Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Feb 15.
Published in final edited form as: Dev Cell. 2011 Feb 15;20(2):256–263. doi: 10.1016/j.devcel.2010.12.009

Translocation of the cytoplasmic domain of ADAM13 to the nucleus is essential for Calpain-8 expression and cranial neural crest cell migration

Hélène Cousin 1, Genevieve Abbruzzese 1, Erin Kerdavid 1, Alban Gaultier 2, Dominique Alfandari 1,*
PMCID: PMC3074609  NIHMSID: NIHMS261436  PMID: 21316592

Summary

ADAMs are transmembrane metalloproteases that control cell behavior by cleaving both cell adhesion and signaling molecules. The cytoplasmic domain of ADAMs can regulate the proteolytic activity by controlling the subcellular localization and/or the activation of the protease domain. Here we show that the cytoplasmic domain of ADAM13 is cleaved and translocates into the nucleus. Preventing this translocation renders the protein incapable of promoting cranial neural crest (CNC) cell migration in vivo, without affecting its proteolytic activity. In addition, the cytoplasmic domain of ADAM13 regulates the expression of multiple genes in CNC, including the protease Calpain8-a. Restoring the expression of Calpain8-a is sufficient to rescue CNC migration in the absence of the ADAM13 cytoplasmic domain. This study shows that the cytoplasmic domain of ADAM metalloproteases can perform essential functions in the nucleus of cells and may contribute substantially to the overall function of the protein.

Introduction

ADAMs are cell surface metalloproteases that contain a disintegrin domain (Alfandari et al., 2009; Blobel, 2005; Wolfsberg et al., 1995). They are key players in many biological processes and control cell adhesion and cell signaling. Their role in cell signaling is linked to their ability to cleave molecules either to turn on a signal, e.g. by cleaving growth factor precursors (EGF, TNF-α) or receptors (Notch), or to turn off signals by cleaving ligand/receptor complexes (e.g. ephrins)(Alfandari et al., 2009). ADAM proteins have also been shown to regulate cell adhesion by cleaving N- and E-cadherin to promote epithelial to mesenchymal transition (EMT). In addition to reducing adhesion of these cells, cleavage of N- and E-cadherins by ADAM10 releases β-catenin, which translocates into the nucleus and activates gene transcription, further facilitating EMT (Maretzky et al., 2009; Reiss et al., 2005).

We have previously shown, using both a dominant negative (DN) and Morpholino Knock down (KD) approaches, that ADAM13 plays a critical role in CNC cell migration (Alfandari et al., 2001; McCusker et al., 2009). In vertebrates, CNC are responsible for the formation of the face during embryogenesis. We have previously shown that ADAM13, in collaboration with other meltrins (ADAM9 and ADAM19), controls CNC cell migration by cleaving the extracellular domain of Cadherin-11 (McCusker et al., 2009). We have also shown that while its proteolytic activity is critical for ADAM13 function, the cytoplasmic domain of the protein is also important for regulating its function through its interaction with an SH3-containing cytoplasmic adaptor protein PACSIN2 (Cousin et al., 2000). In Xenopus tropicalis, ADAM13 is involved in CNC induction by cleaving ephrin B ligands and upregulating the canonical Wnt signaling pathway (Wei et al., 2010).

ADAM cytoplasmic domains are poorly conserved both between the various ADAMs and also between orthologues in different species. The ADAM13 cytoplasmic domain, like many other ADAMs, contains proline-rich (PR) repeats that function as SH3 binding sites. In addition, the juxta-membrane region of the cytoplasmic domain is rich in lysine and arginine (KR). ADAM cytoplasmic domains have been shown to regulate the ADAM protein functions either through phosphorylation or by controlling their sub-cellular localization (Cao et al., 2001a; Howard et al., 1999; Izumi et al., 1998; Janes et al., 2009; Maretzky et al., 2009; Stautz et al., 2010; Xu and Derynck, 2010). Recently, ADAM10 was shown to be cleaved by gamma-secretase, releasing the cytoplasmic domain from the plasma membrane. Using inhibitors of nuclear export they were able to detect the ADAM10 cytoplasmic domain in the nucleus of transfected 293T cells associated with nuclear speckle, which could be regions of active transcription (Tousseyn et al., 2009).

Here we show that the ADAM13 cytoplasmic domain is cleaved in vivo during embryogenesis and translocates into the nucleus. This translocation is critical for the function of ADAM13 during CNC cell migration and affects the expression of multiple genes within these cells. One of these genes Calpain8-a can rescue CNC migration in embryos lacking the ADAM13 cytoplasmic domain. We also show that in Xenopus the cytoplasmic domain of ADAM19 can substitute for the ADAM13 cytoplasmic domain. Using GFP-fusions of the cytoplasmic domains of ADAMs in multiple species we show that the cytoplasmic domains of C. elegans meltrin (adm-2), zebrafish ADAM13, and opossum ADAM13 can compensate for the loss of the Xenopus ADAM13 cytoplasmic domain, while mouse ADAM33 cannot. These results show that the function of ADAM cytoplasmic domain in the nucleus has been conserved during evolution.

Results

ADAM13 and ADAM19 cooperate to promote cranial neural crest cell migration

We have previously shown that three ADAM proteins play a role during Xenopus CNC migration. ADAM9 and ADAM13 both cleave Cadherin-11, while ADAM19 does not (McCusker et al., 2009). We have also shown that ADAM19 is important for the expression of CNC specific genes including Sox8 and Slug (Neuner et al., 2009). To determine whether ADAM13 and 19 could compensate for each other in CNC migration, we performed single and double KD using Morpholino oligonucleotides (MO) that prevent the translation of the endogenous protein (McCusker et al., 2009; Neuner et al., 2009). CNC cells from morphant embryos were dissected before migration and grafted into host embryos and the migration of grafted cells was followed using the green fluorescent protein (GFP) as a lineage tracer (Fig. 1). While single ADAM13 or ADAM19 KD prevents CNC migration in less that 20% of the embryos, the double KD inhibits migration in more than 80% of the embryos. CNC migration was rescued by either ADAM13 or 19 but not the protease inactive mutants (E/A) or a mutant lacking the cytoplasmic domain (ΔCyto), suggesting that both the proteolytic activity and the cytoplasmic domain are essential.

Figure 1. ADAM13 and 19 cooperate during CNC migration.

Figure 1

Open in a new tab

A) Schematic representation of the graft. Donor embryos are injected in one cell at the 2-cell stage with GFP, or combinations of GFP, MO against ADAM13 and 19 and mRNA encoding various ADAM constructs. At stage 15, CNC are dissected and grafted into host embryos. CNC migration is visualized using a fluorescent microscope. B) Fluorescence photographs of representative grafted embryos at stage 24. A positive migration is only counted if cells have progressed ventrally in one or more of the posterior arches. C) Histogram representing the analysis of CNC migration in at least 3 independent experiments. The error bars correspond to the standard deviation (SD). N: number of embryos.

To determine if the effect on CNC migration was due to defect in CNC induction we tested the expression of several CNC markers in embryos lacking the ADAM13 protein. Our results show that in the absence of detectable ADAM13 protein, all of the CNC markers tested were expressed at the right place and the right level (Fig. S1). These results show that in Xenopus laevis, ADAM13 KD affects CNC migration in the absence of any effect on CNC induction.

These results show that ADAM13 and ADAM19 can compensate for each other even though their role in CNC migration during normal embryo development is distinct. They also show that the cytoplasmic domain of ADAM13 is essential for CNC migration. We next investigated how the cytoplasmic domain of ADAM13 could control cell migration.

The ADAM13 cytoplasmic domain is cleaved by gamma-secretase and translocates into the nucleus

The ADAM13 extracellular domain is cleaved by autoproteolysis in the cysteine-rich domain, releasing the active metalloprotease from the cell surface (Gaultier et al., 2002) (Fig. 2A). Ectodomain shedding of transmembrane proteins is often followed by a cleavage by gamma-secretase (GS) that releases the cytoplasmic domain (Hass et al., 2009). To investigate if a similar processing occurs for ADAM13, we transfected Cos-7 and 293T cells with the various ADAM13 constructs. After transfections, the cytoplasmic and nuclear fractions were separated and analyzed for the presence of the cytoplasmic fragment using an antibody directed against this domain (6615F) (Alfandari et al., 1997). When ADAM13 is transfected into 293T cells, a 17 kDa fragment is detected in the nuclear extract (Fig. 2B, arrowhead). This is also the case following transfection with a fusion protein containing the cytoplasmic domain of ADAM13 fused to GFP (GFP-C13) but not with GFP alone. To determine if the same cleavage also occurs in vivo, we analyzed protein extract from either control embryos or embryos injected with MO13. As seen in transfected cells, the ADAM13 antibody recognizes a 17 kDa fragment present in control embryos but absent in morphant embryos (Fig. 2C). To test if GS is responsible for the cleavage of ADAM13 we treated Cos-7 cells with two pharmacological inhibitors of GS. Indeed, both ILCHO (McLendon et al., 2000) and DAPT (Hemming et al., 2008) prevented the accumulation of the ADAM13 cytoplasmic domain in the nuclear fractions (Fig. 2D). GS are known to cleave proteins just distal to the transmembrane domain, which for ADAM13 would release a fragment of 21 kDa. Our results showing that the fragment is approximately of 17 kDa and that the GFP-C13 fusion protein is also cleaved, although never associated with the plasma membrane, suggest that subsequent cleavage by a different enzyme may occur following the initial gamma-secretase cleavage. The absence of the 17 kDa fragment in cells treated with the GS inhibitors suggests that this first step is critical. Using immunofluorescence, the cytoplasmic domain of endogenous ADAM13 was also detected in the nucleus of Xenopus S3 cells in foci that stained less intensely for DAPI suggesting that the DNA in this region is euchromatic and potentially transcriptionally active (Fig. S2).

Figure 2. ADAM13 cytoplasmic domain translocates to the nucleus.

Figure 2

Open in a new tab

A) Schematic representation of ADAM13 proteolytic processing (left). The Pro-domain is cleaved during transit to the cell surface (1). A second extracellular cleavage within the cysteine-rich domain has also been documented (2), releasing the active protease. The cytoplasmic domain is cleaved by GS (3). The GFP-fusion protein corresponding to the ADAM13 cytoplasmic domain and the various mutants are represented (right). B) Western blot of ADAM13 cytoplasmic domain. 293T Cells were transfected with GFP, GFP-C13, and wild-type ADAM13 (A13). Cells were fractionated to generate a cytoplasmic (C) and a nuclear (N) fraction. Fractions were analyzed by western blot using a polyclonal antibody to the cytoplasmic domain of ADAM13 (arrowhead) (Alfandari et al., 1997). All membrane-bound fragments of ADAM13 are found both in the cytoplasmic fraction (plasma membrane) and in the nuclear fraction (ER attached to the nuclear membrane). The nuclear proteins PARP is found in the nuclear fraction, while GAPDH is in the cytoplasm. C) ADAM13 was immunoprecipitated from 10 embryos using a goat polyclonal antibody. Non-injected embryos (NI) at stage 12 (gastrula) and stage 18 (neurula) are compared to sibling embryos injected with MO13. The ADAM13 protein was detected using 6615F. D) Cos-7 cells transfected with ADAM13 were treated for 4 hours with GS inhibitors (+, ILCHO 50 μM or DAPT 10 μM). E) Localization of GFP-fusion proteins expressed in XTC cells. Hoecht was used to detect the nuclei in cells transfected with GFP-C13NES. See also figure S2.

The nuclear localization depends on the KR subdomain while the PR subdomain directs a GFP-fusion protein to membrane ruffles and actin stress fibers (Fig. 2E). This is consistent with a predicted bipartite nuclear localization signal in the KR region (Hulo et al., 2008), and suggests that, as shown for ADAM12, the cytoplasmic domain of ADAM13 may interact with proteins of the cytoskeleton (Cao et al., 2001a). The nuclear localization of GFP-C13 was also visible when the protein was expressed in Xenopus embryos (Fig. S2C).

To assess the contribution of nuclear localization to the function of the ADAM13 protein, we introduced a nuclear export signal (NES), based on the net-NES prediction software (la Cour et al., 2004), by adding one leucine at position 877 in the PR domain of both ADAM13 (ADAM13-NES) and GFP-C13. To test if the NES was functional we expressed GFP-C13NES in XTC cells and detected its localization in live cells. Depending on the cell, GFP-C13NES was either entirely cytoplasmic (Fig. 2E) or was present in both the nucleus and the cytoplasm of XTC cells (data not shown), suggesting that the NES is functional but that it does not prevent the translocation into the nucleus.

Translocation of the cytoplasmic domain is critical for ADAM13 function during CNC cell migration

To investigate the role of the cytoplasmic domain of ADAM13 in vivo, we injected embryos with MO13 alone or together with MO19. The injections were performed at the 16-cell stage in a single cell that contributes to the CNC, and GFP or RFP was used as a lineage tracer to follow the ability of cells to migrate in vivo (McCusker et al., 2009) (Fig. 3). Injection of MO13 inhibited CNC migration in 30% of the embryos, while the co-injection of MO13 and MO19 inhibited migration in 79% of the embryos. As seen for the grafts, injection of RNA encoding ADAM13, but not ΔCyto, rescued CNC migration. This technique presents two main advantages over the graft. First, it allows the injection and analysis of a greater number of embryos enabling us to test multiple proteins and mutants. Second, since the embryos do not have to be dissected, the migration pathways between the epidermis and the mesoderm remain intact, which could potentially explain why the targeted injection of MO13 inhibits CNC migration more efficiently than in the grafts. For these reasons, we used the targeted injection for the remainder of this study.

Figure 3. ADAM13 cytoplasmic domain is critical for cranial neural crest cell migration.

Figure 3

Open in a new tab

A) Lateral view of representative embryos injected with RFP and a control MO (CMO) or with MO13 (see also Fig.S4). The white arrows point to the fluorescence observed in the three main CNC segments (from left to right, Mandibular Branchial and Hyoid). B) Histogram representing the percentage of embryos in which CNC migration was inhibited by either MO13 (black bars) or MO13 and MO19 (2MO, grey bars). The numbers on the right indicate the number of embryos scored for each construct (schematic representation to the left). Statistical significance (at least 3 independent experiments) was calculated using a student t test p<0.05. Significant rescue is indicated with an asterisk (*), error bars are SD. C) Western Blot from Cos-7 cells transfected with various ADAM13 constructs and the protocadherin PAPC. The cell extract (Cell) and the glycoprotein purified from the culture supernatant (Media) were probed with an antibody to the extracellular domain of PAPC. The cell extract was also probed with the 7C9, a monoclonal antibody to the cysteine-rich domain of ADAM13. D) Fluorescence images of live XTC cells transfected with GFP-fusion proteins corresponding to the various ADAM cytoplasmic domains. The ADAM number and the species are indicated (xl; Xenopus laevis, dr; Danio rerio, mm; mus musculus). E) Histogram representing the rescue experiments described in (A), using a complementation assay. The total number of embryos scored in at least 3 independent experiments is indicated on the right (N). Asterisk indicate significant rescue (p<0.05), error bars are SD. The species name is indicated according to standard nomenclature (ce; Caenorhadbitis elegans, md; Monodelphis domestica).

We then performed complementation experiments by co-injecting ΔCyto together with GFP-C13 in the morphant embryos, and this combination rescued migration as efficiently as ADAM13 (Fig. 3B). Neither the single point mutant of ADAM13 containing a NES (A13-NES), nor GFP-C13 alone, was capable of rescuing migration. While mutations in the cytoplasmic domain affected the ability of ADAM13 to promote CNC migration they did not affect the proteolytic activity, as shown by the ability to cleave the protocadherin PAPC (Fig. 3C). The abnormal migration in ADAM13 KD was confirmed using in situ hybridization with Twist to detect the position of CNC after migration (Fig. S3).

Taken together, these results show that both the proteolytic activity and the cytoplasmic domain of ADAM13 are essential for CNC migration in vivo. They also show that the cytoplasmic domain does not need to be attached to the extracellular domain or to the plasma membrane, but only needs to translocate and remain in the nucleus (absence of rescue by ADAM13-NES) to perform its critical function.

Since ADAM13 is capable of cleaving itself in the cysteine-rich domain, we tested whether the autocatalysis of ADAM13 was essential to generate the cleaved cytoplasmic domain. We injected the E/A-ADAM13, which is incapable of self-processing, together with ΔCyto mRNA in morphant embryos. This combination did not rescue CNC migration (Fig. 3E) suggesting that, in vivo, the initial autocatalytic cleavage is required for the secondary cleavage by GS.

The ADAM19 cytoplasmic domain can compensate for ADAM13

To investigate if other ADAMs could compensate for the loss of the ADAM13 cytoplasmic domain, we made GFP-fusions with the cytoplasmic domains of Xenopus ADAM9, 10 and 19 which all translocated into the nucleus of transfected XTC cells (Fig. 3D). In complementation experiments, the cytoplasmic domain of ADAM19 was able to rescue migration, while neither the ADAM9 nor the ADAM10 cytoplasmic domains could (Fig. 3E). Given that ADAM9 can cleave Cadherin-11 (McCusker et al., 2009) and ADAM19 can compensate for the loss of the ADAM13 cytoplasmic domain, the presence of both proteins in the CNC may explain why the loss of ADAM13 only produces defective migration in 30 to 50% of the embryos, while the double KD of ADAM13 and 19 inhibits migration in 80% of the embryos.

The functionality of the ADAM13 cytoplasmic domain is evolutionarily conserved

To test whether the function of the ADAM13 cytoplasmic domain is evolutionarily conserved, we cloned the cytoplasmic domains of the putative ADAM13 orthologues from worm (adm-2), zebrafish (ADAM19a), marsupial (ADAM13) and mouse (ADAM33) in frame with GFP. While the C. elegans (ceCm), zebrafish (drC13) and the opossum (mdC13) constructs all translocated into the nucleus and rescued CNC migration, the mouse (mmC33) construct did neither (Fig. 3D-E). Using the mouse constructs, the cytoplasmic domain of ADAM19 but not ADAM12 was able to rescue CNC migration (Fig. 3E). This demonstrates that even within the meltrin subfamily, the cytoplasmic domains, which share proline-rich repeats and basic residues, possess a relatively strict specificity in regulating cell migration.

Role of the ADAM13 cytoplasmic domain

To understand the role of the cytoplasmic domain of ADAM13 in the nucleus, we then tested if this domain could regulate gene expression in the CNC. We dissected CNC from embryos injected with either a control MO (CMO), MO13 alone or with both MO13 and GFP-C13. Gene expression was assayed using microarrays on independent triplicate experiments (Affimetrix, BioMicro Center MIT core facility). The results of the overall analysis of gene expression show that the variation between experiments is greater than the variation between samples within each experiment, suggesting that the level of gene expression in outbred Xenopus populations is highly variable, and that the analysis should be carried within each batch of sibling embryos before comparing multiple experiments. These data have been submitted in NCBI’s Gene Expression Omnibus (Edgar et al., 2002), and are accessible through GEO series accession number GSE21517.

We therefore used paired student t-test (TM4 software suite (Saeed et al., 2006)) to identify genes that were significantly affected by the loss of ADAM13 (p<0.01). A surprisingly large number (40%) of genes were identified (matrix2). However within these 6121 genes, only 172 were increased or decreased by more than 40%, suggesting that ADAM13 is required for the correct expression of a large number of genes, and that it serves to modulate target gene expression rather than switch them on or off.

We then performed another t-test within this first set of genes (6121) to identify those that were also significantly affected by the presence of the ADAM13 cytoplasmic domain (p<0.01), and found that one third of these genes were (2096, matrix3). We further consolidated the data by keeping only the genes that were either reduced or increased with a minimum variation of 40% (174 genes). Examples of genes affected by the ADAM13 knockdown and the cytoplasmic domain rescue are given in Figure 4A. These data show that the ADAM13 cytoplasmic domain can modulate the expression of multiple genes in the CNC cells.

Figure 4. The cytoplasmic domain of ADAM13 regulates gene expression.

Figure 4

Open in a new tab

A) Representative genes were selected from the microarray data. The average fold change between the control MO and MO13 (MO13) or between MO13 and the rescue MO13 plus GFP-C13 (MO13+C13) is represented as a Log2. Error bars represent the SD. Four groups of genes are presented. Xmc (Xenopus Marginal Coil), Pafr (Platelet-activating factor receptor), capn8-a (Calpain8-a), Wnt3-A (Wingless-type MMTV integration site 3A) and Pou50 (Pou-homeobox gene 50) are decreased in CNC injected with MO13 and are partially rescued by GFP-C13. Nudc (Nuclear distribution gene C), Rad1 (Cell cycle check point) and Vamp8 (Vesicle-associated membrane protein 8) are increased in CNC lacking ADAM13, and rescued by GFP-C13. Dusp18 (Dual specificity Phosphatase 18) and mek-2 (Erk Kinase) are increased in CNC with MO13, while camK1 (Calcium/calmodulin-dependent protein kinase 1) and Dap (Death-associated protein kinase 1) are decreased, with no significant effect from GFP-C13. B) Histogram representation of quantitative PCR data. Amplification was performed from cDNA isolated from CNC of embryos injected with either MO13 or a combination of MO13, plus the cytoplasmic domains of ADAM9 (blue), ADAM13 (red) or ADAM19 (green). Values are represented as the Log2 fold change compared to MO13 alone. Error bars correspond to the SD between triplicates. (Myt1: myelin transcription factor 1, Fst: follistatin, Nubp1: nucleotide binding protein 1, Inta6: Integrin alpha 6). C) Complementation assays with embryos injected with MO13 plus ΔCyto alone or with either MMP13, Capn8-a or Xmc. CNC migration was also measured in embryos injected with a MO to Capn8-a or a DN Capn8-a construct (Capn8-aC105S). The total number of embryos is given (n). Error bars correspond to the SD. Statistical analysis was done using a student t test. Asterisk represents p values <0.01, for a or <0.05 for b. Representative examples are given in D.

Calpain-8 can rescue migration in CNC lacking the ADAM13 cytoplasmic domain

To identify genes regulated by the ADAM13 cytoplasmic domain that are essential for CNC migration we performed quantitative PCR on CNC with MO13 alone or MO13 plus GFP-C9, -C13 or -C19 (Fig. 4B). We expected that genes important for CNC migration would be regulated by GFP-C13 and GFP-C19, but not GFP-C9 since this construct does not rescue migration (Fig. 3). We found that Calpain8-a (Capn8-a) was the only gene tested that fit the hypothesis. To test whether any of these genes were important for CNC migration, we injected mRNA encoding each of the candidates together with MO13 and ΔCyto in complementation assays. Only Capn8-a was able to rescue CNC migration confirming that at least one gene regulated by the ADAM13 cytoplasmic domain is required for CNC migration (Fig. 4C-D). The role of Capn8-a in CNC migration was confirmed using both a DN (Cao et al., 2001b) and a KD (MO to prevent splicing). Using these two reagents in targeted injections, we found that CNC migration was inhibited by ~40% with the MO and ~30% with the DN (Fig. 4C).

Together these results demonstrate the importance of Capn8-a in CNC migration and confirm that one of the essential roles of the ADAM13 cytoplasmic domain is to increase Capn8-a expression.

Discussion

Role of ADAM cytoplasmic domains

The cytoplasmic domains of ADAM10 (Tousseyn et al., 2009) and ADAM13 are cleaved and translocate into the nucleus, suggesting that this may be a general feature of ADAMs. Our study shows that this translocation is essential for ADAM13 to increase Capn8-a expression and promote CNC migration. Calpains have been linked to cell migration but their role is not entirely solved. They may affect cell migration by cleaving components of focal adhesions such as integrins, focal adhesion kinase and talin at the trailing edge of the cell to control the release of the cell membrane from the substrate (Franco and Huttenlocher, 2005). Other studies have shown that they can cleave β-catenin to remove the GSK3 phosphorylation sites and generate a stable form that can translocate into the nucleus and induce the expression of target genes including those involved in epithelium to mesenchyme transition (Abe and Takeichi, 2007). The MO that prevents Capn8-a splicing will be useful to test the various hypotheses and determine the exact contribution of this protease during CNC migration.

Our results clearly show that while multiple ADAM cytoplasmic domains can translocate into the nucleus, they have distinct and specific functions that will need to be elucidated for each protein and may contribute to the overall function of the protein, as well as the robust effect of the DN constructs that have been used in the past. These DNs, lacking the proteolytic activity, are often more potent at producing a phenotype than the elimination of the protein (Alfandari et al., 2001; Pan and Rubin, 1997). This could be the result of over-expressing the cytoplasmic domain both in cells that normally express the target ADAM and ectopically in cells that do not.

In physiological situation, it will be interesting to determine the role of the cytoplasmic domain of non-proteolytic ADAMs. In pathological conditions, it will be of interest to define mutations in the cytoplasmic domain of ADAMs that are associated with specific diseases and determine if these affect the cleavage, translocation or other activity of this domain in and out of the nucleus.

Evolutionary conservation of the ADAM13 protein function

Here we show that the single meltrin found in C. elegans, as well as the orthologues of ADAM13 in fishes and marsupials but not in eutherians (placental mammals), can functionally replace the cytoplasmic domain of Xenopus ADAM13. In eutherians, the most likely orthologue is ADAM33, but its cytoplasmic domain is not conserved in either sequence identity (it is acidic rather than basic) or function. In the mouse and human genomes there is no better candidate, making it likely that the role of the ADAM13 cytoplasmic domain has been lost. The duplication of the single meltrin (c.e.adm-2) during evolution has generated four distinct ADAMs in vertebrates (ADAM9, 12, 13/33, 19). Of these, ADAM13 and ADAM19 maintained the original nuclear function in most vertebrates, while after the divergence between marsupials and eutherians the function was lost in ADAM13/33. This could have been facilitated by the ability of the ADAM19 cytoplasmic domain to assume ADAM13 role, decreasing the selection pressure.

It will be interesting to identify the sequence that allows the ADAM13 and 19 cytoplasmic domains to selectively activate Capn8-a and promote CNC migration. Clearly, the proline repeats and basic amino acids are required but not sufficient since ADAM9 and 12 possess both but are not capable of rescuing cell migration.

Conclusions

ADAMs are multifunctional proteins that have been studied extensively with regard to their proteolytic activities. While this domain is clearly one of the most important of the protein, the sum of all domains is required to control not only substrate specificity and sub-cellular localization, but also cell signaling.

Experimental procedures

Morpholinos

Morpholino antisense oligonucleotides (Genetool) against ADAM13 and ADAM19 have been described previously (McCusker et al., 2009; Neuner et al., 2009). Two control-morpholinos were used. One corresponds to a randomly generated sequence of 25-mer and the other corresponds to a standard sequence (CCTCTTACCTCAGTTACAATTTATA). The morpholino antisense oligonucleotide to Calpain8-a (GAAAGTTATGAGACAACACCTGCTT) was designed to prevent splicing. The realtime PCR primers were used to amplify genomic DNA containing an intron, which was cloned and sequenced. The efficiency was tested by realtime PCR from polyA-RNA purified from embryos injected with 25, 12.5 and 6.25 ng of MO-capn. 80 to 90% KD of Capn8-a mRNA was achieved using the lowest dose. A dose of 1 ng at the 8-cell stage was chosen for the migration assay.

Antibodies

6615F: Rabbit polyclonal antibody to the ADAM13 cytoplasmic (Alfandari et al., 1997), gA13: Goat polyclonal antibody to the ADAM13 cytoplasmic, 7C9: mouse monoclonal to the ADAM13 cysteine-rich domain (Gaultier et al., 2002). PARP: mouse monoclonal C2-10 (BD, PharMingen). GAPDH: mouse monoclonal antibody 6C5 (Millipore). PAPC: mouse monoclonal to the extracellular domain (Chen and Gumbiner, 2006).

Injections

Capped mRNA were synthesized using SP6 RNA polymerase on DNA linearized with NotI as described before (Cousin et al., 2000). For the CNC migration assays, embryos were injected at the 16-cell stage in one dorsal animal blastomere with 1 ng of MO, 200 pg of RFP mRNA and 80 pg of mRNA encoding various constructs. For the graft assays, embryos were injected at the two cell stage with 5 ng of MO, 300 pg of GFP mRNA, 400 pg of ADAM13 mRNA or 200 pg of ADAM19 mRNA. Embryos were raised at 15°C until tail bud stage (St. 24 to 28) at which time CNC migration was scored. The percentage of inhibition was normalized to embryos injected with RFP or GFP alone.

For the gene expression analysis, embryos were injected at the one cell stage with 10 ng of either a CMO, MO13 or MO13 plus 0.5 ng of GFP-C13. Embryos were grown at 15°C for 48 hours until neurula stage (St. 15 to 17), at which point CNC were dissected and immediately placed in a guanidium thioisocyanate solution to extract RNA. To control for the viability of the explants, 4 CNC explants were placed on fibronectin and imaged by time-lapse microscopy using a Zeiss 200M inverted microscope and the openlab4 software (Improvision). CNC from each condition were capable of migrating in vitro. RNA extraction was performed as previously described (Chomczynski and Sacchi, 1987). Total RNA was quantified by absorbance at 260 nm using a nanodrop (Thermo Scientific).

RNA Amplification/Affymetrix Microarray

RNA were processed by the MIT core facility as described in the supplemental methods.

Quantitative PCR

Quantitative PCR was performed as previously described (Neuner et al., 2009). All primers were tested for efficiency. Primer sequences are given in Table S4. cDNA was produced using polyA mRNA purified from 10 CNC explants (Qiagen) using direct cDNA kit (Quanta) according to manufacturer’s instruction.

Cell culture and transfection

Cos-7 cells and 293T cells were obtained from ATCC and transfected using Fugene-6 according to manufacturer’s instruction. Protein analysis was done 48 hours after transfection. Cos-7 cells were trypsinized while 293T cells were collected by pipetting into ice cold PBS. Nuclear and cytoplasmic fractions were isolated using the NE-PER kit (Pierce) following manufacturer’s instruction. For PAPC shedding assay, cells were incubated with media containing 2% serum 24 hours after transfection and conditioned supernatants were collected at 48 hours. The shed extracellular domain was purified using Concanavalin-A-agarose (Vector), eluted in reducing Laemmi and blotted using the PAPC monoclonal antibody (Chen and Gumbiner, 2006).

Fluorescence

Xenopus XTC cells were transfected using Fugene-HD following manufacturer’s instruction and placed on FN-coated glass bottom plates (Matek Corp.). Cells were transfected with the GFP-fusion proteins, and were incubated with Hoechst (Invitrogen) to label nuclei. Photographs were taken using a Zeiss 200M inverted microscope equipped with an Apotome and a 63X immersion lens to obtain optical sections. For in vivo CNC migration assays, tailbud stage embryos were imaged using a Nikon fluorescent dissecting microscope.

Supplementary Material

01

Acknowledgments

This work was supported by a grant from USPHS (DE016289) to Dr. Alfandari. Thanks to Drs. B. Osborne, J. Mager and L. Minter for critical reading of the manuscript. Thanks to Drs. C. Whittaker and M. Hagen for their help in microarray data analysis. We thank Dr. Gumbiner for the PAPC antibody, Dr. Karlstrom for dr embryos, Dr. K. Smith for md RNA, and Dr. D. Chase for ce clone.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abe K, Takeichi M. NMDA-receptor activation induces calpain-mediated beta-catenin cleavages for triggering gene expression. Neuron. 2007;53:387–397. doi: 10.1016/j.neuron.2007.01.016. [DOI] [PubMed] [Google Scholar]
  2. Alfandari D, Cousin H, Gaultier A, Smith K, White JM, Darribere T, DeSimone DW. Xenopus ADAM 13 is a metalloprotease required for cranial neural crest- cell migration. Curr Biol. 2001;11:918–930. doi: 10.1016/s0960-9822(01)00263-9. [DOI] [PubMed] [Google Scholar]
  3. Alfandari D, McCusker C, Cousin H. ADAM function in embryogenesis. Semin Cell Dev Biol. 2009;20:153–163. doi: 10.1016/j.semcdb.2008.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alfandari D, Wolfsberg TG, White JM, DeSimone DW. ADAM 13: a novel ADAM expressed in somitic mesoderm and neural crest cells during Xenopus laevis development. Dev Biol. 1997;182:314–330. doi: 10.1006/dbio.1996.8458. [DOI] [PubMed] [Google Scholar]
  5. Blobel CP. ADAMs: key components in EGFR signalling and development. Nat Rev Mol Cell Biol. 2005;6:32–43. doi: 10.1038/nrm1548. [DOI] [PubMed] [Google Scholar]
  6. Cao Y, Kang Q, Zolkiewska A. Metalloprotease-disintegrin ADAM 12 interacts with alpha-actinin-1. Biochem J. 2001a;357:353–361. doi: 10.1042/0264-6021:3570353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cao Y, Zhao H, Grunz H. XCL-2 is a novel m-type calpain and disrupts morphogenetic movements during embryogenesis in Xenopus laevis. Dev Growth Differ. 2001b;43:563–571. doi: 10.1046/j.1440-169x.2001.00592.x. [DOI] [PubMed] [Google Scholar]
  8. Chen X, Gumbiner BM. Paraxial protocadherin mediates cell sorting and tissue morphogenesis by regulating C-cadherin adhesion activity. J Cell Biol. 2006;174:301–313. doi: 10.1083/jcb.200602062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  10. Cousin H, Gaultier A, Bleux C, Darribere T, Alfandari D. PACSIN2 is a regulator of the metalloprotease/disintegrin ADAM13. Dev Biol. 2000;227:197–210. doi: 10.1006/dbio.2000.9871. [DOI] [PubMed] [Google Scholar]
  11. Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30:207–210. doi: 10.1093/nar/30.1.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Franco SJ, Huttenlocher A. Regulating cell migration: calpains make the cut. J Cell Sci. 2005;118:3829–3838. doi: 10.1242/jcs.02562. [DOI] [PubMed] [Google Scholar]
  13. Gaultier A, Cousin H, Darribere T, Alfandari D. ADAM13 disintegrin and cysteine-rich domains bind to the second heparin-binding domain of fibronectin. J Biol Chem. 2002;277:23336–23344. doi: 10.1074/jbc.M201792200. [DOI] [PubMed] [Google Scholar]
  14. Hass MR, Sato C, Kopan R, Zhao G. Presenilin: RIP and beyond. Semin Cell Dev Biol. 2009;20:201–210. doi: 10.1016/j.semcdb.2008.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hemming ML, Elias JE, Gygi SP, Selkoe DJ. Proteomic profiling of gamma-secretase substrates and mapping of substrate requirements. PLoS Biol. 2008;6:e257. doi: 10.1371/journal.pbio.0060257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Howard L, Nelson KK, Maciewicz RA, Blobel CP. Interaction of the metalloprotease disintegrins MDC9 and MDC15 with two SH3 domain-containing proteins, endophilin I and SH3PX1. J Biol Chem. 1999;274:31693–31699. doi: 10.1074/jbc.274.44.31693. [DOI] [PubMed] [Google Scholar]
  17. Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, Lachaize C, Langendijk-Genevaux PS, Sigrist CJ. The 20 years of PROSITE. Nucleic Acids Res. 2008;36:D245–249. doi: 10.1093/nar/gkm977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Izumi Y, Hirata M, Hasuwa H, Iwamoto R, Umata T, Miyado K, Tamai Y, Kurisaki T, Sehara-Fujisawa A, Ohno S, et al. A metalloprotease-disintegrin, MDC9/meltrin-gamma/ADAM9 and PKCdelta are involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Embo J. 1998;17:7260–7272. doi: 10.1093/emboj/17.24.7260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Janes PW, Wimmer-Kleikamp SH, Frangakis AS, Treble K, Griesshaber B, Sabet O, Grabenbauer M, Ting AY, Saftig P, Bastiaens PI, et al. Cytoplasmic relaxation of active Eph controls ephrin shedding by ADAM10. PLoS Biol. 2009;7:e1000215. doi: 10.1371/journal.pbio.1000215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. la Cour T, Kiemer L, Molgaard A, Gupta R, Skriver K, Brunak S. Analysis and prediction of leucine-rich nuclear export signals. Protein Eng Des Sel. 2004;17:527–536. doi: 10.1093/protein/gzh062. [DOI] [PubMed] [Google Scholar]
  21. Maretzky T, Le Gall SM, Worpenberg-Pietruk S, Eder J, Overall CM, Huang XY, Poghosyan Z, Edwards DR, Blobel CP. Src stimulates fibroblast growth factor receptor-2 shedding by an ADAM15 splice variant linked to breast cancer. Cancer Res. 2009;69:4573–4576. doi: 10.1158/0008-5472.CAN-08-4766. [DOI] [PubMed] [Google Scholar]
  22. McCusker C, Cousin H, Neuner R, Alfandari D. Extracellular cleavage of cadherin-11 by ADAM metalloproteases is essential for Xenopus cranial neural crest cell migration. Mol Biol Cell. 2009;20:78–89. doi: 10.1091/mbc.E08-05-0535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. McLendon C, Xin T, Ziani-Cherif C, Murphy MP, Findlay KA, Lewis PA, Pinnix I, Sambamurti K, Wang R, Fauq A, et al. Cell-free assays for gamma-secretase activity. Faseb J. 2000;14:2383–2386. doi: 10.1096/fj.00-0286fje. [DOI] [PubMed] [Google Scholar]
  24. Neuner R, Cousin H, McCusker C, Coyne M, Alfandari D. Xenopus ADAM19 is involved in neural, neural crest and muscle development. Mech Dev. 2009;126:240–255. doi: 10.1016/j.mod.2008.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pan D, Rubin GM. Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell. 1997;90:271–280. doi: 10.1016/s0092-8674(00)80335-9. [DOI] [PubMed] [Google Scholar]
  26. Reiss K, Maretzky T, Ludwig A, Tousseyn T, de Strooper B, Hartmann D, Saftig P. ADAM10 cleavage of N-cadherin and regulation of cell-cell adhesion and beta-catenin nuclear signalling. Embo J. 2005;24:742–752. doi: 10.1038/sj.emboj.7600548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li J, Thiagarajan M, White JA, Quackenbush J. TM4 microarray software suite. Methods Enzymol. 2006;411:134–193. doi: 10.1016/S0076-6879(06)11009-5. [DOI] [PubMed] [Google Scholar]
  28. Stautz D, Sanjay A, Hansen MT, Albrechtsen R, Wewer UM, Kveiborg M. ADAM12 localizes with c-Src to actin-rich structures at the cell periphery and regulates Src kinase activity. Exp Cell Res. 2010;316:55–67. doi: 10.1016/j.yexcr.2009.09.017. [DOI] [PubMed] [Google Scholar]
  29. Tousseyn T, Thathiah A, Jorissen E, Raemaekers T, Konietzko U, Reiss K, Maes E, Snellinx A, Serneels L, Nyabi O, et al. ADAM10, the rate–limiting protease of regulated intramembrane proteolysis of Notch and other proteins, is processed by ADAMS-9, ADAMS-15, and the gamma-secretase. J Biol Chem. 2009;284:11738–11747. doi: 10.1074/jbc.M805894200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wei S, Xu G, Bridges LC, Williams P, White JM, Desimone DW. ADAM13 Induces Cranial Neural Crest by Cleaving Class B Ephrins and Regulating Wnt Signaling. Dev Cell. 2010;19:345–352. doi: 10.1016/j.devcel.2010.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wolfsberg TG, Primakoff P, Myles DG, White JM. ADAM, a novel family of membrane proteins containing A Disintegrin And Metalloprotease domain: multipotential functions in cell-cell and cell- matrix interactions. J Cell Biol. 1995;131:275–278. doi: 10.1083/jcb.131.2.275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Xu P, Derynck R. Direct activation of TACE-mediated ectodomain shedding by p38 MAP kinase regulates EGF receptor-dependent cell proliferation. Mol Cell. 2010;37:551–566. doi: 10.1016/j.molcel.2010.01.034. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS261436-supplement-01.pdf (783.1KB, pdf)

RESOURCES