cyt) and Nuclear (Nuc) proteins were extracted from resting, LPS-activated, and p21gp75-transduced B cells. RelB proteins were immunoblotted with anti-RelB antibody.

Retroviral vectors induce colocalization of TLR2 and mCAT1 at cell surface

To directly demonstrate a possible physical interaction between TLR2 and mCAT1, we evaluated whether the virus receptor mCAT1 was recruited into microrafts together with TLR2. To this end, we made use of fluorescein isothiocyanate (FITC)-labeled cholera toxin for its capacity to bind to sphingolipids (GM1) typically recruited in microraft,14 together with mCAT-specific and TLR2-specific antibodies. Figure 6 shows resting, nontransduced, or transduced B cells after incubation with FITC-cholera toxin, anti-mCAT1, and anti-TLR2 antibodies. In resting cells, the distribution of GM1 on the plasma membrane was homogeneous with diffuse TLR2; both in the membrane and the intracellular compartment and retroviral cellular receptor mCAT1 was not observed (Figure 6a). Likely due to low receptor density in absence of virus. In retrovirally transduced B cells, translocation of TLR2 to the membrane rafts and retroviral cellular receptor mCAT1 expression were both significantly increased (Figure 6c). Crosslinking of microrafts by addition of an anticholera toxin antibody showed that both TLR2 and mCAT1 cocapped in association with microrafts. Addition of a microraft formation inhibitor, methyl-β-cyclodextrin, fully prevented mCAT1 and TLR2 surface expression as well as IL-10 production (data not shown). These results suggested that the TLR2-dependent signaling leading to constitutive expression of IL-10 was triggered by colocalization of TLR2 with the mCAT1 receptor in microrafts following its interaction with the viral envelope.

Figure 6.

Figure 6

Toll-like receptor 2 (TLR2) and mCAT1 colocalize in microrafts upon virus transduction. B cells were labeled by incubation with fluorescein isothiocyanate (FITC)-cholera toxin (FITC-CTx, green fluorescence) for sphingolipids, anti-TLR2 antibody (red), and anti-mCAT1 antibody (blue). The upper pictures show patterns obtained with antibodies and lower pictures show patterns resulting from crossreacting sphingolipids by addition of an antibody to CTx. Columns a, b, and c show resting B cells, LPS-activated B cells, and B cells activated by LPS and transduced, respectively. The insert shows the breakdown of the upper right picture into individual staining pattern for sphingolipids, TLR2 (in red with arrows), mCAT1 (in blue with arrows), and the triple staining.

Discussion

We hereby describe a novel mechanism whereby the interaction of a retroviral vector particle with its corresponding cellular receptor can activate TLR2-dependent signaling pathways resulting in epigenetic modifications and chromatin remodeling. The demonstration that retroviral transduction ultimately results in the constitutive production of an immunosuppressive cytokine (IL-10) and inhibition of the translocation of the NF-κB complex to the nucleus, thereby preventing the production of proinflammatory cytokines, clearly opens perspectives for applications in gene therapy and gene vaccination.

IL-10 production was observed with either integrating and nonintegrating “empty” viral vector particles immediately after transduction. Yet long-term IL-10 production obviously required B cell survival, which was shown to depend on viral integration. Although not clearly understood, It is indeed possible that the retroviral RNA genome and/or the cognate double-stranded cDNA, located within the retroviral preintegration complex, is been required to trigger cellular signaling events that can promote B cell survival. However, because long-term IL-10 production was assessed on spleen cells obtained 3 months after transfer to the mouse, we cannot formally exclude that B cells exposed to empty viral vector particles were homing out of the spleen. This would require further investigation.

We have demonstrated that similar results in terms of IL-10 production can be obtained using different transgenes, showing that the effect was not transgene-related. It should be noted, however, that these transgenes were used in constructs containing a major histocompatibility complex-class II targeting sequence (gp75). Transgene expression in class II determinants could maintain B cells into secondary lymphoid organs, such as the spleen and lymph nodes, where they encounter specific T cells.15 This would provide B cells with an environment promoting survival, through cytokines and cellular interactions with T cells and antigen-presenting cells such as follicular dendritic cells. By contrast, B cells transduced with an empty particle would be distributed evenly in all lymphoid organs, depriving them from T-cell interaction. Consequently, though empty viral vector particles are fully capable of inducing IL-10 in transduced B cells, these cells may not have persisted in sufficiently high numbers in the spleen to permit detection of IL-10. Thus, the presence of a transgene encoding an antigen, which is presented in association with major histocompatibility complex-class II determinants, could maintain long-term survival of transduced, IL-10 producing B cells. This hypothesis has still to be formally tested.

These novel findings suggest that “danger signals” can be subverted by the viral vector to activate pathways that potentially lead to establish long-lasting immune unresponsiveness. Along this line, we have recently shown that the retrovirally induced IL-10 production by transduced B cells is required to establish a state of long-lasting antigen-specific immune tolerance.16 Remarkably, the relatively short-term exposure of the B cells to the integrating retroviral vector particles induced a sustained IL-10 production due to epigenetic modifications, which ultimately resulted in the constitutive production of IL-10 in vivo (for at least 3 months) after adoptive transfer of the transduced B cells. Hence, this vector-induced chromatin remodeling can be considered as a novel “secondary effect” of retroviral transduction.

There are seemingly several pathways linking TLR2 recognition and IL-10 production, depending on surface corecruitment of other TLR receptors.17 This has been studied almost exclusively in dendritic cells,18,19 however, and there is no relevant information for B cells. Peptidoglycans and lipoteichoic acid of Gram+ bacteria activate TLR2.20 By contrast, binding to TLR2 can represent an escape mechanism from host defense as shown in the present study. Our present observations are consistent with previous reports showing that peptidoglycans such as those of Candida albicans21 activate TLR2, which resulted in IL-10 production. In addition, Yersinia enterocolitica22 and Borrelia burgdorferi23 can induce immunosuppression by TLR2-dependent production of IL-10. Dendritic cells produce IL-10 by a TLR2-dependent surface binding of yeast-derived proteins.24 Chang et al. have shown that hepatitis C virus core and NS3 proteins induced tumor necrosis factor-α and IL-10 production by human macrophages, which was impaired by targeted gene-inactivation of TLR2, TLR1, and TLR6.25 However, there is no report showing a direct interaction between a viral vector protein and TLR2.

Because of the alleged importance of our findings for gene therapy and gene vaccination, we decided to analyze further how the cell surface contact with viral vectors triggered proximal signaling. One possibility was that the cellular receptor mCAT1 and TLR2 were cocapped at the cell surface. Susceptibility to murine leukemia virus is conferred by the presence of a surface receptor, mCAT1. Entry into host cells is initiated by interaction between the receptor-binding domain of the viral SU protein and the third extracellular domain of the CAT1 receptor.26 The envelope protein binds through its N-terminal end, which includes His-8 residue in the conserved SPHQ motif.13 This residue seems to be critical for triggering a series of postbinding fusion events.27 To our knowledge, however, it has not been reported that a cellular receptor for a virus/viral vector (i.e., mCAT1) could colocalize with TLR2 at the cell surface. Interestingly, TLR2-specific blocking antibodies abrogated both viral vector-induced and LPS-induced IL-10 production indicating an intriguing possibility that in such a system full TLR2 signaling is required for TLR4-induced IL-10 production. We also considered the possibility of a conformational change occurring in lipid raft structure after contact between B cell surface and viral particle envelope, which can alter the position of TLR4 activated by LPS on the surface28 in such a way as to render it susceptible to TLR2-blocking antibodies.

These findings therefore demonstrate that colocalization between a retroviral particle cognate receptor and TLR2, assembled within microrafts and possibly other receptors,21 is involved in the induction of epigenetic modifications of transcription factor-binding sites in the IL-10 promoter, which together with viral integration, results in sustained increased IL-10 transcription in vivo. LPS and viral particles synergize for the formation of cholesterol-rich microrafts at cell surface, but LPS alone is unlikely to be responsible for hyperproduction of IL-10, as LPS activation is only transient and B cells downregulate LPS-induced activation markers within 3–4 days after transfer to a host animal.29

To explore the underlying molecular mechanisms of spatiotemporal changes in chromatin remodeling along the B cell IL-10 promoter, we checked phosphorylation and acetylation of H3, which is associated with increased accessibility of binding sites for STAT3 and Sp1.11 Our results showed that histone phosphorylation closely followed both transcription factor binding and transcriptional activation (phosphorylated-STAT3), suggesting that phosphorylation but not acetylation was causally related to transcription. In other cellular systems, the phosphorylation of histones is not always associated with gene activation. In fact, histone H3 is highly phosphorylated on serine 10 on condensed chromatin during mitosis.30 Unlike the phosphorylation events associated with mitosis, however, the integrating viral particle-induced phosphorylation that we observe is specific to individual regions of the IL-10 promoter rather than uniform. More studies are required to identify the underlying mechanisms responsible for histone phosphorylation following activation. We predict that mechanisms to prolong histone phosphorylation may be exploited to manipulate B-cell IL-10 production.

The lack of production of proinflammatory cytokines after transduction, despite the use of LPS, prompted us to investigate whether the activation of NF-κB was affected. The link in between activation of TLRs and of NF-κB is well established.31 Interestingly, although the transcription of components of the NF-κB complex was clearly increased upon cell transduction, the overall effect was absence of translocation due, at least in part, to the activation of the NFKBIA, a potent suppressor of translocation.32 The precise mechanism by which this occurs remains to be further investigated, but the end result is long-term prevention of proinflammatory cytokines, as well as lack of expression of activation markers such as CD80/CD86.33 The maintenance of B cells with a tolerogenic phenotype is therefore the result of both constitutive production of IL-10 and lack of activation.

To our knowledge, this is the first demonstration establishing a link between viral vector induced IL-10 production and TLR-signaling. Based on these findings, it is tempting to speculate that viruses may have evolved mechanisms that enable viral persistence by escaping host immune defense mechanisms via subversion of TLR-signaling pathways that result in sustained production of immunomodulatory cytokines (i.e., IL-10). This hypothesis is consistent with the ability of mouse mammary tumor virus to induce IL-10 by subverting the TLR4 signaling pathway, enabling long-term viral persistence.34 Moreover, this is reminiscent of the long-term persistence of herpes viruses in an infected host due to expression of immunosuppressive viral proteins (viL10) that are structurally and functionally homologous to cellular IL-10.35 This work deserves further investigation to determine whether it could be useful for inducing long-term antigen-specific unresponsiveness.

Materials and Methods

Mice and reagents. BALB/c (H-2d) mice were obtained from the University animal facilities. B6.129P2-Il10tm1Cgn/Crl IL-10-deficient mice (backcrossed for 18 generations on the BALB/cJ background) were purchased from Charles River Laboratories (Wilmington, MA). 15-mer-peptides p21–35 and p71–85 derived from the Der p 2 sequence were purchased from Eurogentec (Liège, Belgium). Peptides sequence were CHGSEPCIIHRGKPF and NACHYMKCPLVKGQQ, respectively. Smooth lipopolysaccharide from Escherichia coli (055:B5) was purchased from Sigma (Steinheim, Germany). TaqMan probe (5′-CCG-GCC-GCT-TGG-GTG-GAG-AG) and primers set for NeoR, forward primer (GAT-GGA-TTG-CAC-GCA-GGT-T) and reverse primer (GTG-CCC-AGT-CAT-AGC-CGA-ATA) were also purchased from Eurogentec. All experimental procedures were approved by the University Ethical Committee for Animal Experiments.

Retroviral vector generation and production. The murine leukemia virus retroviral vector plasmid pMND-GFP was generated by cloning the GFP gene into the pMND-MFG-SN vector (kindly provided by Dr D. Kohn, Children's Hospital of Los Angeles, Los Angeles, CA) The chimeric construct p21gp75, encoding peptide 21–35 connected to the transmembrane and cytosolic part of gp75 (amino acid 488–539) via a linker Ser-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Gly, was made by PCR using partially overlapping primers (5′CCGGAATTCCCACC ATGGATTGCCATGGTCAGAACCATGTATCATTCATCGTGGTAAACCA TTCTCTGGTGGTTCCGGAGGTTCAGGAGGC-3′, 5′-CAGACAAGAAGCAACCCCG AAAATGGCAGCTACAAGTAACAACGCAGCCACTACAGCAATGG TAATGATGCCTCCTGAACCTCCGGAACC3′,5′GCATAGCGTTGATAGTGATA GTGAGGAGAGGCTGGTTGGCTTCATTCTTGGTGCTTCTAAA CGGATCAGACAAGAAGCAACCCCG-3′ and 5′GTATCTCTCGAGTCAGACCAT GGAGTGGTTAGGATTCGGGAGCTCCTCATAGTCCTCAGCTAGCGTT GATAGTGATCAG-3′). The pMND-p21gp75 and pMND-p71-85gp75 retroviral vectors were generated by restricting the peptide-gp75 fragment with EcoRI/XhoI and subsequent cloning into the respective sites of pMND-GFP. Stable retroviral vector producer cell lines that produced the MND-GFP, MND-p21gp75, and MND-p71-85gp75 retroviral vector particles were obtained by introducing the corresponding constructs into GPE8636 packaging cells and subsequent selection in G418 (800 µg/ml), as described previously,37 The resulting packaging cell lines, designated as GPE-MND-GFP, GPE-MND-p21gp75, and GPE-MND-p71-85gp75, were grown in Dulbecco's modified Eagle's medium (Gibco-BRL, Grand Island, NY) supplemented with 10% heat-inactivated fetal bovine serum (Gibco-BRL), 100 U/ml penicillin, 100 µg/ml streptomycin, and 200 mmol/l -glutamine (designated as D10 medium). Conditioned medium was collected over 24 hours from confluent vector producer cell lines. To produce nonintegrating particles, the packaging cell line GPE86, which produce ecotropic envelope particles devoid of viral genomes, was cultured in the same medium and was collected over 24 hours from confluent producer cell lines. These vector-containing and empty particle-containing supernatants were concentrated 200-fold using centricon ultrafiltration (Millipore, Bedford, MA). By using quantitative real-time PCR with TaqMan's set of specific primers and the probe for the amplification of neoR gene,38 vector genome copies in concentrated supernatants of packaging cell lines for the GFP, p21gp75, and p71-85gp75 constructs were established at 9 × 109, 3.9 × 1010, and 3.2 × 1010 per ml, respectively. TaqMan probe (5′-CCG-GCC-GCT-TGG-GTG-GAG-AG-3′) and primers set for neoR, forward primer (5′-GAT-GGA-TTG-CAC-GCA-GGT-T-3′) and reverse primer (5′-GTG-CCC-AGT-CAT-AGC-CGA-ATA-3′) were purchased from Eurogentec.

B-cell transduction. Murine B lymphocytes were obtained from spleens of naive BALB/c mice by Ficoll density gradient purification (Nycomed Pharma, Oslo, Norway) and subsequently enriched by positive selection using magnetic beads coupled with antibodies to CD19 (Miltenyi Biotec, Bergisch Gladbach, Germany). Since retroviral vectors can only transduce dividing cells, it was necessary to activate B cell proliferation by culturing the purified B cells in the presence of 50 µg/ml lipopolysaccharide (Sigma). Both nontransduced and transduced B cells were activated with LPS, whereas resting B cells were not activated with LPS. Purified B cells were cultured in the presence or absence of 50 µg/ml LPS in enriched RPMI medium (Life Technologies, Breda, the Netherlands), containing 10% fetal calf serum, 50 µmol/l 2-mercaptoethanol, 100 U/ml penicillin, and 100 µg/ml streptomycin. The next day, concentrated viral vector-containing supernatant (200 µl) supplemented with 6-µg/ml polybrene was added to the cells. To enhance transduction efficiency, cells were subjected to two successive rounds of centrifugation with vector-containing medium for 1 hour at 2,600 r.p.m. and 20 °C, separated by a 4 hours interval in which cells were cultured in medium without viral particles which resulted in >50% transduction efficiency.

Quantification of IL-10. IL-10 was measured in cell supernatant of transduced versus nontransduced B cells using the BD OptEIATM Set Mouse IL-10 (BD Biosciences, Erembodegem, Belgium). Intracellular IL-10 was determined using IL-10-specific antibody (clone: IES5-16E3; PE-labeled; BD Biosciences, San Diego, CA) on the CD19+-gated population. Nonspecific binding was evaluated with isotype controls. mRNA for IL-10 was purified using the QuickPrep Micro-mRNA purification kit (Amersham Biosciences, Buckinghamshire, UK). IL-10 cDNA was synthesized using the First Strand cDNA synthesis kit (Amersham Biosciences) and reverse transcription-PCR carried out using a human/mouse IL-10 PCR primer pair (R&D Systems Europe, Abingdon, UK) according to manufacturer instruction.

Phenotypic markers. Transduced B cells were tested for cell surface marker expression by direct immunofluorescence and flow cytometric analysis using antibodies conjugated to either FITC or PE (BD Biosciences). Aliquots of cells were incubated with specific antibodies to either CD19-FITC or CD-19-PE and CD40 (PE; clone 3/23), CD80 (PE; clone 16-10AI), CD54 (PE; clone 3E2), CD86 (PE; clone GL1), IA/IE (FITC; clone 2G9), CD45R/B (FITC; clone 16A), CD5.1 (Ly-1.1; FITC; clone H11-86.1). Isotype controls were included.

Western blotting. Western blotting on whole B cell lysate was performed using antibodies to Sp1 [mouse monoclonal immunoglobulin G1 (IgG1); clone: 1C6; Santa Cruz Biotechnology, Heidelberg, Germany], Phospho-Stat-3 (Tyr705; Cell Signaling Technology, Danvers, MA) and RelB (mouse monoclonal IgG1; clone: D-4; Santa Cruz Biotechnology) using NE-PER Nuclear and cytoplasmic extraction reagents (Pierce, Rockford, IL). Sonicated protein extracts were aliquoted and kept at −80 °C until usage. Protein concentration was determined with Quant-iT Protein Assay kit (Invitrogen). Aliquots of cell extracts (50–120 µg protein) were heated for 10 minutes at 70 °C in the presence of NUPAGE LDS sample buffer (Invitrogen) and NuPAGE Reducing agent (Invitrogen, Merelbeke, Belgium). Samples and Cruz Marker MW standard (Santa Cruz Biotechnology) were loaded onto the NuPAGE 4–12% Bis–Tris Gel (Invitrogen). After running the gel, proteins were transferred onto nitrocellulose membranes (Invitrolon PVDF Filter Paper Sandwich; Invitrogen) and were blocked with 5% nonfat dry milk in 50 mmol/l Tris–HCl, 0.15 mol/l NaCl, 0.05% Tween 20 buffer. The membranes were probed with antibodies described above for 1 hour and goat anti-rabbit and anti-mouse IgG-RP were used as secondary antibodies. Membranes were developed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific, Rockford, IL) detection system.

Mouse inflammation assay. The BD CBA Mouse Inflammation kit (BD Biosciences) was used to quantitatively measure IL-6, IL-10, monocyte chemoattractant protein-1, interferon-γ, tumor necrosis factor-α, and IL-12p70 protein levels.

RT2 profiler PCR arrays. Profiling expression of a panel of NF-κB genes was carried out using PCR Arrays (Tebu-Bio, Boechout, Belgium) and real-time PCR in 96-well plate including SYBR Green-optimized primer assays.

B cell homing studies

CellTrace far red N, N-dimethyldodecylamine-N-oxide succinimidyl ester (Invitrogen) labeling: p21gp75-transduced B cells or B cells exposed to the empty particle were washed twice in phosphate-buffered saline (PBS) /bovine serum albumin 0.1%, and resuspended for 15 minutes at 37 °C in PBS/bovine serum albumin 0.1% containing 2.5 µmol/l of the N, N-dimethyldodecylamine-N-oxide succinimidyl ester. Cells were transferred adoptively in naive BALB/c mice and after month the spleens were removed and splenocytes were analyzed by FACS analysis.

SNARF-1 labeling: p21gp75-transduced B cells were washed twice in PBS and resuspended for 15 minutes at 37 °C at a density of 107 cells/ml in PBS containing 12.5 nmol/l of the succinimidyl ester of SNARF-1 carboxylic acid acetate. Splenic distribution of transferred B cells was analyzed on 10-µm splenic cryostat sections fixed in acetone and stained with MOMA-1 and Alexa fluor 488-labeled goat anti-rat IgG (H+L) antibody (Molecular Probes, Eugene, OR). Immunofluorescence slides were mounted in prolong gold antifade reagent (Invitrogen) and analyzed with a Zeiss CLM510 confocal microscope using excitation between 488 and 530 nm while monitoring fluorescence emission at two wavelengths, typically 580 and 640 nm.

CSFE labeling: p21gp75-transduced B cells were washed with PBS and resuspended for 15 minutes at 37 °C at a density of 107 cells/ml in PBS containing 1 µmol/l CFSE (Vybrant CFDA SE cell tracer kit; Molecular Probe, Invitrogen, Eugene, OR). CFSE-labeled transduced cells were then washed twice with medium and resuspended in PBS. Adoptive transfer was carried out by intravenous injection of 15–20 × 106 cells per recipient BALB/c mouse. Three days later, intracellular production of IL-10 was assessed by FACS analysis of CFSE-labeled p21gp75-transduced CD19+ cells recovered from the spleen.

TLR2-blocking studies. To investigate the role of TLRs in induction of immune unresponsiveness, blocking studies were carried out. CD19 purified B cells were activated overnight by LPS and cocultured with 1 µg/106 cells antibodies to either TLR2, TLR3, CD180, or an IgG2a isotype control, respectively, for 30 minutes at 37 °C before each of the two runs used for transduction. Blocking antibodies to TLRs (clone 6C2 to mouse TLR2 and clone TLR3.7 to human TLR3), an anti-mouse CD180 (clone MHR73-11) or with an IgG2a isotype control (clone eBM2a) were purchased from BD Bioscience. Clone TLR3.7 was shown to crossreact with mouse TLR3.

Detection of TLR2, mCAT1, and lipid rafts. B cells were incubated with 8 µg/ml FITC-conjugated cholera toxin B (Sigma Aldrich, Bornem, Belgium) on ice for 10 minutes. After fixation, staining was carried out with antibodies to the mouse TLR2 (TLR2; clone: mT2.7; e-Bioscience, San Diego, CA) and to the retroviral cellular receptor mCAT1 (goat polyclonal IgG antibody; clone: c-12; Sigma). After washing, cell suspensions were incubated with Alexa 594-coupled secondary antibody for retroviral cellular receptor mCAT1 for 1 hour. The slides were examined with a Zeiss CLM510 (Zeiss, Zaventem, Belgium) confocal microscope.

Chromatin immunoprecipitation assay. Anti-Acetyl-Histone H3 (Lys 14; rabbit antiserum) and anti-Phospho-Histone H3 (serine 10; rabbit monoclonal IgG; clone: MC463) were purchased from Millipore (Billerica, MA). ChIP assays were performed following ultrasonic shearing conditions that result in DNA fragment size of ~300 bp. Remaining procedures were conducted as previously described.39 The primers used to amplify specific regions of the IL-10 promoter (Stat-3) by reverse transcription-PCR are 5′-T-CTT-CGA-GTC-TAG-GGT-CGT-ACT-3′ and 5′-CGG-AAG-TCA-CCT-TAG-CAC-TCA-GT-3′.

Acknowledgments

We acknowledge Sonia de Halleux, Gaëlle Toussaint, Abel Acosta Sanchez, and Sven Terclavers for technical assistance. This study was supported by grants from the Flemish government (VIB). The CMVB is supported by the Excellentie Financiering program of the University of Leuven. W.J. was a F.W.O doctoral fellow. R.R.A. and W.J. designed and performed the research. V.C. analyzed FACS data, L.V. adopted the vector to the specific purpose, T.V. and M.C. designed the vectors, contributed to optimizing the B-cell transductions and experimental design and to the writing of the manuscript, M.J. conceived the initial idea of using B cells, J.-M.S.-R. designed the study and wrote the manuscript. The authors declared no conflict of interest.

REFERENCES

  1. Waehler R, Russell SJ., and, Curiel DT. Engineering targeted viral vectors for gene therapy. Nat Rev Genet. 2007;8:573–587. doi: 10.1038/nrg2141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Manno CS, Pierce GF, Arruda VR, Glader B, Ragni M, Rasko JJ, et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med. 2006;12:342–347. doi: 10.1038/nm1358. [DOI] [PubMed] [Google Scholar]
  3. Mingozzi F, Maus MV, Hui DJ, Sabatino DE, Murphy SL, Rasko JE, et al. CD8(+) T-cell responses to adeno-associated virus capsid in humans. Nat Med. 2007;13:419–422. doi: 10.1038/nm1549. [DOI] [PubMed] [Google Scholar]
  4. Trumpfheller C, Finke JS, López CB, Moran TM, Moltedo B, Soares H, et al. Intensified and protective CD4+ T cell immunity in mice with anti-dendritic cell HIV gag fusion antibody vaccine. J Exp Med. 2006;203:607–617. doi: 10.1084/jem.20052005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Perreau M, Pantaleo G., and, Kremer EJ. Activation of a dendritic cell-T cell axis by Ad5 immune complexes creates an improved environment for replication of HIV in T cells. J Exp Med. 2008;205:2717–2725. doi: 10.1084/jem.20081786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Lin SW, Hensley SE, Tatsis N, Lasaro MO., and, Ertl HC. Recombinant adeno-associated virus vectors induce functionally impaired transgene product-specific CD8+ T cells in mice. J Clin Invest. 2007;117:3958–3970. doi: 10.1172/JCI33138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Yanaba K, Bouaziz JD, Matsushita T, Tsubata T., and, Tedder TF. The development and function of regulatory B cells expressing IL-10 (B10 cells) requires antigen receptor diversity and TLR signals. J Immunol. 2009;182:7459–7472. doi: 10.4049/jimmunol.0900270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gieni RS, Umetsu DT., and, DeKruyff RH. Ly1- (CD5-) B cells produce interleukin (IL)-10. Cell Immunol. 1997;175:164–170. doi: 10.1006/cimm.1996.1060. [DOI] [PubMed] [Google Scholar]
  9. Brightbill HD, Plevy SE, Modlin RL., and, Smale ST. A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages. J Immunol. 2000;164:1940–1951. doi: 10.4049/jimmunol.164.4.1940. [DOI] [PubMed] [Google Scholar]
  10. Riley JK, Takeda K, Akira S., and, Schreiber RD. Interleukin-10 receptor signaling through the JAK-STAT pathway. Requirement for two distinct receptor-derived signals for anti-inflammatory action. J Biol Chem. 1999;274:16513–16521. doi: 10.1074/jbc.274.23.16513. [DOI] [PubMed] [Google Scholar]
  11. Zhang X, Edwards JP., and, Mosser DM. Dynamic and transient remodeling of the macrophage IL-10 promoter during transcription. J Immunol. 2006;177:1282–1288. doi: 10.4049/jimmunol.177.2.1282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Masuda M, Kakushima N, Wilt SG, Ruscetti SK, Hoffman PM., and, Iwamoto A. Analysis of receptor usage by ecotropic murine retroviruses, using green fluorescent protein-tagged cationic amino acid transporters. J Virol. 1999;73:8623–8629. doi: 10.1128/jvi.73.10.8623-8629.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Panda BR, Kingsman SM., and, Kingsman AJ. Mutational analysis of the putative receptor-binding domain of Moloney murine leukemia virus glycoprotein gp70. Virology. 2000;273:90–100. doi: 10.1006/viro.2000.0397. [DOI] [PubMed] [Google Scholar]
  14. Bi K, Tanaka Y, Coudronniere N, Sugie K, Hong S, van Stipdonk MJ, et al. Antigen-induced translocation of PKC-theta to membrane rafts is required for T cell activation. Nat Immunol. 2001;2:556–563. doi: 10.1038/88765. [DOI] [PubMed] [Google Scholar]
  15. Finnegan A, Needleman B., and, Hodes RJ. Activation of B cells by autoreactive T cells: cloned autoreactive T cells activate B cells by two distinct pathways. J Immunol. 1984;133:78–85. [PubMed] [Google Scholar]
  16. Ahangarani RR, Janssens W, VanderElst L, Carlier V, VandenDriessche T, Chuah M, et al. In vivo induction of type 1-like regulatory T cells using genetically modified B cells confers long-term IL-10-dependent antigen-specific unresponsiveness. J Immunol. 2009;183:8232–8243. doi: 10.4049/jimmunol.0901777. [DOI] [PubMed] [Google Scholar]
  17. Netea MG, Van der Meer JW., and, Kullberg BJ. Toll-like receptors as an escape mechanism from the host defense. Trends Microbiol. 2004;12:484–488. doi: 10.1016/j.tim.2004.09.004. [DOI] [PubMed] [Google Scholar]
  18. Ferreira KS, Bastos KR, Russo M., and, Almeida SR. Interaction between Paracoccidioides brasiliensis and pulmonary dendritic cells induces interleukin-10 production and toll-like receptor-2 expression: possible mechanisms of susceptibility. J Infect Dis. 2007;196:1108–1115. doi: 10.1086/521369. [DOI] [PubMed] [Google Scholar]
  19. Yanagawa Y., and, Onoé K. Enhanced IL-10 production by TLR4- and TLR2-primed dendritic cells upon TLR restimulation. J Immunol. 2007;178:6173–6180. doi: 10.4049/jimmunol.178.10.6173. [DOI] [PubMed] [Google Scholar]
  20. Akira S., and, Hemmi H. Recognition of pathogen-associated molecular patterns by TLR family. Immunol Lett. 2003;85:85–95. doi: 10.1016/s0165-2478(02)00228-6. [DOI] [PubMed] [Google Scholar]
  21. Netea MG, Sutmuller R, Hermann C, Van der Graaf CA, Van der Meer JW, van Krieken JH, et al. Toll-like receptor 2 suppresses immunity against Candida albicans through induction of IL-10 and regulatory T cells. J Immunol. 2004;172:3712–3718. doi: 10.4049/jimmunol.172.6.3712. [DOI] [PubMed] [Google Scholar]
  22. Sing A, Rost D, Tvardovskaia N, Roggenkamp A, Wiedemann A, Kirschning CJ, et al. Yersinia V-antigen exploits toll-like receptor 2 and CD14 for interleukin 10-mediated immunosuppression. J Exp Med. 2002;196:1017–1024. doi: 10.1084/jem.20020908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Diterich I, Rauter C, Kirschning CJ., and, Hartung T. Borrelia burgdorferi-induced tolerance as a model of persistence via immunosuppression. Infect Immun. 2003;71:3979–3987. doi: 10.1128/IAI.71.7.3979-3987.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Dillon S, Agrawal S, Banerjee K, Letterio J, Denning TL, Oswald-Richter K, et al. Yeast zymosan, a stimulus for TLR2 and dectin-1, induces regulatory antigen-presenting cells and immunological tolerance. J Clin Invest. 2006;116:916–928. doi: 10.1172/JCI27203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Chang S, Dolganiuc A., and, Szabo G. Toll-like receptors 1 and 6 are involved in TLR2-mediated macrophage activation by hepatitis C virus core and NS3 proteins. J Leukoc Biol. 2007;82:479–487. doi: 10.1189/jlb.0207128. [DOI] [PubMed] [Google Scholar]
  26. Yoshimoto T, Yoshimoto E., and, Meruelo D. Enhanced gene expression of the murine ecotropic retroviral receptor and its human homolog in proliferating cells. J Virol. 1992;66:4377–4381. doi: 10.1128/jvi.66.7.4377-4381.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Katane M, Fujita R, Takao E, Kubo Y, Aoki Y., and, Amanuma H. An essential role for the His-8 residue of the SDF-1α-chimeric, tropism-redirected Env protein of the Moloney murine leukemia virus in regulating postbinding fusion events. J Gene Med. 2004;6:260–267. doi: 10.1002/jgm.487. [DOI] [PubMed] [Google Scholar]
  28. Nakahira K, Kim HP, Geng XH, Nakao A, Wang X, Murase N, et al. Carbon monoxide differentially inhibits TLR signaling pathways by regulating ROS-induced trafficking of TLRs to lipid rafts. J Exp Med. 2006;203:2377–2389. doi: 10.1084/jem.20060845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Dong C, Temann UA., and, Flavell RA. Cutting edge: critical role of inducible costimulator in germinal center reactions. J Immunol. 2001;166:3659–3662. doi: 10.4049/jimmunol.166.6.3659. [DOI] [PubMed] [Google Scholar]
  30. Cheung P, Allis CD., and, Sassone-Corsi P. Signaling to chromatin through histone modifications. Cell. 2000;103:263–271. doi: 10.1016/s0092-8674(00)00118-5. [DOI] [PubMed] [Google Scholar]
  31. Toubi E., and, Shoenfeld Y. Toll-like receptors and their role in the development of autoimmune diseases. Autoimmunity. 2004;37:183–188. doi: 10.1080/08916930410001704944. [DOI] [PubMed] [Google Scholar]
  32. Klein W, Tromm A, Folwaczny C, Hagedorn M, Duerig N, Epplen JT, et al. A polymorphism of the NFKBIA gene is associated with Crohn's disease patients lacking a predisposing allele of the CARD15 gene. Int J Colorectal Dis. 2004;19:153–156. doi: 10.1007/s00384-003-0531-y. [DOI] [PubMed] [Google Scholar]
  33. O'Neill SK, Cao Y, Hamel KM, Doodes PD, Hutas G., and, Finnegan A. Expression of CD80/86 on B cells is essential for autoreactive T cell activation and the development of arthritis. J Immunol. 2007;179:5109–5116. doi: 10.4049/jimmunol.179.8.5109. [DOI] [PubMed] [Google Scholar]
  34. Jude BA, Pobezinskaya Y, Bishop J, Parke S, Medzhitov RM, Chervonsky AV, et al. Subversion of the innate immune system by a retrovirus. Nat Immunol. 2003;4:573–578. doi: 10.1038/ni926. [DOI] [PubMed] [Google Scholar]
  35. Middeldorp JM, Brink AA, van den Brule AJ., and, Meijer CJ. Pathogenic roles for Epstein-Barr virus (EBV) gene products in EBV-associated proliferative disorders. Crit Rev Oncol Hematol. 2003;45:1–36. doi: 10.1016/s1040-8428(02)00078-1. [DOI] [PubMed] [Google Scholar]
  36. Markowitz D, Goff S., and, Bank A. A safe packaging line for gene transfer: separating viral genes on two different plasmids. J Virol. 1988;62:1120–1124. doi: 10.1128/jvi.62.4.1120-1124.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Janssens W, Chuah MK, Naldini L, Follenzi A, Collen D, Saint-Remy JM, et al. Efficiency of onco-retroviral and lentiviral gene transfer into primary mouse and human B-lymphocytes is pseudotype dependent. Hum Gene Ther. 2003;14:263–276. doi: 10.1089/10430340360535814. [DOI] [PubMed] [Google Scholar]
  38. Venditti G, Di Ianni M, Falzetti F, Moretti L, Di Florio S., and, Tabilio A. NeoR-based transduced T lymphocytes detected by real-time quantitative polymerase chain reaction. J Hematother Stem Cell Res. 2003;12:83–91. doi: 10.1089/152581603321210163. [DOI] [PubMed] [Google Scholar]
  39. Lucas M, Zhang X, Prasanna V., and, Mosser DM. ERK activation following macrophage FcγR ligation leads to chromatin modifications at the IL-10 locus. J Immunol. 2005;175:469–477. doi: 10.4049/jimmunol.175.1.469. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES