Abstract
Smac mimetics are potential anticancer therapeutics selectively killing cancer cells through autocrine tumor necrosis factor (TNF)-mediated apoptosis pathway. Our recent study reveal that the Smac mimetic compound 3 (SMC3)-activated NF-κB protects cancer cells against apoptosis, thus blunting SMC3’s anticancer activity. Based on our previous observations that the nutrient flavonoid luteolin potently blocks TNF-induced NF-κB activation in cancer cells, we investigated if the combination of SMC3 and luteolin would achieve a synergistic anticancer activity. The results show that luteolin had no effect on autocrine TNF but it effectively blocked SMC3-induced nuclear factor kappa B (NF-κB) activation and expression of anti-apoptotic NF-κB targets. When SMC3 and luteolin were combined in treating cancer cells derived from lung and liver tumors, the activation of TNF-dependent apoptosis was markedly sensitized and a synergistic cytotoxic effect was achieved. In addition, the SMC3 and luteolin co-treatment had marginal effect on immortalized normal human bronchial epithelial cells. The results suggest that combination of SMC3 and luteolin is an effective approach for improving the anticancer value of SMC3, which has implications in cancer prevention and therapy.
Keywords: NF-κB, Smac mimetic, luteolin, cytotoxicity, apoptosis
1. Introduction
Smac (second mitochondria-derived activator of caspase, also called direct IAP [inhibitor of apoptosis] binding protein with low pI, DIABLO) was identified as an important signal amplifier for the intrinsic (mitochondrial) apoptosis pathway [Chai et al., 2000; Du et al., 2000; Verhagen et al., 2000]. When the intrinsic apoptosis pathway is initiated, the mitochondrial protein Smac is released to the cytosol where it suppresses the inhibitor of apoptosis protein (IAP) family members c-IAP1, c-IAP2, and XIAP so as to release the brake for apoptosis [Chai et al., 2000; Du et al., 2000]. Many cancer cells have acquired resistance to apoptosis. Thus, to lower the apoptosis threshold by modulation of apoptosis-regulating molecules such as Smac is a potential approach for improving anticancer chemo- or radiotherapy [Hanahan and Weinberg, 2000; Wu et al., 2007]. Several Smac mimetics have been developed and shown to have an anticancer property. Interestingly, the anticancer activity of Smac mimetics appears to be executed mainly through induction of autocrine tumor necrosis factor (TNF)-mediated activation of the extrinsic apoptosis pathway [Bertrand et al., 2008; Petersen et al., 2007; Varfolomeev et al., 2007; Vince et al., 2007], although other cancer cell-killing mechanisms may also be utilized [Bank et al., 2008; Lu et al., 2008].
Besides triggering apoptosis, Smac mimetics also activate nuclear factor kappa B (NF-κB), a cell survival signal that protects cells against death [Aggarwal, 2003; Varfolomeev et al., 2007; Vince et al., 2007]. Our recent studies unveil that Smac mimetic compound 3 (SMC3), a Smac mimetic with a potent anticancer activity in a variety of tumor cells, activates NF-κB through autocrine TNF; and subsequently NF-κB upregulates expression of anti-apoptotic genes such as Bcl-XL and MnSOD to attenuate the anticancer activity of the Smac mimetic. Thus, blocking the SMC3-induced NF-κB activation would be an effective approach to improve the anticancer activity of SMC3 [Bai et al., 2009], akin to sensitizing cancer cells to TNF-induced apoptosis using NF-κB blocking agents [Karin, 2008; Wang et al., 2006; Wang and Lin, 2008].
Luteolin (3′,′,5,7-tetrahydroxyflavone), a common flavonoid found in many plant types such as fruits, vegetables, and medicinal herbs, has been shown to have various anti-inflammation, anti-allergy, and anticancer biological effects [Lin et al., 2008; Lopez-Lazaro, 2009; Seelinger et al., 2008]. Recent studies have attributed the anticancer property of luteolin at least partly to its NF-κB blocking activity [Lin et al., 2008]. In addition, luteolin functions as an anticancer adjunct. For example, luteolin potently blocked TNF-induced NF-κB activation, but it had little effect on the apoptosis signaling pathway activated by TNF, thereby shifting the cellular signaling balance to the side of cell death [Ju et al., 2007; Shi et al., 2004]. Thus, luteolin could be used to sensitize TNF-induced apoptosis in cancer cells.
Because NF-κB blunts the anticancer activity of the SMC3 and luteolin functions as an effective NF-κB blocker, we examined whether a combination of luteolin and SMC3 could achieve increased cancer cell killing activity. The results showed that although luteolin did not interfere with autocrine TNF, it potently blocked SMC3-induced NF-κB activation, resulting in a synergistic cytotoxicity in cancer cells. This observation implies that the combination of luteolin and SMC3 is an effective approach to anticancer chemotherapy.
2. Materials and Methods
2.1. Reagents and antibodies
SMC3 was a generous gift from Dr. Xiaodong Wang, University of Texas Southwest Medical Center. Luteolin was from Cayman Chemical (Ann Arbor, MI). The following antibodies were used for Western blot: anti-caspase-8 and -caspase-3 (Pharmingen, San Diego, CA), anti-PARP (BioSource, Camarillo, CA), anti-Bcl-XL (Cell Signaling, Beverly, MA), anti-MnSOD (BD Biosciences, San Diego, CA), anti-β-tubulin (Sigma, St. Louis, MO). The human TNF detection ELISA kit was purchased from eBioscience (San Diego, CA).
2.2 Cell culture
The human lung cancer cell line H23, and human hepatoma cell lines HepG2 and Huh7 were obtained from American Type Culture Collection (Manassas, VA). H23 cells were grown in RPMI 1640 with 10% fetal bovine serum, 1 mmol/L glutamate, 100 units/ml penicillin, and 100 μg/ml streptomycin. HepG2 and Huh7 cells were cultured in DMEM with 4.5 g/L glucose, 10% fetal bovine serum, 1 mmol/L glutamate, 100 units/ml penicillin, and 100 μg/ml streptomycin. HCCBE-2 and -3 are human bronchial epithelial cells immortalized by insertion of cyclin-dependent kinase 4 and human telomerase reverse transcriptase [Ramirez et al., 2004], a gift from Drs. Jerry Shay and John Minna (University of Texas Southwestern Medical Center) and cultured in keratinocyte serum-free medium in collagen-coated plates.
2.3 Cytotoxicity assay
Cytotoxicity was determined using a lactate dehydrogenase (LDH) release-base cytotoxicity detection kit (Promega, Madison, WI). Cells were seeded in 48-well plates at 70–80% confluence. After culture overnight, cells were treated as indicated in each figure legend. LDH release was determined and cell death was calculated as described previously [Chen et al., 2007; Ju et al., 2007]. In order to morphologically study cell death, H23 cells were cultured on cover slides and pretreated with luteolin (20 μM) for 30 min followed by SMC3 (10 nM) treatment for 16 h or remained untreated. Cells were stained with 50 μg/ml of acridine orange and 50 μg/ml ethidium bromide (EB), and immediately visualized and photographed under a fluorescent microscope [Lin et al., 2004].
2.4 Measurement of autocrine TNF secretion by ELISA
Cells were plated onto 12-well plates at 70–80% confluence. After culture overnight, cells were treated as described in the figure legends. The culture media were collected and the concentration of TNF was detected by ELISA analysis with the human TNF-α ELISA kit following the instruction of the manufacturer (eBioscience Inc.) [Bai et al., 2009].
2.5 Western blot
Cells were harvested and lysed in M2 buffer (20 mM Tris-Hcl, pH7.6; 0.5% NP-40; 250 mM NaCl; 3 mM EGTA; 3 mM EDTA; 2 mM DTT; 0.5 mM phenylmethylsulfonyl fluoride; 20 mM b-glycerophosphate; 1 mM sodium vanadate; and 1 μg/ml leupeptin). Equal amounts of protein extracts were resolved in 12% SDS-PAGE and the proteins of interest were probed by Western blot and visualized by enhanced chemiluminescence according manufacturer’s instructions (Amersham, Piscataway, NJ) [Lin et al., 2006; Wang et al., 2007].
2.6 Transfection and luciferase report assay
Cells grown in 24-well plates were transfected with p5×κB-Luc and pRSV-LacZ with FuGENE 6 according to manufacturer’s instruction (Roche, Indianapolis, IN). Twenty-four hours after transfection, cells were treated as indicated in each figure legend. Luciferase activity was measured using a luciferase assay kit (Promega ) and normalized to β-galactosidase activity [Lin et al., 1999].
2.7 Reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was extracted with the RNAeasy kit (Qiagen, Valencia, CA). One microgram of RNA from each sample was used as a template for cDNA synthesis with a reverse transcription kit (Promega). An equal volume of cDNA product was used in the PCR. The primers used were: MnSOD, AGTTGCTGGAAGCCATCAAACGTG and TAAGGCCTGTTGTTCCTTGCAGTG; Bcl-XL, TGGGCTCACTCTTCAGTCGGAAAT and ATGTAGTGGTTCTCCTGGTGGCAA; and β-actin, CCAGCCTTCCTTCCTGGGCAT and AGGAGCAATGATCTTGATCTTCATT. The reaction condition was 94°C, 45 s; 55°C, 40 s; and 72°C, 45 s. For MnSOD, Bcl-XL, and β-actin, the cycles for PCR were 25, 27 and 21, respectively. PCR products were run on 2% agarose gel with 0.5 μg/ml ethidium bromide, visualized, and photographed.
2.8 Statistical analysis
Data are expressed as means ± standard deviation (S.D. Statistical significance was examined by one-way analysis of variance (ANOVA) pairwise comparison. To assess the potential for interactions between factors, we included interaction terms in the models. When tests indicated an interaction, 95% confidence intervals for the differences in means were obtained to assess the magnitude of the interaction. In all analyses, P < 0.05 was considered statistically significant.
3. Results
3.1 Luteolin does not interfere with SMC3-induced autocrine TNF
Our recent study found that SMC3-induced autocrine TNF is independent of NF-κB, and NF-κB attenuates SMC3-induced cell death. Thus, blockage of NF-κB could enhance the cancer cell killing efficacy of SMC3 [Bai et al., 2009]. Considering that luteolin is a potent NF-κB blocker, we hypothesized that this flavonoid could be an adjunct agent in sensitizing SMC3’s anticancer activity. In order to augment SMC3-induced cytotoxicity, luteolin should not suppress autocrine TNF triggered by SMC3. Therefore, we first investigated if luteolin affects the SMC3-triggered TNF secretion from H23 and HepG2 cells, two SM-responsive cell lines derived from distinct human tumors. The results show that regardless of the presence of luteolin, SMC3 equally increased the TNF in culture media at all the tested time points (Fig. 1A and 1B). Notably, luteolin by itself did not induce autocrine TNF (Fig. 1A and 1B). These results indicate that luteolin has no inhibitory effect on SMC3-induced TNF secretion, an essential process for tumor cell apoptosis triggered by this Smac mimetic compound.
Figure 1. Luteolin has no effect on SMC3-induced TNF secretion.
A, H23 (A) or HepG2 (B) cells were pretreated with luteolin (20 μM) for 30 min follow by SMC3 (50 nM) for the indicated times or left untreated (0 min). The concentrations of TNF in cell culture media were measured by ELISA.
3.2 Luteolin efficiently blocks NF-κB activation induced by SMC3
Next, the effect of luteolin on SMC3-induced NF-κB activation in H23 and HepG2 cells was examined. SMC3 potently activated NF-κB in both cell lines, which was detected by a reporter assay with an NF-κB -responsive luciferase reporter (Fig. 2A). Inclusion of luteolin markedly blocked the NF-κB activity induced by SMC3 (Fig. 2A). Similarly, the SMC3-stimulated expression of the two representative NF-κB target anti-apoptotic genes Bcl-XL and MnSOD was also completely suppressed by luteolin (Fig. 2B, 2C). Remarkably, expression of both the mRNA and protein levels of these genes was effectively suppressed by luteolin, suggesting that the downregulation of these anti-apoptotic factors is through blocking SMC3-induced NF-κB transcriptional activity.
Figure 2. Luteolin blocks SMC3-induced NF-κB activation.
A, H23 and HepG2 cells were cotransfected with p5×κB-Luc and pRSV-LacZ. Twenty-four hours after transfection the cells were pretreated with luteolin (20 μM) for 30 min followed by SMC3 treatment (10 nM for H23 and 25nM for HepG2 cells) for 24 h or left untreated. Luciferase activity was detected and normalized to β-galactosidase activity. Data shown are the mean ± S.D. * P < 0.01. B, H23 and HepG2 cells were pretreated with luteolin (20 uM) for 30 min followed by SMC3 treatment (10 nM for H23 and 25 nM for HepG2 cells) for 6 h or left untreated. TNF mRNA was detected by RT-PCR. β-actin was detected as an input control. C, H23 and HepG2 cells were treated as in B. Bcl-XL and MnSOD proteins were detected by Western blot. β-Tubulin was detected as an input control.
3.3 Luteolin potentiates SMC3-induced apoptosis pathway
The TNF-induced NF-κB pathway in cancer cells is dominant over the apoptosis pathway, resulting in cancer cell survival and proliferation in response to TNF. Thus, blocking the NF-κB pathway would release the apoptosis brake to ensure the initiation of TNF-induced apoptosis [Balkwill, 2009; Wang and Lin, 2008]. We then examined the activation of caspase-8, the initiator caspase that is recruited and activated at the TNF receptor 1 signaling complex by SMC3 and luteolin. In H23 cells, SMC3 alone induced a weak and slow (at 24 h post-treatment) activation of caspase-8, which was detected by Western blot as the appearance of the cleaved active form of caspase-8 (p43/36 and p23). When luteolin was included, the activation of caspase-8 was significantly stronger and faster (began at 8 h post treatment). The subsequent activation of the effector caspase-3 and cleavage of the caspase-3 substrate PARP was also dramatically enhanced (Fig. 3A). Remarkably, SMC3 selectively eliminated c-IAP1 while it had a marginal effect on c-IAP2 expression, whereas luteolin had no detectable effect on these two IAP proteins (Fig. 3A). Although under the experimental conditions SMC3-induced caspase-8 activation was too weak to be detected in HepG2 cells, the combined treatment with SMC3 and luteolin dramatically activated caspase-8 and downstream caspase-3 (Fig. 3B). Furthermore, sub-G1 distribution, which reflects apoptosis, was significantly increased when cells were treated with SMC3 plus luteolin (Fig. 3C). In addition, apoptotic cell death was detected morphologically by acridine orange and EB staining. The combination of SMC3 and luteolin dramatically increased cell death and the dead cells exerted typical apoptotic features (data not shown). These results suggest that luteolin is able to sensitize SMC3-induced apoptosis in both H23 and HepG2 cells.
Figure 3. Luteolin potentiates SMC3-induced apoptosis.
A, H23 cells were pretreated with 20 μM of luteolin for 30 min or left untreated and followed by SMC3 treatment (10 nM) for the indicated time periods. Caspase-8, PARP, activated caspase-3, c-IAP1, and c-IAP2 were detected by Western blot. β-Tubulin was detected as an input control. B, HepG2 cells were treated with 20 μM of luteolin for 30 min or left untreated and followed by SMC3 treatment (25 nM) for the indicated time periods. Caspase-8, PARP, and activated caspase-3 were detected by Western blot. β-Tubulin was detected as an input control. C. H23 cells were pretreated with 20 μM of luteolin for 30 min or left untreated and followed by SMC3 treatment (10 nM) for 16 h. The cells were stained with propidium iodide (100 μg/ml) for 30 min and detected by flow cytometry.
3.4. Synergic cytotoxicity is induced by combined treatment with SMC3 and luteolin
Next we examined whether co-treatment of luteolin and SMC3 result in enhanced cytotoxicity in cancer cells by detecting LDH release. We first treated H23 cells with an increasing concentration of luteolin and a fixed SMC3 dose (10 nM). SMC3 alone caused little cell death (<10%). However, a dramatic increase in cell death was detected when increasing concentrations of luteolin were included. Consistently, a potentiated cytotoxicity was seen with a fixed luteolin concentration and increased concentrations of SMC3 (Fig. 4A, 4B). A similar observation also was also made in HepG2 and Huh7 cells (Fig. 4C). The substantial increase in cytotoxicity in luteolin/SMC3 compared to SMC3 or luteolin alone was significantly higher than would be expected under an additive model, indicating a significant synergy (P < 0.001 for all cell lines). In addition, an MTT assay was employed to detect cell viability, which showed results consistent with that of the LDH release assay (data not shown). These results suggest that combined treatment with luteolin and SMC3 could achieve a synergistic anticancer activity. Interestingly, in the two immortalized human bronchial epithelial cell lines (HCCBE-2 and HCCBE-3), SMC3 and luteolin combination did not cause detectable cytotoxicity (Fig. 4D), suggesting that co-treatment of SMC3 and luteolin selectively kill malignant cells.
Figure 4. Synergistic cytotoxicity is induced by SMC3 plus luteolin co-treatment in cancer but not untransformed cells.
A, H23 cells were pretreated with luteolin (5–40 μM) for 30 min or remained untreated and followed by exposure to SMC3 (10 nM) for 36 h. Cell death was measured with an LDH release assay kit. B, H23 cells were pretreated with luteolin (20 μM) for 30 min or remained untreated and followed by exposure to SMC3 (1–25 nM) for 36 h. Cell death was measured as described in A. C, HepG2 and Huh-7 cells were pretreated with 20 μM of luteolin for 30 min followed by 25 nM of SMC3 treatment for 36 h. Cell death was measured as described in A. D, HCCBE-2 and HCCBE-3 cells were pretreated with luteolin (40 μM) for 30 min followed by 36 h of treatment with 25 nM of SMC3. Cell death was measured as described in A.
3.5 The potentiated cytotoxicity by SMC3 and luteolin co-treatment is TNF-dependent
Finally, we examined whether the synergistic cytotoxicity caused by SMC3 and luteolin co-treatment is through potentiating autocrine TNF-induced apoptosis. A TNF neutralizing antibody was used to block the function of secreted TNF from H23 cells. Consistent with previous reports that cell death induced by SMC3 alone was dramatically inhibited by pretreatment with the TNF neutralizing antibody [Bai et al., 2009; Petersen et al., 2007], the synergism in cell death by SMC3 and luteolin was also abolished by the TNF neutralizing antibody. As a negative control, the control antibody had no effect on SMC3 and luteolin-induced cytotoxicity (Fig. 5). Together with the results shown in Fig. 3, this observation further supports the finding that the synergistic cancer cell killing by the SMC3 and luteolin combination is mainly through sensitization of autocrine TNF-induced apoptosis.
Figure 5. Blocking SMC3-induced TNF secretion suppresses SMC3 plus luteolin co-treatment-induced cytotoxicity.
H23 cells were pretreated with 20 μM luteolin for 30 min, TNF neutralizing antibodies (1 μg/ml), or control antibody (1 μg/ml) for 1 h, followed by SMC3 (10 nM) treatment for 36 h. Cell death was measured by LDH leakage assay.
4. Discussion
In this report, we provide evidence validating the hypothesis that luteolin can sensitize SMC3-induced cancer cell apoptosis through blocking the NF-κB pathway. We found that luteolin does not interfere with SMC3-induced autocrine TNF that is essential for apoptosis caused by this Smac mimetic. However, luteolin potently blocked SMC3-induced NF-κB activation, and the co-treatment of luteolin and SMC3 resulted in potentiated apoptosis and a synergistic cytotoxicity in cancer cells. The results suggest that combination of luteolin and SMC3 could be an effective approach for anticancer chemotherapy. Similar to other anticancer drugs, combining SMC3 with other drugs such as luteolin would increase their therapeutic effect while reducing their doses in order to minimize adverse effects [Mabuchi et al., 2004; Maschek et al., 2004].
Our recent work found that the process of SMC3-induced autocrine TNF is independent of NF-κB activation and NF-κB plays a negative role in attenuating SMC3-induced cytotoxicity [Bai et al., 2009]. The fact that NF-κB is distinctively required for cell survival but not death during cancer cells’ response to SMC3 provides an opportunity to sensitize the anticancer activity of SMC3 by shutting off the NF-κB pathway. Indeed, directly targeting key mediators of the TNF-induced NF-κB activation pathway, such as IKKβ or the NF-κB RelA subunit, dramatically potentiated SMC3-induced cytotoxicity in a variety of cancer cells [Bai et al., 2009]. In addition, in the lung cancer cell line A549, which does not secret TNF and is resistant to SMC3-induced death, the combination of SMC3, TNF, and luteolin caused substantial cytotoxicity (data not shown). Taken together with our previous observation that luteolin sensitizes TNF-induced apoptosis in A549 cells through blocking the NF-κB pathway, these results fully support our hypothesis that blocking NF-κB with luteolin sensitizes SMC3-induced cell death. The observations suggest that the combination of other anticancer drugs that have NF-κB inhibition properties will achieve potentiated anticancer activity. In this study, we show clearly that the combination of luteolin and SMC3 is able to reach this goal. The blockage of SMC3-induced NF-κB activation by luteolin may underlie the main mechanism of the synergistic cytotoxicity caused by these two agents, although other mechanisms are not excluded [Leung et al., 2005; Lin et al., 2008].
Luteolin blocks TNF-induced NF-κB activation through a mechanism that required accumulation of the reactive oxygen species (ROS) superoxide [Ju et al., 2007]. This process does not affect the early steps of NF-κB activation, such as activation of IKK and degradation of IκB, but suppresses NF-κB-triggered expression of anti-apoptotic genes [Ju et al., 2007; Shi et al., 2004]. Although our previous studies demonstrated that induction of autocrine TNF is independent of either transcription or translation, the signal leading to this process has not been revealed [Bai et al., 2009; Wang et al., 2008]. The results in this report show that the SMC3-induced autocrine TNF is not affected by luteolin, a strong ROS inducer in cancer cells [Ju et al., 2007], suggesting that the change of the cellular redox status is unlikely involved in SMC3-stimulated TNF secretion.
We further found that SMC3 and luteolin, alone or in combination, caused no detectable cytotoxicity in immortalized human bronchial epithelial cells, suggesting the approach of combining these two drugs has relatively low toxicity in normal or untransformed cells. Because luteolin is rich in diets and is implicated to be preventive against cancer [Lin et al., 2008; Seelinger et al., 2008], combining SMC3 with luteolin may also be used in cancer prevention. The results shown here warrant further animal experiments to validate the cancer therapy and prevention values of combining these potential anticancer agents in vivo.
Acknowledgments
Contract grant sponsors: NCI/NIH; DOE Low Dose Radiation Research Program
Contract grant numbers: NCI/NIH, R03CA125796; DOE, 02-09ER64783
We thank Dr. Xiaodong Wang for providing the Smac mimetic compound 3 and Dr. Chris Stidley for help in statistical analyses, respectively, and V. Fisher for editing the manuscript.
Abbreviations
- EB
ethidium bromide
- IAP
inhibitor of apoptosis protein
- LDH
lactate dehydrogenase
- NF-κB
nuclear factor B
- Smac
second mitochondria-derived activator of caspase
- SMC3
Smac mimetic compound 3
- ROS
reactive oxygen species
- RT-PCR
reverse transcriptase polymerase chain reaction
- TNF
tumor necrosis factor
References
- Aggarwal BB. Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol. 2003;3:745–56. doi: 10.1038/nri1184. [DOI] [PubMed] [Google Scholar]
- Bai L, Chen W, Wang X, Tang H, Lin Y. IKK{beta}-mediated nuclear factor-{kappa}B activation attenuates smac mimetic-induced apoptosis in cancer cells. Mol Cancer Ther. 2009;8:1636–45. doi: 10.1158/1535-7163.MCT-09-0068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Balkwill F. Tumour necrosis factor and cancer. Nat Rev Cancer. 2009;9:361–71. doi: 10.1038/nrc2628. [DOI] [PubMed] [Google Scholar]
- Bank A, Wang P, Du C, Yu J, Zhang L. SMAC mimetics sensitize nonsteroidal anti-inflammatory drug-induced apoptosis by promoting caspase-3-mediated cytochrome c release. Cancer Res. 2008;68:276–84. doi: 10.1158/0008-5472.CAN-07-5242. [DOI] [PubMed] [Google Scholar]
- Bertrand MJ, Milutinovic S, Dickson KM, Ho WC, Boudreault A, Durkin J, Gillard JW, Jaquith JB, Morris SJ, Barker PA. cIAP1 and cIAP2 facilitate cancer cell survival by functioning as E3 ligases that promote RIP1 ubiquitination. Mol Cell. 2008;30:689–700. doi: 10.1016/j.molcel.2008.05.014. [DOI] [PubMed] [Google Scholar]
- Chai J, Du C, Wu JW, Kyin S, Wang X, Shi Y. Structural and biochemical basis of apoptotic activation by Smac/DIABLO. Nature. 2000;406:855–62. doi: 10.1038/35022514. [DOI] [PubMed] [Google Scholar]
- Chen W, Wang X, Zhuang J, Zhang L, Lin Y. Induction of death receptor 5 and suppression of survivin contribute to sensitization of TRAIL-induced cytotoxicity by quercetin in non-small cell lung cancer cells. Carcinogenesis. 2007;28:2114–21. doi: 10.1093/carcin/bgm133. [DOI] [PubMed] [Google Scholar]
- Du C, Fang M, Li Y, Li L, Wang X. Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell. 2000;102:33–42. doi: 10.1016/s0092-8674(00)00008-8. [DOI] [PubMed] [Google Scholar]
- Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57–70. doi: 10.1016/s0092-8674(00)81683-9. [DOI] [PubMed] [Google Scholar]
- Ju W, Wang X, Shi H, Chen W, Belinsky SA, Lin Y. A critical role of luteolin-induced reactive oxygen species in blockage of tumor necrosis factor-activated nuclear factor-kappaB pathway and sensitization of apoptosis in lung cancer cells. Mol Pharmacol. 2007;71:1381–8. doi: 10.1124/mol.106.032185. [DOI] [PubMed] [Google Scholar]
- Karin M. The IkappaB kinase - a bridge between inflammation and cancer. Cell Res. 2008;18:334–42. doi: 10.1038/cr.2008.30. [DOI] [PubMed] [Google Scholar]
- Leung HW, Wu CH, Lin CH, Lee HZ. Luteolin induced DNA damage leading to human lung squamous carcinoma CH27 cell apoptosis. Eur J Pharmacol. 2005;508:77–83. doi: 10.1016/j.ejphar.2004.12.032. [DOI] [PubMed] [Google Scholar]
- Lin Y, Choksi S, Shen HM, Yang QF, Hur GM, Kim YS, Tran JH, Nedospasov SA, Liu ZG. Tumor necrosis factor-induced nonapoptotic cell death requires receptor-interacting protein-mediated cellular reactive oxygen species accumulation. J Biol Chem. 2004;279:10822–8. doi: 10.1074/jbc.M313141200. [DOI] [PubMed] [Google Scholar]
- Lin Y, Devin A, Rodriguez Y, Liu ZG. Cleavage of the death domain kinase RIP by caspase-8 prompts TNF-induced apoptosis. Genes Dev. 1999;13:2514–26. doi: 10.1101/gad.13.19.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin Y, Shi R, Wang X, Shen HM. Luteolin, a flavonoid with potential for cancer prevention and therapy. Curr Cancer Drug Targets. 2008;8:634–46. doi: 10.2174/156800908786241050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin Y, Yang Q, Wang X, Liu ZG. The essential role of the death domain kinase receptor-interacting protein in insulin growth factor-I-induced c-Jun N-terminal kinase activation. J Biol Chem. 2006;281:23525–32. doi: 10.1074/jbc.M601487200. [DOI] [PubMed] [Google Scholar]
- Lopez-Lazaro M. Distribution and biological activities of the flavonoid luteolin. Mini Rev Med Chem. 2009;9:31–59. doi: 10.2174/138955709787001712. [DOI] [PubMed] [Google Scholar]
- Lu J, Bai L, Sun H, Nikolovska-Coleska Z, McEachern D, Qiu S, Miller RS, Yi H, Shangary S, Sun Y, Meagher JL, Stuckey JA, Wang S. SM-164: a novel, bivalent Smac mimetic that induces apoptosis and tumor regression by concurrent removal of the blockade of cIAP-1/2 and XIAP. Cancer Res. 2008;68:9384–93. doi: 10.1158/0008-5472.CAN-08-2655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mabuchi S, Ohmichi M, Nishio Y, Hayasaka T, Kimura A, Ohta T, Saito M, Kawagoe J, Takahashi K, Yada-Hashimoto N, Sakata M, Motoyama T, Kurachi H, Tasaka K, Murata Y. Inhibition of NFkappaB increases the efficacy of cisplatin in in vitro and in vivo ovarian cancer models. J Biol Chem. 2004;279:23477–85. doi: 10.1074/jbc.M313709200. [DOI] [PubMed] [Google Scholar]
- Maschek G, Savaraj N, Priebe W, Braunschweiger P, Hamilton K, Tidmarsh GF, De Young LR, Lampidis TJ. 2-deoxy-D-glucose increases the efficacy of adriamycin and paclitaxel in human osteosarcoma and non-small cell lung cancers in vivo. Cancer Res. 2004;64:31–4. doi: 10.1158/0008-5472.can-03-3294. [DOI] [PubMed] [Google Scholar]
- Petersen SL, Wang L, Yalcin-Chin A, Li L, Peyton M, Minna J, Harran P, Wang X. Autocrine TNFalpha Signaling Renders Human Cancer Cells Susceptible to Smac-Mimetic-Induced Apoptosis. Cancer Cell. 2007;12:445–456. doi: 10.1016/j.ccr.2007.08.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramirez RD, Sheridan S, Girard L, Sato M, Kim Y, Pollack J, Peyton M, Zou Y, Kurie JM, Dimaio JM, Milchgrub S, Smith AL, Souza RF, Gilbey L, Zhang X, Gandia K, Vaughan MB, Wright WE, Gazdar AF, Shay JW, Minna JD. Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res. 2004;64:9027–34. doi: 10.1158/0008-5472.CAN-04-3703. [DOI] [PubMed] [Google Scholar]
- Seelinger G, Merfort I, Wolfle U, Schempp CM. Anti-carcinogenic effects of the flavonoid luteolin. Molecules. 2008;13:2628–51. doi: 10.3390/molecules13102628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi RX, Ong CN, Shen HM. Luteolin sensitizes tumor necrosis factor-alpha-induced apoptosis in human tumor cells. Oncogene. 2004;23:7712–21. doi: 10.1038/sj.onc.1208046. [DOI] [PubMed] [Google Scholar]
- Varfolomeev E, Blankenship JW, Wayson SM, Fedorova AV, Kayagaki N, Garg P, Zobel K, Dynek JN, Elliott LO, Wallweber HJ, Flygare JA, Fairbrother WJ, Deshayes K, Dixit VM, Vucic D. IAP Antagonists Induce Autoubiquitination of c-IAPs, NF-kappaB Activation, and TNFalpha-Dependent Apoptosis. Cell. 2007;131:669–81. doi: 10.1016/j.cell.2007.10.030. [DOI] [PubMed] [Google Scholar]
- Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ, Vaux DL. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell. 2000;102:43–53. doi: 10.1016/s0092-8674(00)00009-x. [DOI] [PubMed] [Google Scholar]
- Vince JE, Wong WW, Khan N, Feltham R, Chau D, Ahmed AU, Benetatos CA, Chunduru SK, Condon SM, McKinlay M, Brink R, Leverkus M, Tergaonkar V, Schneider P, Callus BA, Koentgen F, Vaux DL, Silke J. IAP Antagonists Target cIAP1 to Induce TNFalpha-Dependent Apoptosis. Cell. 2007;131:682–93. doi: 10.1016/j.cell.2007.10.037. [DOI] [PubMed] [Google Scholar]
- Wang L, Du F, Wang X. TNF-alpha induces two distinct caspase-8 activation pathways. Cell. 2008;133:693–703. doi: 10.1016/j.cell.2008.03.036. [DOI] [PubMed] [Google Scholar]
- Wang X, Chen W, Lin Y. Sensitization of TNF-induced cytotoxicity in lung cancer cells by concurrent suppression of the NF-kappaB and Akt pathways. Biochem Biophys Res Commun. 2007;355:807–12. doi: 10.1016/j.bbrc.2007.02.030. [DOI] [PubMed] [Google Scholar]
- Wang X, Ju W, Renouard J, Aden J, Belinsky SA, Lin Y. 17-allylamino-17-demethoxygeldanamycin synergistically potentiates tumor necrosis factor-induced lung cancer cell death by blocking the nuclear factor-kappaB pathway. Cancer Res. 2006;66:1089–95. doi: 10.1158/0008-5472.CAN-05-2698. [DOI] [PubMed] [Google Scholar]
- Wang X, Lin Y. Tumor necrosis factor and cancer, buddies or foes? Acta Pharmacol Sin. 2008;29:1275–88. doi: 10.1111/j.1745-7254.2008.00889.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu H, Tschopp J, Lin SC. Smac mimetics and TNFalpha: a dangerous liaison? Cell. 2007;131:655–8. doi: 10.1016/j.cell.2007.10.042. [DOI] [PMC free article] [PubMed] [Google Scholar]





