Summary
Objective
To provide a comprehensive immunohistochemical (IHC) map of the temporal expression and tissue distribution of interleukin-1β (IL-1β) through progression of osteoarthritis (OA) in two strains of guinea pigs with varying propensity for spontaneous knee joint disease.
Methods
OA-prone Hartley and OA-resistant Strain 13 guinea pigs were collected at 60, 120, 180, 240, 360, and 480 days of age (N=4 animals per strain per date). IHC was performed on whole joint preparations; the distribution of IL-1β expression on coronal sections was mapped, semi-quantitatively scored, and correlated to OA grade using Mankin criteria with guinea pig-specific modifications. OA and IHC indices were compared among times and between strains using the Kruskal-Wallis one-way analysis of variance by ranks followed by Dunn's post test.
Results
OA indices for both strains increased from 60 to 480 days of age; a statistically higher score (p≤0.01) was found in Hartley animals at 180, 240, 360, and 480 days. At 60 days of age, IL-1β expression was detected in cartilage, menisci, synovium, and subchondral bone in both strains. Persistent and statistically increased (p<0.05) IL-1β expression was found in these same tissues in Hartley animals at 120 and 180 days, while Strain 13 animals demonstrated a significant reduction in positive immunostaining. Statistical differences in IHC indices between strains beyond 240 days of age were restricted to synovium (days 240 and 480) and subchondral bone (days 360 and 480).
Conclusions
As expected, histologic OA proceeded in an accelerated manner in Hartley animals relative to Strain 13 animals. The OA-prone strain did not demonstrate reduced IL-1β expression during adult maturity as occurred in the OA-resistant strain, and this persistent expression may have corresponded to early incidence of OA. Future interventional studies are warranted to explore whether dysregulation of IL-1β expression may contribute to premature onset of spontaneous disease in the Hartley guinea pig.
Keywords: Osteoarthritis, Interleukin-1β, Cartilage, Synovium, Menisci, Subchondral bone, Guinea pig
Introduction
Interleukin-1β (IL-1β), a key regulator of innate host immune responses, is repeatedly cited as one of the most prominent cytokines involved in osteoarthritis (OA)-related joint degeneration. It has been well-established in cell culture that IL-1β inhibits the production of type II collagen and aggrecan and potently induces chondrocyte-mediated degradation of extracellular matrix components by stimulating production of matrix metalloproteinases2,3. In addition, by promoting prostaglandin- and nitrous oxide-mediated pathways in joint tissue, IL-1β is recognized as a global mediator of inflammation and pain in joints affected by OA4.
The benefits of an IL-1β competitive antagonist, IL-1 receptor antagonist protein (IL-1Ra), in animal models of surgically-induced OA supports the role of IL-1β in OA pathogenesis4–6. A local increase in exogenous IL-1Ra in OA joints by administration of recombinant human (rh)IL-1Ra protein7, intra-articular injection of rhIL-1Ra transduced cells8, or adenoviral delivery of IL-1Ra using in vivo and ex vivo techniques9,10 has been shown to reduce the progression of experimentally created lesions.
While these studies provide strong evidence that IL-1β is implicit for the onset and development of secondary OA, ambiguity to its ultimate role in primary disease was initially provided by the finding that IL-1β knock-out mice showed accelerated development of OA lesions in surgically and non-surgically altered knees11. Further, intra-articular rhIL-1Ra injections to treat symptomatic knee OA in people found no statistical improvement over placebo at one month12 and trials with diacerein, a compound that inhibits IL-1β production from synovium and cartilage13, did not show clinical, radiographic, or structure-modifying effects as expected14–16. Thus, the molecular interactions to explain the relationship between IL-1β and maintenance of healthy articular cartilage have been proposed but are not yet definitively established17, and characterization of the function of IL-1β in a spontaneous, in vivo model remains elusive11,18.
Reports exist on the presence of the IL-1β transcript19 and protein20,21 in OA, but these are generally reported in control versus end-stage OA cartilage, synovium, or synovial fluid22 and lack documentation of IL-1β expression relative to the development of OA lesions. The aim of this study was to provide a comprehensive analysis of the temporal expression and tissue distribution of IL-1β using immunohistochemistry (IHC) throughout initiation and progression of OA in a naturally-occurring animal model. By providing direct comparisons between two guinea pig strains with varying propensity for the disease, this work provides a foundation upon which mechanistic data regarding the contribution of IL-1β to spontaneous and premature OA can be hypothesized and substantiated.
Materials & Methods
This study was carried out in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All protocols were approved by the Institutional Laboratory Animal Care and Use Committee at The Ohio State University. Male Hartley guinea-pigs (24 animals total) were obtained from Charles River Laboratories (Wilmington, MA) and male Strain 13 (24 animals total) from the U.S. Army Medical Research Institute of Infectious Diseases (Fort Detrick, MD) for data collection at 60, 120, 180, 240, 360, and 480 days of age (N=4 animals per time point per strain). The majority of animals were available directly from the suppliers at the required ages and euthanized by exposure to carbon dioxide within 24 hours of arrival to the facilities. Hartley and Strain 13 animals intended for harvest at 180 and 240 days of age, however, were raised at approved university laboratory animal facilities until the appropriate time point was reached. Animals were housed individually in solid bottom cages and allowed ad libitum water and guinea-pig chow (Harlan Teklad 7006) containing Vitamin C (800 mg/kg) and Vitamin D3 (2.4 IU/g) until euthanasia was performed. Weight (grams) at time of harvest was recorded.
JOINT TISSUE PROCESSING & ANALYSIS
Both knees from each animal were evaluated using the scoring systems described below. Whole knee joints were fixed in 10% neutral buffered formalin and prepared for histological analysis, as previously described23,24,25, with the following modifications: after a monitored period of decalcification in 8% formic acid/hydrochloric acid, joints were cut in half on a coronal plane and further decalcified in 8% formic acid/acetic acid. Decalcification was standardized within harvest age to ensure that adequate processing was attained with minimal exposure to acidic conditions (Table 1A). Paraffin sections (5 μm) were taken from the center of the medial tibial plateau in each joint and stained with toluidine blue or subjected to immunostaining, as described below.
Table 1A.
Decalcification protocol for Hartley and Strain 13 guinea pigs collected at specified ages
| Number of days exposed to respective decalcification solutions |
||
|---|---|---|
| Harvest age |
8% formic acid/hydrochloric acid | 8% formic acid/acetic acid |
| 60 | 1 | 2 |
| 120 | 2 | 3 |
| 180 | 2 | 3 |
| 240 | 3 | 3 |
| 360 | 5 | 5 |
| 480 | 5 | 5 |
Three independent, blinded observers (KSS, SEW, ALB) performed histological grading of serial coronal sections of each knee, using adapted Mankin criteria based upon characteristic features of OA in this species24,25. Histological evidence of chondropathy incorporated: (1) grading of articular cartilage structure from 0–8; and (2) grading of proteoglycan loss, as determined by loss of toluidine blue staining intensity, from 0–6 (Table 1B). Chondropathy was scored for the medial and lateral tibial plateaus. The total score for each compartment ranged from 0 (normal) to 14 (severe structural damage and complete loss of toluidine blue staining), providing a total possible tibial index ranging from 0–28. Intra- and inter-observer variability was negligible (within one numeric score in all cases). Cellularity and tidemark integrity have been reported to not diverge between the Hartley and Strain 13 guinea pigs and, therefore, these measures were not included in the histologic grading scheme24. This study also characterized meniscal degeneration, as described26: 0=homogenous staining collagen; 1=mild cleft formation of collagen bundles; and 2=several cleft and cyst formation of collage bundles.
Table 1B.
| Grade |
Descriptions |
|
|---|---|---|
| Articular cartilage structure | 0 | normal, smooth uninterrupted |
| 1 | mild surface irregularities, no clefts | |
| 2 | irregular surface, 1–3 superficial clefts | |
| 3 | >3 clefts and/or loss of cartilage to superficial zone | |
| 4 | 1–3 clefts extending into middle zone | |
| 5 | >3 clefts and/or loss of cartilage into middle zone | |
| 6 | 1–3 clefts extending into deep zone | |
| 7 | >3 clefts extending into calcified cartilage zone | |
| 8 | clefts extending to calcified cartilage zone | |
| Toluidine blue staining | 0 | uniform staining |
| 1 | loss of staining in superficial zone for <half the length of the plateau | |
| 2 | loss of staining in superficial zone for >half the length of the plateau | |
| 3 | loss of staining in superficial + middle zone for <half the length of the plateau | |
| 4 | loss of staining in superficial + middle zone for >half the length of the plateau | |
| 5 | loss of staining in all 3 zones <half the length of the plateau | |
| 6 | loss of staining in all 3 zones >half the length of the plateau |
IMMUNOHISTOCHEMISTRY TECHNIQUE & ANALYSIS
IHC was performed on an automated instrument-reagent system, the Ventana Medical Systems Benchmark XT (Tucson, AZ), according to manufacturer's recommendations using the Ultraview Universal Red AP System and a rabbit polyclonal antibody (sc-7884) from Santa Cruz Biotechnology (Santa Cruz, CA) at a dilution of 1:800. Use of this machine expedited identification of conditions necessary to detect the epitope of interest while curtailing background, and allowed uniform comparisons between and among animals. As per company datasheets, the primary antibody is specific for an epitope corresponding to the C-terminus of human IL-1β and is recommended for detection of rodent and human protein via IHC on paraffin-embedded tissue. Validation of this primary antibody with guinea pig tissue was confirmed on splenic tissue macrophages. Preliminary studies, as well as samples tested throughout the study, confirmed that neither protease-induced nor heat-induced epitope retrieval were necessary for detection of IL-1β in these whole joint tissues. Incubation with the primary antibody occurred for 90 minutes, followed by application of a proprietary secondary multi-link directed against mouse or rabbit primary antibodies according to machine specifications. Exposure to the secondary antibody, alone, did not result in positive staining. Several cell types, including skeletal muscle and bone marrow stem cells and macrophages, frequently showed IL-1 β staining and provided internal positive controls for each section. The tissue distribution and intensity of IL-1β immunostaining demonstrated minimal variations within each group (strain and age) examined. Sections with negligible immunostaining were subjected to antigen retrieval, as described above, to endorse the absence or reduction in cytokine detection. Sections were counterstained with hematoxylin and viewed by microscopy. A minimum of four sections from each joint were examined.
The percentage of chondrocytes staining positive for IL-1β were assessed by three independent, blinded reviewers (KSS, EP, GN) and assigned a score of 0–5, as previously described27 (Table 1C). In addition, due to the standardized staining conditions permitted by instrument-reagent system, a scale of 1–3 was used to gauge the intensity of immunostaining, with 0=no visible staining, 1=minimal degree of staining, 2=moderate degree of staining, and 3=marked degree of staining. This allowed a total IHC index ranging from 0–8. Intra- and inter-observer variability was negligible (within one numeric score in all cases).
Table 1C.
Semi-quantitative immunostaining grading system for knee joints of the guinea pig27, with modifications
| Score |
Qualifier |
Description |
|
|---|---|---|---|
| Percentage of positive cells | 0 | (−) | no visible immunostaining |
| 1 | rare | <5% of cells and/or matrix positive | |
| 2 | occasional | 6–24% of cells and/or matrix positive | |
| 3 | several | 25–49% of cells and/or matrix positive | |
| 4 | frequent | 50–75% of cells and/or matrix positive | |
| 5 | extensive | >75% of cells and/or matrix positive | |
| Intensity of immunostaining | 0 | (−) | no visible immunostaining |
| 1 | + | minimal visible immunostaining | |
| 2 | ++ | moderate visible immunostaining | |
| 3 | +++ | marked visible immunostaining |
To substantiate this scoring system, detailed descriptive qualifiers of the location and intensity of immunostaining in tissues were recorded (KSS) (Table 3; Figure 1). Weight-bearing cartilage was evaluated according to structure (tibial plateaus and femoral condyles), location (medial and lateral), regions of interest within each location (midline, central, axial or abaxial), and cartilage zones (superficial, middle, and deep). Synovium was evaluated according to location (medial and lateral) and regions of interest within each location (proximal, mid-joint, and distal). Menisci were evaluated according to location (medial and lateral), regions of interest within each location (central and axial or abaxial), and meniscal zones (superficial and deep). Subchondral bone was evaluated according to structure (tibia and femur) and location (medial or lateral).
Table 3A.
Expression of IL-1β in weight-bearing knee cartilage of Hartley & Strain 13 guinea pigs
| Age | Hartley | Strain 13 |
|---|---|---|
| 60d | Several to frequent + to ++ cells in all zones/ROIs | Several to extensive ++ to +++ cells in all zones/ROIs |
|
| ||
| 120d | Several to extensive ++ cells in all zones/ROIs | Medial tibia: − to rare + cells in all zones of central & axial ROIs |
| Medial femur: − to rare + matrix staining in all zones of central & midline ROIs | ||
| Lateral tibia: − to rare + cells/matrix in middle/deep zones of central ROI | ||
| Lateral femur: rare + matrix staining in all zones/ROIs | ||
|
| ||
| 180d | Several to extensive + to ++ cells/matrix in all zones/ROIs | Medial tibia: − to rare + cells in middle/deep zones of central ROI |
| Lateral tibia: − to rare + cells/matrix in middle/deep zones of central ROI | ||
| Femora: rare + to + matrix in middle/deep zones of central ROIs | ||
|
| ||
| 240d | Occasional to several + to ++ cells/matrix in all zones/ ROIs | Occasional to several + to ++ cells/matrix in all zones/ROIs |
|
| ||
| 360d | Medial tibia: occasional to several ++ cells in all zones of axial & midline ROIs | Occasional to several + to ++ cells/matrix in all zones of central ROI |
| Medial femur: − to several + cells/matrix staining in all zones of axial & midline ROIs | ||
| Lateral tibia: several ++ cells/matrix staining in all zones of abaxial & midline ROIs; rare + to ++ cells in middle/deep zones of central ROI | ||
| Lateral femur: occasional + cells/matrix in superficial/middle zones of abaxial & midline ROIs | ||
|
| ||
| 480d | Medial tibia: several to frequent + to ++ cells in all zones/ROIs | Medial tibia: several to frequent + to ++ cells in all zones of all ROIs Lateral tibia: several to extensive ++ to +++ cells/matrix in all zones/ROIs Femora: several to frequent + to ++ matrix in all zones/ROIs |
| Lateral tibia: occasional + cells in all zones/ROIs; +++ matrix in superficial zones of midline ROIs | ||
| Femora: frequent to extensive ++ to +++ cells/matrix staining of all zones/ROIs | ||
ROI(s) = region(s) of interest. Medial and lateral tibial plateaus, as well as medial and lateral femoral condyles, were evaluated for immunostaining within midline, central, and axial or abaxial regions of interest and superficial, middle, and deep zones of cartilage.
Figure 1.
Schematic representation of the descriptive structures, locations, regions of interest, and zones investigated within individual relevant tissues in whole guinea pig knee joints examined for IL-1β immunostaining.
REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION (RT-PCR)
To confirm IHC findings, one-step RT-PCR using Invitrogen reagents (Carlsbad, CA) was performed on DNase-treated RNA isolated from weight-bearing cartilage at days 60, 120, and 180 days of age. Primers specific for guinea pig IL-1β (forward: ACGCCTGGTGTTGTCTG; reverse: GGGAACTGAGCGGATTC) and GAPDH (forward: GTATCGTGGAAGGACTCATGACC; reverse: GTTGAAGTCACAGGACACAACCT) were purchased from Eurofins MWG Operon (Huntsville, AL), with the latter serving as a positive control. Universal cycling parameters, as suggested by the manufacturer, were employed for cDNA construction and subsequent amplification. Products were run in a 1% agarose gel and visualized under UV light using ethidium bromide.
STATISTICAL ANALYSES
Total tibial indices for OA and IHC indices for each tissue type (cartilage, synovium, menisci, and subchondral bone) were analyzed using the one-way analysis of variance (ANOVA), Kruskal-Wallis test, followed by Dunn's Multiple Comparison post-hoc test, as previously described28. Weights were analyzed using one-way ANOVA followed by pairwise comparisons using Tukey's 95% confidence intervals. These analyses were performed to detect statistical differences between strains at all time points, as well as within strain differences at each harvest age. All analyses were performed using the Minitab statistical software program (State College, PA). Statistical significance was set at p≤0.05.
Results
HISTOLOGICAL ASSESSMENT OF CHONDROPATHY
Total tibial OA indices for both guinea pig strains statistically increased (p=0.01) from 60 to 480 days of age, similar to that previously reported24,28 (Table 2A). Significant increases (p=0.01) in index values were found within each individual strain when transitioning between the 120 and 180 time points and 360 and 480 time points. Significant differences (p=0.01) in OA indices were found between the two strains at 180, 240, 360, and 480 days of age.
Table 2A.
Median (range provided) OA indices of Hartley and Strain 13 guinea pigs. Significant increases in index values were found within individual strains over time at the indicated ages. Significant differences in index values were found between the two strains at 180, 240, 360, and 480 days of age, with p-values indicated (NS=not significant, p-value > 0.05).
| Day | Hartley | Strain 13 | p-value |
|---|---|---|---|
| 60 | 0 (0–0) | 0 (0–0) | NS |
| 120 | 0 (0–0) | 0 (0–0) | NS |
| 180 | 11 (7–15)† | 5 (3–8)† | p = 0.01 |
| 240 | 14 (9–17)† | 7 (6–9)† | p = 0.01 |
| 360 | 11 (10–14)† | 7 (2–9)† | p = 0.01 |
| 480 | 20 (18–24)† | 10 (8–13)† | p = 0.01 |
p=0.01
Scores assigned to menisci were not significantly different within or between strains at the time points examined (data not shown).
A significantly lower (p=0.01) body weight was found within each individual guinea strain at 60 days of age relative to the other time points examined. No significant differences in body weight were found between strains at any of the investigated ages (Table 2B).
Table 2B.
Mean body weight (upper and lower 95% confidence intervals provided) in grams of Hartley and Strain 13 guinea pigs. Significant increases in weight were found within individual strains over time at the indicated ages. No significant differences in body weight were found between strains at any of the examined time points (NS=not significant, p-value > 0.05).
| Day | Hartley | Strain 13 | p-value |
|---|---|---|---|
| 60 | 524 (509, 541)† | 407 (374, 440)† | NS |
| 120 | 815 (542, 1088) | 659 (636, 681) | NS |
| 180 | 904 (799, 1008) | 790 (691, 889) | NS |
| 240 | 915 (730, 1100) | 868 (733, 1002) | NS |
| 360 | 985 (934, 1037) | 941 (828, 1054) | NS |
| 480 | 1039 (904, 1174) | 970 (768, 1172) | NS |
p=0.01
ASSESSMENT OF INTERLEUKIN-1B IMMUNOSTAINING
COMPOSITE SUMMARY (Figure 2)
Figure 2.
Composite summary of IL-1β IHC indices assigned to weight-bearing cartilage, syovium, menisci, and subchondral bone of Hartley and Strain 13 guinea pigs at indicated ages. Significant increases (p<0.05) in immunostraining that were found between strains are indicated by asterisks on relevant tissues.
At 60 days of age, IL-1β expression was detected in all reported tissues in Hartley and Strain 13 guinea pigs (Figure 2). IHC indices for weight-bearing cartilage at this age were higher in Strain 13 animals than Hartley animals. Persistent and statistically increased (p<0.05) IL-1β expression in all articular tissues of interest were found in Hartley guinea pigs at 120 and 180 days of age, while Strain 13 animals demonstrated a significant and marked reduction in positive cells and/or matrix at these time points. Statistical differences in immunostaining indices starting at 240 days of age were restricted to synovium (days 240 and 480) and subchondral bone (days 360 and 480), only, while descriptive differences in cartilage, synovium, menisci, and bone were elucidated. Pertinent details are provided below for each tissue.
CARTILAGE (Table 3A; Figure 3)
Figure 3.
Median (range provided) immunohistochemistry (IHC) indices (A) and corresponding photomicrographs (measure bar = 40μm) demonstrating significant differences (B) for IL-1β expression in weight-bearing knee cartilage of Hartley and Strain 13 guinea pigs. RT-PCR results (C) performed on cartilage samples on days 60, 120, and 180 days of age confirmed the reported IHC IL-1β protein expression. Within strain IHC indices for Hartley guinea pigs were not statistically different at the time points investigated. Significant decreases in index values were found within Strain 13 animals over time at 120 and 180 days of age (p=0.01†). Significant differences in positive cells and/or matrix staining were noted between the two strains at 60, 120, 180 days of age, as indicated (NS=not significant, p>0.05).
Within Hartley guinea pigs, IHC indices for IL-1β expression in weight-bearing cartilage of aging animals were persistent and did not differ at the time points examined (Figure 3). Within Strain 13 guinea pigs, IHC scores were significantly reduced (p=0.01) at 120 and 180 days relative to other harvest ages. RT-PCR results performed on cartilage samples on days 60, 120, and 180 days of age supported the reported IHC IL-1β protein expression (Figure 3C).
Temporal changes in IHC scores between strains corresponded to significant differences in positive chondrocyte and/or matrix staining at 60, 120, and 180 days of age. More specifically, at 60 days of age, IL-1β immunostaining in the cartilage of both guinea pig strains varied in number and intensity, which correlated to statistically increased (p=0.04) total IHC indices in Strain 13 animals relative to Hartley animals (Table 3A; Figure 3A). On 120 and 180 days of age, Hartley guinea pigs continued to demonstrate several to extensive (25–100%), minimally to moderately positive cells and/or matrix in all cartilage zones throughout all regions of cartilage, which corresponded to a significant increase (p=0.01) in IHC indices relative to the control strain. In comparison, IL-1β expression in the Strain 13 animals at these same two time points was represented by either negative staining or rare (<5%), minimally positive cells and/or matrix that were observed only in the middle and deep zones of the central regions of tibiae and femora.
Although differences in IHC score were not detected between Hartley and Strain 13 guinea pigs at 240, 360, and 480 days of age, descriptive regional differences in cartilage IL-1β immunostaining were discerned at the latter time points (Table 3A; Figure 2). By 360 days of age, for example, immunostaining in Hartley guinea pigs was restricted to the midline and axial or abaxial regions, with absent to rare (<5%), minimally to moderately positive cells in middle and deep zones of central regions of interest. At this same age, occasional to several (6–49%), minimally to moderately positive cells and/or matrix in cartilage of Strain 13 animals were present only in central regions. Differences in immunostaining were also noted in the lateral tibiae of guinea pigs at 480 days of age, where Hartley animals showed occasional (6–24%), minimally positive cells in all cartilage zones, but several (25–49%), markedly positive matrices were present in the superficial zones of midline regions of interest. Strain 13 animals, on the other hand, demonstrated several to extensive (25–100%), moderately to markedly positive cells/matrix in all zones and regions of lateral tibiae.
MENISCI (Table 3B; Figure 4)
Table 3B.
Expression of IL-1β in knee joint meniscal tissue of Hartley & Strain 13 guinea pigs
| Age | Hartley | Strain 13 |
|---|---|---|
| 60d | Several to extensive + to ++ cells/matrix in superficial zones of all ROIs | Frequent to extensive ++ to +++ cells/matrix in all ROIs |
|
| ||
| 120d | Several to extensive ++ cells/matrix in all ROIs | Medial: − in all ROIs Lateral: rare + cell/matrix in all ROIs |
|
| ||
| 180d | Several to extensive ++ cells in all ROIs | − in all ROIs |
|
| ||
| 240d | Occasional to several + to ++ cells/matrix in all ROIs | Medial: occasional + to ++ cells/matrix in central ROI |
| Lateral: frequent ++ to +++ cells/matrix in all ROIs | ||
|
| ||
| 360d | Several to frequent ++ cells in axial and abaxial ROIs with occasional + to ++ cell in central ROI | Occasional to several + to ++ cells/matrix in central ROIs |
|
| ||
| 480d | Medial: occasional + to ++ cells/matrix in all ROIs | Occasional to several + to ++ cells/matrix in all ROIs |
| Lateral: occasional + to ++ cells/matrix in central ROI | ||
ROI(s) = region(s) of interest. Medial and lateral menisci were evaluated for immunostaining in superficial and deep zones, as well as central and axial or abaxial regions of interest.
Figure 4.
Median (range provided) immunohistochemistry (IHC) indices (A) and corresponding photomicrographs (measure bar = 40μm) demonstrating significant differences (B) for IL-1β expression in menisci of Hartley and Strain 13 guinea pigs. Within strain IHC indices for Hartley guinea pigs were not statistically different at the time points investigated. Significant decreases in index values were found within Strain 13 animals over time at 120 and 180 days of age (p=0.01†). Significant increases in positive cells and/or matrix staining were noted in Hartley animals relative to Strain 13 animals at 120 and 180 days of age, as indicated (NS=not significant, p>0.05).
In general, IL-1β expression patterns for meniscal tissue were similar to that of weight-bearing articular cartilage. IHC indices for IL-1β expression of aging Hartley guinea pigs were not statistically different at the within-strain time points investigated (Figure 4). Significant decreases (p=0.01) in index values were found within aging Strain 13 animals over time at 120 and 180 days of age. Significant increases in positive cells and/or matrix staining were noted in Hartley animals relative to Strain 13 animals at 120 and 180 days of age (p=0.01).
While statistical differences in IHC scoring were not present at later time points, noteworthy descriptive differences were found between the two guinea pig strains at 360 and 480 days of age (Table 3B). Meniscal tissue of Hartley animals at 360 days of age had several to frequent (25–75%), moderately positive cells in axial and abaxial regions of interest, with only occasional (6–24%), minimally to moderately positive cells in central regions of interest. Strain 13 animals at this same age, however, had occasional to several (6–49%), minimally to moderately positive cells and/or matrix in central regions of both menisci, only. At 480 days of age, Hartley guinea pigs had occasional (6–24%), minimally to moderately positive cells and/or matrix in both medial and central, and central only, regions of interest in medial and lateral menisci, respectively. Menisci of Strain 13 animals, meanwhile, contained occasional to several (6–50%), minimally to moderately positive cells and/or matrix in all regions of interest.
SYNOVIUM (Table 3C; Figure 5)
Table 3C.
Expression of IL-β in knee joint synovium of Hartley & Strain 13 guinea pigs
| Age | Hartley | Strain 13 |
|---|---|---|
| 60d | Several to frequent + to ++ cells/matrix in all ROIs | Medial: frequent to extensive ++ to +++ cells/matrix in all ROIs |
| Lateral: frequent to extensive + cells/matrix in all ROIs | ||
|
| ||
| 120d | Several to frequent + to ++ cells/matrix in all ROIs | − to rare + cells/matrix in all ROIs |
|
| ||
| 180d | Frequent to extensive ++ to +++ cells/matrix in all ROIs | − in all ROIs |
|
| ||
| 240d | − to occasional + cells/matrix in mid-joint ROIs | Frequent ++ cells/matrix in distal ROIs |
|
| ||
| 360d | Several to frequent + to ++ cells/matrix in all ROIs | Occasional to frequent + cells/matrix in distal ROIs |
|
| ||
| 480d | Frequent to extensive ++ to +++ cells/matrix in all ROIs | Medial: − to rare + cell in distal ROIs |
| Lateral: occasional to several + to ++ cells/matrix in distal ROIs | ||
ROI(s) = region(s) of interest. Medial and lateral synovium was evaluated for immunostaining in proximal, mid-joint, and distal regions of interest.
Figure 5.
Median (range provided) immunohistochemistry (IHC) indices (A) and corresponding photomicrographs (measure bar = 40μm) demonstrating significant differences (B) for IL-1β expression in synovium of knee joints of Hartley and Strain 13 guinea pigs. IHC indices for Hartley guinea pigs were statistically decreased at 240 days of age relative to the other time points investigated. Significant decreases in index values were found within Strain 13 animals over time at 120 and 180 days of age (p=0.01†). Significant differences in positive cells and/or matrix staining were noted in Hartley animals relative to Strain 13 animals at 120, 180, 240, and 480 days of age, as indicated (NS=not significant, p>0.05).
IHC indices for IL-1β expression in synovium of aging Hartley guinea pigs were statistically decreased (p=0.01) at 240 days of age relative to the other time points examined within this strain (Figure 5). Significant decreases (p=0.01) in index values were found within aging Strain 13 animals at 120 and 180 days of age compared to other harvest days. Significant differences (p≤0.02) in positive cells and/or matrix staining were noted in Hartley animals relative to Strain 13 animals at 120, 180, 240, and 480 days of age.
At 240 days of age, descriptive and statistically significant increases (p=0.01) in synovial IHC indices were seen in Strain 13 guinea pigs relative to their Hartley counterparts, where IL-1β was absent or was detected occasionally (6–24%) in minimally positive cells and/or matrix in mid-joint regions of interest (Table 3C). In Strain 13 animals, however, IL-1β immunostaining showed frequent (50–75%), moderately positive cells and/or matrix in distal regions of interest.
At 360 and 480 days of age, descriptive differences were, again, noted between Hartley and Strain 13 guinea pigs. Hartley animals exhibited several to frequent (25–75%), minimally to moderately positive cells and/or matrix in all regions of interest at 360 days, which increased from frequent to extensive (50–100%), moderately to markedly positive cells and/or matrix by 480 days of age. Synovium of Strain 13 animals showed occasional to frequent (6–75%), minimally positive cells and/or matrix in distal regions of interest, only, at 360 days of age. Further, by 480 days of age, all regions of the medial synovium were absent of immunostaining or contained, at most, rare (<5%), minimally positive cells. The lateral synovium of the oldest Strain 13 animals maintained occasional to several (6–49%), minimally to moderately positive numbers of cells/matrix in distal regions of interest. Importantly, these divergences translated to a statistical increase (p=0.02) in IHC scoring seen with Hartley animals compared to Strain 13 guinea pigs at 480 days of age.
SUBCHONDRAL BONE (Table 3D; Figure 6)
Table 3D.
Expression of IL-1β in subchondral bone of knee joints of Hartley & Strain 13 guinea pigs
| Age | Hartley | Strain 13 |
|---|---|---|
| 60d | Several to frequent + to ++ matrix in all ROIs | Several to frequent + to ++ cells/matrix in all ROIs |
|
| ||
| 120d | Several + to ++ cells/matrix in all ROIs | − in all ROIs |
|
| ||
| 180d | Several to frequent ++ cells/matrix in all ROIs | − to rare + matrix in all ROIs |
|
| ||
| 240d | Tibia: occasional to several + matrix in all ROIs | Several to frequent + to ++ cells/matrix in all ROIs |
| Femur: occasional + matrix in all ROIs | ||
|
| ||
| 360d | − to rare + matrix in all ROIs | Occasional to several + to ++ cells/matrix in all ROIs |
|
| ||
| 480d | − to occasional + matrix in all ROIs | Occasional to several + to ++ cells/matrix in all ROIs |
ROI(s) = region(s) of interest. Tibial and femoral subchondral bone were evaluated for immunostaining in medial or lateral regions of interest.
Figure 6.
Median (range provided) immunohistochemistry (IHC) indices (A) and corresponding photomicrographs (measure bar = 40μm) demonstrating significant differences (B) for IL-1β expression subchondral bone of Hartley and Strain 13 guine pigs. Within strain IHC indices for Hartley guinea pigs were statistically decreased at 360 days of age relative to the other time points investigated (p=0.01†). Significant decreases in index values were found within Strain 13 animals over time at 120 and 180 days of age (p=0.01†). Significant differences in positive cells and/or matrix staining were noted in Hartley animals relative to Strain 13 animals at 120, 180, 360, and 480 days of age, as indicated (NS=not significant, p>0.05).
IHC indices for IL-1β expression in subchondral bone of aging Hartley guinea pigs were statistically decreased (p=0.01) at 360 days of age relative to the other time points investigated within this strain (Figure 6). Significant decreases (p=0.01) in index values were found within Strain 13 animals over time at 120 and 180 days of age. Significant differences (p≤0.04) in positive cells and/or matrix staining were noted in Hartley animals relative to Strain 13 animals at 120, 180, 360, and 480 days of age.
Starting at 240 days of age, positive immunostaining was detected only in the matrix of subchondral bone in Hartley animals. At this age, these animals showed occasional to several (6–50%), minimally positive matrix in the tibiae, as well as occasional (6–24%) positive matrix in the femora (Table 3D). IL-1β expression descriptively and statistically decreased (p≤0.04) relative to Strain 13 animals at 360 and 480 days of age, where matrix immunostaining was absent to occasional (0–24%), and of minimal intensity, in all regions of interest. Strain 13 animals, on the other hand, had several to frequent (25–75%) numbers of minimally to moderately positive cells and/or matrix present in all regions of interest at 240 days of age. On days 360 and 480 days of age, IL-1β immunostaining continued, with occasional to several (6–49%) cells and/or matrix demonstrating minimal to moderately positive staining intensity.
Discussion
To the authors' knowledge, this is the first study to describe localization of IL-1β within whole joints and associated relevant articular tissues from divergent guinea pig strains that develop varying degrees of naturally-occurring OA. Interestingly, the timing of enduring IL-1β levels in Hartley animals relative to Strain 13 animals at 120 and 180 days of age appeared to coincide with the onset of OA in the former strain. Given that these ages are associated with attainment of skeletal maturity in this species, we postulate that IL-1β plays a role in normal growth and development but that a dysregulation of this cytokine exists in Hartley animals relative to the control strain, resulting in persistent expression of a mediator strongly associated with OA. Indeed, collagenase cleavage and disruption of the type II collagen network occur early in the Hartley guinea pig model, preceding even histologic evidence of disease28. Further, in a model of developing bone and cartilage in human osteophytes, IL-1β mRNA expression was transient and restricted to active osteoblasts within distinct areas of intramembraneous ossification29. This emphasizes the strict control under which this cytokine exists in joint-related tissue and the importance of negative regulatory processes.
Although these findings cannot confirm a cause-and-effect relationship between IL-1β expression and OA, our study demonstrates a window when targeted cytokine reduction and/or blockade may explicate such a correlation and help identify mechanistic components. Additionally, this enduring IL-1β expression provides potential groundwork from which downstream or correlative offending mediators, as well as the processes of cell death and apoptosis, can be identified and studied. Because OA is a multi-factorial process that requires intricate interactions of several key biochemical and mechanical players, this manuscript is intended to provide a base from which other mediators implicated in OA can be investigated and correlated. Our laboratory is completing work related to microRNA-155 (miR-155), a molecule that has been shown to directly modulate interleukin-1 signaling in human monocyte-derived dendritic cells30. Using the human miR-155 sequence, we have been able to detect the precursor and mature forms of this small RNA in joint tissue of both guinea pig models and are currently characterizing a potential relationship between this molecule, IL-1β expression patterns, and release of other degradative molecules such as metalloproteinases (Santangelo et al, unpublished data).
In addition to statistical differences in IHC scoring for IL-1β, equally intriguing descriptive differences were also detected between guinea pig strains. In particular, a divergence in immunostaining was found in weight-bearing cartilage at 360 days of age, where the OA-affected Hartley guinea pigs showed positive staining cells within the midline and axial or abaxial regions of interest, whereas the less affected Strain 13 animals had positive staining limited to central regions. Meniscal tissue at this same time point mirrored cartilage data. On 360 days of age, synovial IL-1β in Hartley guinea pigs was found throughout all regions of interest; in Strain 13 animals, however, expression was restricted to cells and/or matrix present in distal regions affiliated with the tibiae. Further, at 480 days of age, it would be interesting to determine if the greater synovial immunostaining in Hartley animals is directly associated with cytokine-mediated inflammation related to the statistically relevant increase in histologic disease progression. It is worthwhile to note that infiltrating inflammatory cells were not identified in synovium, suggesting that soluble factors such as IL-1β serve as primary niduses for tissue reactivity. Finally, IL-1β in the subchondral bone of Hartley guinea pigs was found only in matrix after 240 days of age, while both cells and matrix of Strain 13 animals contributed to IHC scores. Given that thickening of subchondral bone has been shown to coincide with cartilage degeneration in the Hartley guinea pig24,31, this latter finding may be of particular concern in events preceding onset of OA. Again, the relevance of these variations can only be hypothesized at this stage, but future investigations are likely to reveal germane information.
Serum cytokines and chemokines harvested from Hartley and Strain 13 animals at one year of age did not show a statistical difference of circulating IL-1β between strains, although this finding may have been attributed to the inherent lability of the cytokine32. IL-1β concentration in synovial fluid from primary joints of interest is unknown. Several published methods for arthrocentesis of guinea pig joints24,33 were attempted during the course of the current study. We were interested to determine if synovial fluid levels were indicative of tissue levels, particularly in regards to the synovium at 480 days of age, where Hartley guinea pigs showed a significant increase in IHC scoring relative to Strain 13 animals. Low sample volume and lack of normalization parameters to correct for dilution during collection, however, precluded this analysis from complementing our tissue data.
In summary, histologic OA proceeded in an accelerated manner as expected in the OA-prone Hartley guinea pig relative to the Strain 13 guinea pig. Given that the OA-prone strain did not demonstrate reduced IL-1β during achievement of adult maturity as in the control strain, this aberrant expression may correlate to early incidence of OA. This persistent IL-1β expression is perhaps most significant in the weight-bearing articular cartilage in locations known to demonstrate OA, but also occurred in synovium, meniscus and subchondral bone. This temporal study provided evidence that IL-1β is a biomarker relevant to the development and progression of OA, and that future studies to block or reduce the dysregulation of this cytokine's expression may provide evidence of its contribution to premature onset of spontaneous OA.
Acknowledgements
Drs. Santangelo and Bertone were supported by NIH/NIAMS grant numbers F32AR053805 and K08AR4920101, respectively, during the course of this study. The Comparative Orthopedics Laboratory also receives generous support through the Trueman Family Endowment. Dr. Santangelo is currently funded by a joint GlaxoSmithKline and ACVP/STP Coalition award for advanced graduate and residency training. We would also like to thank Ms. Kathleen Sergott and Ventana Medical Systems for the generous donation of certain supplies related to this work, as well as David Spencer Smith, Sarah Baker, Tim Vojt, and Marc Hardman for technical assistance.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflict of interest All authors declare that there is no conflict of interest.
References
- 1.Goldring MB, Berenbaum F. The regulation of chondrocyte function by proinflammatory mediators. Clin Orthop Relat Res. 2004;(427 Suppl):S37–46. doi: 10.1097/01.blo.0000144484.69656.e4. [DOI] [PubMed] [Google Scholar]
- 2.Evans CH, Gouze JN, Gouze E, Robbins PD, Ghivizzani SC. Osteoarthritis gene therapy. Gene Ther. 2004;11(4):379–89. doi: 10.1038/sj.gt.3302196. [DOI] [PubMed] [Google Scholar]
- 3.Goldring SR, Goldring MB. The role of cytokines in cartilage matrix degeneration in osteoarthritis. Clin Orthop Relat Res. 2004;(427 Suppl):S27–36. doi: 10.1097/01.blo.0000144854.66565.8f. [DOI] [PubMed] [Google Scholar]
- 4.Caron JP, Fernandes JC, Martel-Pelletier J, Tardif G, Mineau F, Geng C, Pelletier JP. Chondroprotective effect of intra-articular injections of interleukin-1 receptor antagonist in experimental osteoarthritis. Suppression of collagenase-1 expression. Arthritis Rheum. 1996;39(9):1535–44. doi: 10.1002/art.1780390914. [DOI] [PubMed] [Google Scholar]
- 5.Evans CH, Robbins PD. The interleukin-1 receptor antagonist and its delivery by gene transfer. Receptor. 1994;4(1):9–15. [PubMed] [Google Scholar]
- 6.van de Loo FA, van den Berg WB. Gene therapy for rheumatoid arthritis. Lessons from animal models, including studies on interleukin-4, interleukin-10, and interleukin-1 receptor antagonist as potential disease modulators. Rheum Dis Clin North Am. 2002;28(1):127–49. 13. doi: 10.1016/s0889-857x(03)00073-5. [DOI] [PubMed] [Google Scholar]
- 7.Nixon AJ, Haupt JL, Frisbie DD, Morisset SS, McIlwraith CW, Robbins PD, et al. Gene-mediated restoration of cartilage matrix by combination insulin-like growth factor-I/interleukin-1 receptor antagonist therapy. Gene Ther. 2005;12(2):177–86. doi: 10.1038/sj.gt.3302396. [DOI] [PubMed] [Google Scholar]
- 8.Bendele A, McAbee T, Sennello G, Frazier J, Chlipala E, McCabe D. Efficacy of sustained blood levels of interleukin-1 receptor antagonist in animal models of arthritis: comparison of efficacy in animal models with human clinical data. Arthritis Rheum. 1999;42(3):498–506. doi: 10.1002/1529-0131(199904)42:3<498::AID-ANR15>3.0.CO;2-A. [DOI] [PubMed] [Google Scholar]
- 9.Pelletier JP, Caron JP, Evans C, Robbins PD, Georgescu HI, Jovanovic D, et al. In vivo suppression of early experimental osteoarthritis by interleukin-1 receptor antagonist using gene therapy. Arthritis Rheum. 1997;40(6):1012–9. doi: 10.1002/art.1780400604. [DOI] [PubMed] [Google Scholar]
- 10.Frisbie DD, Ghivizzani SC, Robbins PD, Evans CH, McIlwraith CW. Treatment of experimental equine osteoarthritis by in vivo delivery of the equine interleukin-1 receptor antagonist gene. Gene Ther. 2002;9(1):12–20. doi: 10.1038/sj.gt.3301608. [DOI] [PubMed] [Google Scholar]
- 11.Clements KM, Price JS, Chamber MG, Visco DM, Poole AR, Mason RM. Gene deletion of either interleukin-1beta, interleukin-1beta-converting enzyme, inducible nitric oxide synthase, or stromelysin 1 accelerates the development of knee osteoarthritis in mice after surgical transection of the medial collateral ligament and partial medial meniscectomy. Arthritis Rheum. 2003;48(12):3452–63. doi: 10.1002/art.11355. [DOI] [PubMed] [Google Scholar]
- 12.Chevalier X, Goupille P, Beaulieu AD, Burch FX, Bensen WG, Conrozier T, et al. Intraarticular injection of anakinra in osteoarthritis of the knee: a multicenter, randomized, double-blind, placebo-controlled study. Arthritis Rheum. 2009;61(3):344–52. doi: 10.1002/art.24096. [DOI] [PubMed] [Google Scholar]
- 13.Pelletier JP, Mineau F, Fernandes JC, Duval N, Martel-Pelletier J. Diacerhein and rhein reduce the interleukin 1beta stimulated inducible nitric oxide synthesis level and activity while stimulating cyclooxygenase-2 synthesis in human osteoarthritic chondrocytes. J Rheumatol. 1998;25(12):2417–24. [PubMed] [Google Scholar]
- 14.Pham T, Le Henanff A, Ravaud P, Dieppe P, Paolozzi L, Dougados M. Evaluation of the symptomatic and structural efficacy of a new hyaluronic acid compound, NRD101, in comparison with diacerein and placebo in a 1 year randomised controlled study in symptomatic knee osteoarthritis. Ann Rheum Dis. 2004;63(12):1611–7. doi: 10.1136/ard.2003.019703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pelletier JP, Martel-Pelletier J. DMOAD developments: present and future. Bull NYU Hosp Jt Dis. 2007;65(3):242–8. [PubMed] [Google Scholar]
- 16.Bartels EM, Bliddal H, Schøndorff PK, Altman RD, Zhang W, Christensen R. Symptomatic efficacy and safety of diacerein in the treatment of osteoarthritis: a meta-analysis of randomized placebo-controlled trials. Osteoarthritis Cartilage. 2010;18(3):289–96. doi: 10.1016/j.joca.2009.10.006. Epub 2009 Oct 14. [DOI] [PubMed] [Google Scholar]
- 17.Aigner T, Soeder S, Haag J. IL-1beta and BMPs--interactive players of cartilage matrix degradation and regeneration. Eur Cell Mater. 2006;12:49–56. doi: 10.22203/ecm.v012a06. [DOI] [PubMed] [Google Scholar]
- 18.Tortorella MD, Malfait AM. The usual suspects: verdict not guilty? Arthritis Rheum. 2003;48(12):3304–7. doi: 10.1002/art.11356. [DOI] [PubMed] [Google Scholar]
- 19.Fan Z, Bau B, Yang H, Aigner T. IL-1beta induction of IL-6 and LIF in normal articular human chondrocytes involves the ERK, p38 and NFkappaB signaling pathways. Cytokine. 2004;28(1):17–24. doi: 10.1016/j.cyto.2004.06.003. [DOI] [PubMed] [Google Scholar]
- 20.Tetlow LC, Adlam DJ, Woolley DE. Matrix metalloproteinase and proinflammatory cytokine production by chondrocytes of human osteoarthritic cartilage: associations with degenerative changes. Arthritis Rheum. 2001;44(3):585–94. doi: 10.1002/1529-0131(200103)44:3<585::AID-ANR107>3.0.CO;2-C. [DOI] [PubMed] [Google Scholar]
- 21.Fan Z, Söder S, Oehler S, Fundel K, Aigner T. Activation of interleukin-1 signaling cascades in normal and osteoarthritic articular cartilage. Am J Pathol. 2007;171(3):938–46. doi: 10.2353/ajpath.2007.061083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Pelletier JP, Martel-Pelletier J, Abramson SB. Osteoarthritis, an inflammatory disease: potential implication for the selection of new therapeutic targets. Arthritis Rheum. 2001;44(6):1237–47. doi: 10.1002/1529-0131(200106)44:6<1237::AID-ART214>3.0.CO;2-F. [DOI] [PubMed] [Google Scholar]
- 23.Huebner JL, Otterness IG, Freund EM, Caterson B, Kraus VB. Collagenase 1 and collagenase 3 expression in a guinea pig model of osteoarthritis. Arthritis Rheum. 1998;41(5):877–90. doi: 10.1002/1529-0131(199805)41:5<877::AID-ART16>3.0.CO;2-#. [DOI] [PubMed] [Google Scholar]
- 24.Huebner JL, Hanes MA, Beekman B, TeKoppele JM, Kraus VB. A comparative analysis of bone and cartilage metabolism in two strains of guinea-pig with varying degrees of naturally occurring osteoarthritis. Osteoarthritis Cartilage. 2002;10(10):758–67. doi: 10.1053/joca.2002.0821. [DOI] [PubMed] [Google Scholar]
- 25.Kraus VB, Huebner JL, DeGroot J, Bendele A. The OARSI histopathology initiative – recommendations for histological assessments of osteoarthritis in the guinea pig. Osteoarthritis Cartilage. 2010;18(Suppl 3):S35–52. doi: 10.1016/j.joca.2010.04.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ishihara G, Kojima T, Saito Y, Ishiguro N. Roles of metalloproteinase-3 and aggrecanase 1 and 2 in aggrecan cleavage during human meniscus degeneration. Orthopedic Reviews. 2009;1(2):e14. doi: 10.4081/or.2009.e14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Carlson CS, Loeser RF, Johnstone B, Tulli HM, Dobson DB, Caterson B. Osteoarthritis in cynomolgus macaques. II. Detection of modulated proteoglycan epitopes in cartilage and synovial fluid. J Orthop Res. 1995;13(3):399–409. doi: 10.1002/jor.1100130314. [DOI] [PubMed] [Google Scholar]
- 28.Huebner JL, Williams JM, Deberg M, Henrotin Y, Kraus VB. Collagen fibril disruption occurs early in primary guinea pig knee osteoarthritis. Osteoarthritis Cartilage. 2010;18(3):397–405. doi: 10.1016/j.joca.2009.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Dodds RA, Merry K, Littlewood A, Gowen M. Expression of mRNA for IL1β, IL6 and TGFβ1 in developing human bone and cartilage. J Histochem Cytochem. 1994;42(6):733–44. doi: 10.1177/42.6.8189035. [DOI] [PubMed] [Google Scholar]
- 30.Ceppi M, Pereira PM, Dunand-Sauthier I, Barras E, Reith W, Santos MA, Pierre P. MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells. Proc Natl Acad Sci U S A. 2009;106(8):2735–40. doi: 10.1073/pnas.0811073106. Epub 2009 Feb 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Anderson-MacKenzie JM, Quasnichka HL, Starr RL, Lewis EJ, Billingham ME, Bailey AJ. Fundamental subchondral bone changes in spontaneous knee osteoarthritis. Int J Biochem Cell Biol. 2005;37(1):224–36. doi: 10.1016/j.biocel.2004.06.016. [DOI] [PubMed] [Google Scholar]
- 32.Huebner JL, Kraus VB. Assessment of the utility of biomarkers of osteoarthritis in the guinea pig. Osteoarthritis Cartilage. 2006;14(9):923–30. doi: 10.1016/j.joca.2006.03.007. [DOI] [PubMed] [Google Scholar]
- 33.Teeple E, Elsaid KA, Fleming BC, Jay GD, Aslani K, Crisco JJ, Mechrefe AP. Coefficients of friction, lubricin, and cartilage damage in the anterior cruciate ligament-deficient guinea pig knee. J Orthop Res. 2008;26(2):231–7. doi: 10.1002/jor.20492. [DOI] [PMC free article] [PubMed] [Google Scholar]