TNF-α potentiates lysophosphatidic acid-induced COX-2 expression via PKD in human colonic myofibroblasts

Abstract

The myofibroblast (MFB) has recently been identified as an important mediator of tumor necrosis factor-α (TNF-α)-associated colitis and cancer, but the mechanism(s) involved remains incompletely understood. Here, we show that treatment of 18Co cells, a model of human colonic MFBs, with TNF-α and lysophosphatidic acid (LPA) induced striking synergistic cyclooxygenase-2 (COX-2) protein expression and production of PGE₂. This effect was prevented by the LPA₁ receptor antagonist Ki16425, the G_iα-specific inhibitor pertussis toxin, and by the preferential protein kinase (PK) C inhibitors GF109203X and Go6983. As a known downstream target of LPA and PKC, we tested whether PKD, recently implicated in the regulation of COX-2 expression in MFB, was involved in this response. TNF-α, while having no detectable effect on the activation of PKD when added alone, augmented PKD activation stimulated by LPA, as measured by PKD autophosphorylation at Ser⁹¹⁰. LPA-induced PKD activation was also inhibited by Ki16425, pertussis toxin, GF109203X, and Go6983. Transfection of 18Co cells with short interfering RNA targeting PKD completely inhibited the synergistic increase in COX-2 protein, demonstrating a critical role of PKD in this response. Our results imply that cross talk between TNF-α and LPA results in the amplification of COX-2 protein expression via a conserved PKD-dependent signaling pathway that appears to involve the LPA₁ receptor and the G protein G_iα. PKD plays a critical role in the expression of COX-2 in human colonic MFBs and may contribute to an inflammatory microenvironment that promotes tumor growth.

myofibroblasts are a subpopulation of stromal cells located in the lamina propria of the gastrointestinal (GI) tract that interact with neighboring cells in a paracrine fashion through the secretion of cytokines, growth factors, and inflammatory mediators, including prostanoids (36, 62). Through these interactions, myofibroblasts regulate multiple biological processes, including epithelial proliferation and differentiation, apoptosis, migration, mucosal repair, and fibrosis (21, 36). They also participate in immune and inflammatory responses (39) and have been implicated in the underlying pathophysiology that characterizes both ulcerative colitis and colorectal cancer (16, 21, 36, 45).

Myofibroblasts are a major source of the inducible isoform of cyclooxygenase (COX-2) (2, 21, 24, 32, 43, 62), the rate-limiting enzyme in arachidonate metabolism that catalyzes the biosynthesis of prostaglandin (PG) H₂, the precursor of prostanoids, including PGs and thromboxanes (25). Substantial evidence demonstrates that PGs play an important role in both inflammation and cancer in the GI tract (4, 16, 25, 45, 57a). Interestingly, increased expression of myofibroblasts, in parallel with elevated levels of COX-2, are seen in the stroma underlying colonic adenomas and carcinomas (1, 2, 5, 21, 43, 52, 58). Therefore, understanding the regulation of COX-2 expression in intestinal myofibroblasts may provide insights into the pathogenesis of inflammation-associated cancer in the gut. Despite their importance, the cell signaling pathways that regulate myofibroblast function, particularly in the setting of inflammation, remain incompletely understood.

TNF-α is a 17-kDa proinflammatory cytokine that plays a pivotal role in regulating the inflammatory signaling cascades characteristic of ulcerative colitis (3) and has been strongly implicated in colitis-associated cancer (17, 35). Binding of TNF-α to its receptors, TNF-α receptor 1 (TNFR1) and TNF-α receptor 2 (TNFR2), triggers the formation of a multiprotein complex (TNFR1-associated death domain protein, receptor interacting protein, TNFR-associated factor 2) that initiates downstream signaling via phosphorylation cascades that culminate in the activation of mitogen-activated protein kinases and the transcription factor NF-κB (reviewed in Ref. 53). Myofibroblasts have recently been identified as an important mediator of TNF-α-associated colitis, but the precise mechanism(s) involved remains incompletely understood (3). The ability of a single antibody targeted against TNF-α to induce clinical remission in patients with Crohn's disease and ulcerative colitis suggests that TNF-α is a central regulator of multiple inflammatory signaling pathways that could promote the development of colitis-associated cancer.

Lysophosphatidic acid (LPA) is a phospholipid that initiates signaling cascades involved in the inflammatory response and may be a potential target for cross talk with TNF-α. LPA is involved in diverse biological processes, including wound healing, cell migration and contraction, vascular remodeling, tumor progression, and cytokine and matrix metalloproteinase production (28). LPA-mediated signaling occurs via specific LPA receptors (LPA_1–5) and at least three different G protein subfamilies (Gα_q/11, G_i/o, G_12/13). The main LPA-producing phospholipase is autotaxin, a member of the nucleotide pyrophosphatase/phosphodiesterase family of ectoenzymes, and a widely expressed autocrine motility factor that is identical to lysophospholipase D. Autotaxin is secreted by adipocytes (13) and connective tissue-type mast cells (49) and is present in the small and large intestine (13, 49), localized to the submucosal layer. Here, mast cells can provide locally bioactive LPA in high concentration (49), where it has effects on the overlying mucosa, and on surrounding mesenchymal cells (e.g., myofibroblasts) of the lamina propria. Autotaxin is overexpressed in many human cancers and has been associated with tumor progression and angiogenesis (28).

Protein kinase D (PKD) is the founding member of a new protein kinase family (38) that lies downstream of protein kinase C (PKC) isoforms in a phosphorylation cascade (18, 57, 67, 68), implicated in the regulation of a variety of biological responses, including inflammation (9, 62), oxidative stress (47, 48, 55, 56), cell proliferation (45, 46, 66), and carcinogenesis (7, 14, 20, 29, 34, 40). While little is known regarding the regulation and biological function of PKD in intestinal myofibroblasts, recent work in our laboratory has implicated PKD as an important mediator of TNF-α-associated COX-2 expression (62).

In the present study, we show synergistic effects between LPA and TNF-α in cultures of human colonic myofibroblasts (18Co cells), leading to dramatic COX-2 expression, PGE₂ production, and PKC/PKD axis activation via the LPA₁ receptor and the G_iα protein subunit. The results presented here demonstrate unique cross talk interactions between TNF-α and G_iα-mediated LPA signaling that result in striking amplification of COX-2 expression through a conserved PKD-dependent mechanism in colonic myofibroblasts.

MATERIALS AND METHODS

Cell culture.

18Co cells (CRL-1459) were purchased from American Type Culture Collection (Rockville, MD). These cells share many of the structural and functional characteristics of in situ colonic subepithelial myofibroblasts, including a reversible stellate morphology, α-smooth actin expression, and the presence of multiple cell surface receptors (51). 18Co cells provide a model to elucidate physiological and pathophysiological functions of intestinal subepithelial myofibroblasts and, accordingly, have been used extensively to study colonic myofibroblast function in a variety of settings (22, 33, 42). 18Co cells were maintained at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) in a humidified atmosphere containing 10% CO₂ and 90% air. For experimental purposes, cells were plated in 35-mm dishes (1 × 10⁵ cells/dish) and grown in DMEM containing 10% FBS for 5–7 days until confluent and used from passages 8–14.

Immunoblotting and detection of PKD and COX-2.

Confluent 18Co cells, treated with different agonists, antagonists, inhibitors, and short interfering RNA (siRNA), as indicated in the individual experiments, were lysed in 2× SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer (20 mM Tris·HCl, pH 6.8, 6% SDS, 2 mM EDTA, 4% 2-mercaptoethanol, 10% glycerol) and boiled for 10 min. After SDS-PAGE, proteins were transferred to Immobilon-P membranes. The transfer was carried out at 100 V, 0.4 A at 4°C for 5 h using a Bio-Rad transfer apparatus. The transfer buffer consisted of 200 mM glycine, 25 mM Tris, 0.01% SDS, and 20% CH₃OH. For detection of proteins, membranes were blocked using 5% nonfat dried milk in phosphate-buffered saline (pH 7.2) and then incubated for 2 h with the desired antibodies diluted in phosphate-buffered saline (pH 7.2) containing 3% nonfat dried milk. Primary antibodies bound to immunoreactive bands were visualized by enhanced chemiluminescence detection with horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies (GE Healthcare, Piscataway, NJ). The phospho-PKD polyclonal antibody pSer⁹¹⁰ (Millipore, Billerica, MA) detects PKD when it is phosphorylated on Ser⁹¹⁰, shown in previous reports.

ELISA.

PGE₂ was quantified from the supernatant of serum-starved, confluent 18Co cells following treatment conditions, according to EIA kit instructions (Prostaglandin E₂ EIA kit, Cayman Chemical, Ann Arbor, MI). The collected supernatant was centrifuged at 5,000 g for 5 min to remove cell debris. Absorbance readings were set between 405 and 420 nm on a spectrophotometer.

PKD siRNA transfection.

The SMART pool PKD siRNA duplexes were purchased from Dharmacon (Lafayette, CO). The PKD siRNA pool was designed to target against the mRNA of human PKD (NM_002742) and consists of four selected siRNA oligonucleotides. The sequences were as follows: oligo 1, CGGCAAAUGUAGUGUAUUAUU; oligo 2, GAACCAACUUGCACAGAGAUU; oligo 3, GGUCUGAAUUACCAUAAGAUU; oligo 4, GGAGAUAGCCAUCCAGCAUUU. siCONTROL nontargeting siRNA no. 3 (D-001210-03-20) was used as the control. 18Co cells were plated at ∼70–80% confluency in a 12-well plate with DMEM supplemented with 10% FBS and 1% antibiotic/antimycotic at 37°C in a humidified atmosphere containing 10% CO₂. After 24 h, each well was replaced with 400 μl DMEM + 10% FBS (no antibiotic). Added to this was a mixture containing the Mirus TKO-IT transfection agent and PKD siRNA or control nontargeting siRNA (total volume: 500 μl per well, total transfection agent: 4 μl per well, siRNA: 50 nM). After incubation for 72 h, cells were used for experiments and subsequently analyzed by Western blot.

Materials.

Bradykinin (BK) and the PKC inhibitor GF109203X were purchased from Sigma (St. Louis, MO). TNF-α was purchased from R&D Systems (Minneapolis, MN). COX-2 antibody was purchased from Cell Signaling Technology (Beverly, MA). The PKC inhibitor Go6983, pertussis toxin (PTx), SB-202190, and U-0126 were purchased from Calbiochem (La Jolla, CA). LPA was purchased from both Sigma (St. Louis, MO) and Cayman Chemical (Ann Arbor, MI). The LPA receptor inhibitor Ki16425 was purchased from Cayman Chemical (Ann Arbor, MI). PKD siRNA was purchased from Dharmacon (Lafayette, CO). α-Smooth muscle actin antibody was purchased from Abcam (Cambridge, MA).

RESULTS

LPA and TNF-α lead to synergistic COX-2 expression in 18Co cells.

To determine whether the proinflammatory mediators LPA and TNF-α regulate COX-2 expression in human colonic myofibroblasts, 18Co cells were treated with LPA or TNF-α, either alone or in combination, over 24 h, and the level of COX-2 protein expression was assessed by Western blot analysis. There was no detectable COX-2 protein in unstimulated 18Co cells. Treatment of 18Co cells with 10 μM LPA induced minimal COX-2 protein expression over the 24-h time period studied (Fig. 1A). Treatment with TNF-α (8 ng/ml) alone stimulated levels of COX-2 expression that were slightly higher than that in the LPA-treated cells. This effect reached a peak after 4 h, but was not detectable after 24 h. However, when myofibroblasts were treated with LPA following an overnight incubation with TNF-α, this led to a synergistic time-dependent increase in COX-2 protein expression that was evident after 2 h and was dramatically augmented between 4 and 8 h, followed by a decline over the 24-h time period studied (Fig. 1A).

Fig. 1.

Lysophosphatidic acid (LPA) and TNF-α lead to synergistic cyclooxygenase (COX)-2 expression and PGE₂ production in 18Co cells. A: confluent 18Co cells were washed and equilibrated in serum-free media for 30 min, followed by treatment with 8 ng/ml TNF-α, 10 μM LPA, or both for various times (2, 4, 8, and 24 h, as indicated). Lysates of these cells were then analyzed by Western blot using a polyclonal antibody that detects COX-2 protein. Autoluminograms were quantified by densitometric scanning. The results shown are means ± SE, n = 3, and are expressed as percentage of the maximum level of COX-2 expression, which correlated with a 48-fold increase over control. Equal protein loading was verified using an antibody that detects ERK-2 and α-smooth muscle actin (α-SMA). B: cultures of confluent 18Co cells were incubated in serum-free medium with 10 μM LPA (medium shaded bars), 8 ng/ml TNF-α (TNF, light shaded bars), or both (TNF+LPA, dark shaded bars) for various times (2, 4, 8, and 24 h, as indicated), with untreated cells (open bar) serving as a control. PGE₂ released into the medium was quantified by ELISA.

To determine whether the induction of COX-2 protein expression by LPA and TNF-α was associated with an increase in PGE₂ production, 18Co cells were again treated with LPA and TNF-α, alone and in combination, over 24 h. Cell culture supernatant was collected at various times, and PGE₂ levels were quantified utilizing an ELISA. As shown in Fig. 1B, treatment of 18Co cells with LPA stimulated low levels of PGE₂ production, which correlated with the modest increase in COX-2 expression seen by Western blot analysis. Treatment with TNF-α over 24 h produced a greater effect compared with that in LPA-treated cells, although the effect was also modest. However, exposure of 18Co cells to TNF-α for 18 h followed by LPA induced a synergistic increase in the production of PGE₂ that was evident after 8 h and was sustained over a 24-h time period. Thus the proinflammatory mediators LPA and TNF-α induced synergistic COX-2 protein expression that was paralleled by increases in the production of PGE₂ in human colonic myofibroblasts.

Since the augmented expression of COX-2 protein was most apparent after 4 h, we utilized this early time period to perform an additional time course experiment to fully characterize the timing of COX-2 protein expression (Fig. 2A). 18Co cells were pretreated overnight with TNF-α, followed by treatment with LPA over 4 h, and COX-2 expression was analyzed by Western blot. Under these conditions, the upregulation of COX-2 was evident after 2 h, with a steady increase in protein expression between 2 and 4 h. Based on this experiment, 18Co cells were treated with LPA for 4 h for all subsequent experiments.

Fig. 2.

LPA-induced COX-2 protein expression is augmented by prior exposure to TNF-α. A: confluent 18Co cells were washed and equilibrated in serum-free media for 30 min, incubated with 8 ng/ml TNF-α for 18 h, and then stimulated with LPA (10 μM) for various times (0–4 h as indicated). Lysates were then analyzed by SDS-PAGE and Western blot using a polyclonal antibody that detects COX-2 protein. The results shown are means ± SE, n = 3, and are expressed as percentage of the maximum level of COX-2 expression, which correlated with a 4.3-fold increase over control. Equal protein loading was verified using an antibody that detects ERK-2. *Statistical significance (P < 0.05). B: 18Co cells were treated with TNF-α overnight at various concentrations (0–80 ng/ml), followed by treatment with LPA (10 μM) for 4 h. Lysates were analyzed by SDS-PAGE and Western blot using a polyclonal antibody that detects COX-2 protein. The results shown are means ± SE, n = 3, and are expressed as percentage of the maximum level of COX-2 expression, which correlated with a 24.4-fold increase over control. Equal protein loading was verified using an antibody that detects α-SMA. C: confluent 18Co cells were washed and equilibrated in serum-free media for 30 min, incubated with 8 ng/ml TNF-α for 18 h, and then stimulated with LPA for 4 h at varying concentrations (0–30 μM). Lysates were then analyzed by SDS-PAGE and Western blot using a polyclonal antibody that detects COX-2 protein. The results shown are means ± SE, n = 3, and are expressed as percentage of the maximum level of COX-2 expression, which correlated with a 4.5-fold increase over control. Equal protein loading was verified using an antibody that detects ERK-2. *Statistical significance (P < 0.05).

The effect of LPA and TNF-α on the synergistic expression of COX-2 was dose dependent, as seen in Fig. 2, B and C. In Fig. 2B, 18Co cells were treated overnight with TNF-α at varying concentrations (0–80 ng/ml), followed by treatment with LPA (10 μM) for 4 h. Increases in COX-2 protein expression were evident at a TNF-α concentration as low as 0.8 ng/ml, well within physiological levels, and persisted at a concentration of 80 ng/ml. Based on this data, subsequent experiments were performed using TNF-α at a concentration of 8 ng/ml, well within the range of concentrations used in other studies (12, 26, 41, 61). In Fig. 2C, 18Co cells were treated overnight with TNF-α, followed by treatment with LPA for 4 h at varying concentrations (0–30 μM). Treatment with LPA for 4 h following an overnight incubation with TNF-α led to increases in COX-2 expression that were evident at a concentration of 1 μM LPA and increased in a dose-dependent manner over the range of concentrations studied.

LPA-mediated PKD activation is augmented by overnight treatment with TNF-α.

Previous work in our laboratory identified PKD as a central mediator of COX-2 expression in human colonic myofibroblasts (62), and LPA has been shown to induce PKD activation in several cell types (8, 9, 64). To evaluate a possible role of PKD in the synergistic expression of COX-2 in colonic myofibroblasts in response to LPA and TNF-α, we first tested whether LPA induces PKD activation in these cells. Confluent 18Co cells were treated with LPA for various times and lysed. Activation of PKD was assessed by Western blot analysis of the cell lysates using site-specific primary antibodies that detect the phosphorylated state of Ser⁷³⁸ located in the activation loop of human PKD (18, 54) and the auto-phosphorylated state of PKD on Ser⁹¹⁰ (63). Treatment of 18Co cells with LPA led to a rapid and transient activation of PKD, as judged by phosphorylation on Ser⁷³⁸ (data not shown) and Ser⁹¹⁰ (Fig. 3). Autophosphorylation at Ser⁹¹⁰ peaked at 15–30 min, with a steady decline over the 4-h time period studied.

Fig. 3.

LPA-induced protein kinase D (PKD) activation is augmented by prior cell treatment with TNF-α. A: 18Co cells were incubated in the presence or absence of TNF-α (8 ng/ml) for 18 h, followed by stimulation with LPA (10 μM) over various times (15, 30, 60, 120, 240 min, as indicated). The cells were analyzed by Western blotting using an antibody that detects the COOH-terminal autophosphorylation site of PKD (Ser⁹¹⁰ in human PKD). Band intensity was analyzed by densitometric scanning of three independent experiments and is depicted in graphical form on the bottom and on the right, presented as means ± SE, and expressed as a percentage of the maximum level of phosphorylated Ser⁹¹⁰, which correlated with a 5.6-fold increase over control. Equal protein loading was verified using an antibody that detects ERK-2. *Statistical significance (P < 0.05).

We next determined whether TNF-α enhanced the intensity and/or duration of LPA-mediated PKD activation in colonic myofibroblasts. Confluent 18Co cells were treated with TNF-α overnight, followed by treatment with LPA, and PKD activation was assessed by Western blot. In agreement with our laboratory's previous results (62), TNF-α alone did not induce any detectable increase in PKD phosphorylation in 18Co cells (data not shown). However, overnight pretreatment of 18Co cells with TNF-α enhanced LPA-mediated PKD activation at 15, 30, and 60 min (Fig. 3). These experiments demonstrate that TNF-α augments the intensity of LPA-mediated PKD activation in 18Co cells, while having no detectable effect on PKD activation in these cells when added alone.

PKD activation and synergistic COX-2 expression induced by LPA and TNF-α involves the LPA₁ receptor and G_iα.

The biological functions of LPA are mediated by a family of at least five different G protein-coupled receptors (GPCRs) (LPA_1–5) (10). LPA₁ was the first LPA receptor to be identified (28), and high mRNA levels are present in the colon and small intestine (27). The LPA₁ receptor is also the most widely expressed LPA receptor in the human colon (10), highlighting its potential importance in LPA-mediated signaling in this organ. To determine which LPA receptor was involved in LPA-mediated PKD activation and synergistic COX-2 expression in the human colonic myofibroblast cell line 18Co, we utilized the inhibitory properties of 3-[4-(4-{[1-(2-chlorophenyl)ethoxl]carbonyl amino}-3-methyl-5-isoxazolyl) benzylsunfanyl] propanoic acid (Ki16425), an LPA receptor antagonist (LPA₁ > LPA₃ >>> LPA₂), that is selective for LPA₁ at the lowest concentrations. Utilizing these properties, confluent 18Co cells were treated with TNF-α overnight, followed by incubation with Ki16425 for 1 h at varying concentrations (0–5 μM), followed by stimulation with LPA for 4 h. PKD activation and COX-2 expression were assessed by Western blot. As shown in Fig. 4A and consistent with previous results (Fig. 1A), overnight treatment with TNF-α alone led to low levels of COX-2 expression, an effect that was augmented by the addition of LPA for 4 h. However, exposure to Ki16425 inhibited LPA-mediated COX-2 expression, beginning at the lowest concentration used (0.25 μM), implicating LPA₁ as the main receptor involved in this response. The remaining low level of COX-2 expression following treatment with Ki16425 (0.25 μM) was equivalent to treatment with TNF-α alone, suggesting that Ki6425 had no effect on TNF-α-induced COX-2 expression. LPA-induced PKD activation was similarly inhibited to baseline levels, and this inhibition was maintained over the range of concentrations used. The profound inhibition by Ki6425 at the lowest concentrations used strongly suggested that LPA-mediated PKD activation and COX-2 expression involve signaling initiated through the LPA₁ receptor, and not by the LPA receptors LPA₂, LPA_3, LPA₄, and LPA₅. These results also supported the hypothesis that PKD could mediate the cross talk between LPA and TNF-α in the synergistic expression of COX-2.

Fig. 4.

PKD activation and synergistic COX-2 expression involves the LPA₁ receptor and G_iα. A: 18Co cells were incubated for 18 h with TNF-α (8 ng/ml), then were pretreated with the LPA receptor inhibitor Ki16425 at various concentrations (0, 0.25, 0.5, 1.0, 5.0 μM) for 1 h, followed by treatment with LPA (10 μM) for 4 h. The cell extracts were analyzed by SDS-PAGE and Western blot using an antibody that detects PKD (Ser⁹¹⁰) and a polyclonal antibody that detects COX-2 protein. Band intensity was analyzed by densitometric scanning of three independent experiments and is depicted in graphical form below, presented as means ± SE, and expressed as a percentage of the maximum level of COX-2 (which correlated with a 3.2-fold increase over control) and phosphorylated Ser⁹¹⁰ (which correlated with a 4.4-fold increase over control). Equal protein loading was verified using an antibody that detects ERK-2. B: 18Co cells were incubated overnight for 18 h with TNF-α (8 ng/ml), then were pretreated with the G_iα-specific inhibitor pertussis toxin (Ptx) at various concentrations (0, 1, 10, 50, 100 ng/ml, as indicated) for 2 h, followed by treatment with LPA (10 μM) for 4 h. The cells were lysed, and the extracts were analyzed by SDS-PAGE and Western blot using an antibody that detects the phosphorylated state of PKD (Ser⁹¹⁰), and a polyclonal antibody that detects COX-2 protein. Band intensity was analyzed by densitometric scanning of three independent experiments and is depicted in graphical form below, presented as means ± SE, and expressed as a percentage of the maximum level of COX-2 (which correlated with a 2-fold increase over control) and phosphorylated Ser⁹¹⁰ (which correlated with a 3.9-fold increase over control). Equal protein loading was verified using an antibody that detects ERK-2. C: 18Co cells were incubated overnight for 18 h with TNF-α (8 ng/ml), then were pretreated with the G_iα-specific inhibitor Ptx at various concentrations (0, 1, 10, 50, 100 ng/ml, as indicated) for 2 h, followed by treatment with bradykinin (BK; 50 nM) for 4 h. The cells were lysed, and the extracts were analyzed by SDS-PAGE and Western blot using an antibody that detects the phosphorylated state of PKD (Ser⁹¹⁰), and a polyclonal antibody that detects COX-2 protein. Band intensity was analyzed by densitometric scanning of three independent experiments and is depicted in graphical form, presented as means ± SE, and expressed as a percentage of the maximum level of COX-2 (which correlated with a 10.2-fold increase over control) and phosphorylated Ser⁹¹⁰ (which correlated with a 10.3-fold increase over control). Equal protein loading was verified using an antibody that detects α-SMA.

Following LPA binding to one of its cognate receptors (LPA_1–5), downstream signals are propagated via one of several G protein subunits (Gα_q/11, G_i/o, G_12/13). The LPA₁ receptor is capable of coupling with the G_iα, G_12/13, and Gα_q family of G proteins (10, 31). To determine which G protein subunit may be involved in the LPA-mediated activation of PKD and the expression of COX-2, we used the G_iα-specific inhibitor PTx. PTx is an A/B type toxin that, upon entry into a cell, catalyzes the ADP-ribosylation of the α-subunit of G proteins, locking G_iα in an inactive state on the cell surface. 18Co cells were treated overnight with TNF-α, followed by LPA for 4 h, with or without a 2-h pretreatment with PTx, at various concentrations (0–50 ng/ml). As shown in Fig. 4B, PTx inhibited both the activation of PKD and the synergistic increase in COX-2 expression following treatment with TNF-α and LPA in a dose-dependent fashion. These experiments demonstrate that LPA-mediated PKD activation and COX-2 expression signal predominantly through G_iα and further support the hypothesis that PKD may play a critical role in the synergistic expression of COX-2 in colonic myofibroblasts.

Previous work in our laboratory demonstrated that the proinflammatory mediator BK also induced PKD activation and synergistic COX-2 expression in response to TNF-α in 18Co cells (62). However, BK-induced PKD activation and COX-2 expression signals predominantly through Gα_q. To confirm the specificity of PTx on the inhibition of G_iα, and to distinguish the upstream signaling mechanisms initiated by BK and LPA, 18Co cells were treated overnight with TNF-α, followed by BK for 4 h, with or without a 2-h pretreatment with PTx, at various concentrations (0–50 ng/ml). In stark contrast to its effect on LPA, the G_iα-specific inhibitor PTx failed to inhibit BK-mediated COX-2 expression and BK-mediated PKD phosphorylation at all concentrations used (Fig. 4C). These data further supports the predominant role of G_iα, and not other G proteins, in LPA-mediated COX-2 expression and PKD activation.

LPA-mediated PKD activation and synergistic COX-2 expression involves PKC.

Isoforms of the PKC family are major downstream targets of LPA-mediated signaling in other cell systems (8). Furthermore, both the LPA₁ receptor and G_iα propagate signaling cascades that can result in the activation of phospholipase C and its downstream target PKC (10). Therefore, we sought to determine the role of PKC, and possibly its downstream target PKD, in the synergistic expression of COX-2 in response to LPA and TNF-α in colonic myofibroblasts. Cultures of 18Co cells were incubated overnight with TNF-α, then were pretreated for 60 min with the preferential PKC inhibitors GF109203X (also known as bisindolylmaleimide I) at 5 μM or Go6983 (2.5 μM), before stimulation with LPA for 4 h. Cell treatment with either Go6983 or GF109203X completely inhibited both the augmented activation of PKD and the synergistic expression of COX-2 induced by LPA and TNF-α (Fig. 5A). In a parallel fashion, Go6983 and GF109203X also blocked LPA and TNF-α-mediated PGE₂ production, as quantified by ELISA (Fig. 5B). These results suggest that PKC isoforms play an upstream role in both LPA-mediated PKD activation and in the synergistic enhancement of COX-2 expression and PGE₂ production mediated by TNF-α and LPA.

Fig. 5.

LPA-induced PKD activation and synergistic COX-2 expression requires PKC activity. A: cultures of 18Co cells were incubated for 18 h with TNF-α (8 ng/ml), then were pretreated for 1 h with the preferential PKC inhibitors GF109203X (GF1, 5 μM) or Go6983 (Go, 2.5 μM), followed by treatment with LPA (10 μM) for 4 h. Cells were lysed, and cell extracts were analyzed by SDS-PAGE and Western blot using anti-COX-2 antibody and an antibody that detects the phosphorylated state of PKD (Ser⁹¹⁰). Similar results were obtained in at least three independent experiments for each condition. The results shown are means ± SE and are expressed as percentage of the maximum level of COX-2 expression (which correlated with a 5.2-fold increase above control) and as a percentage of the maximum level of phosphorylated Ser⁹¹⁰ (which correlated with a 4.5-fold increase above control). Equal protein loading was verified using an antibody that detects ERK-2. *Statistical significance (P < 0.05). B: cultures of 18Co cells were incubated for 18 h with TNF-α (8 ng/ml), then were pretreated for 1 h with the PKC inhibitors GF1 (5 μM) or Go (2.5 μM), followed by treatment with LPA (10 μM) for 4 h. PGE₂ released into the supernatant was quantified by ELISA. *Statistical significance (P < 0.05). TL, TNF-α plus LPA.

Synergistic COX-2 expression induced by LPA and TNF-α involves PKD.

The stimulatory effects produced by TNF-α and LPA on COX-2 expression and PKD activation and the inhibitory effects on both responses by Ki16425, PTx, and the preferential PKC inhibitors GF109203X and Go6983 are all consistent with the hypothesis that PKD plays a critical role in mediating synergistic COX-2 expression in response to sequential cell exposure to TNF-α and LPA. To test this hypothesis directly, we determined whether siRNA-mediated knockdown of PKD protein in 18Co cells inhibits the synergistic expression of COX-2 in response to these proinflammatory mediators. After determining the optimal concentration of PKD siRNA (50 nM), conditions for transfection and incubation time (72 h) in 18Co cells, lysates of cells treated with targeting or nontargeting PKD siRNAs were analyzed by Western blotting to assess the level of PKD. As shown in Fig. 6A, siRNA targeting PKD produced a robust depletion of PKD protein in 18Co cells.

Fig. 6.

Synergistic COX-2 expression induced by LPA and TNF-α is mediated by PKD. A: 18Co cells were transfected with either nontargeting (NT) short interfering RNA (siRNA) or with PKD siRNA [targeting (T)] at 50 nM in the presence of 4 μl Mirus TKO-IT transfection agent for 72 h. The level of PKD protein was analyzed by Western blotting using the anti-PKD C-20 antibody. Antibody against ERK-2 was used to verify equal protein loading. Band intensity was analyzed by densitometric scanning and is presented as means ± SE, n = 3, and expressed as a percentage of the maximum level of PKD [which correlated with a 6.1-fold increase above control (Con)]. Equal protein loading was verified using an antibody that detects ERK-2. *Statistical significance (P < 0.05). B: 18Co cells were transfected with 50 nM siRNA T PKD or with a NT sequence also at 50 nM, as described in A, followed by incubation with TNF-α for 18 h and then stimulation with 10 μM LPA for 4 h. Cell lysates were analyzed by Western blotting using anti-COX-2 antibody. Antibody against ERK-2 was used to verify equal protein loading. Band intensity was analyzed by densitometric scanning and is presented as means ± SE, n = 3, and expressed as a percentage of the maximum level of COX-2 (which correlated with a 3-fold increase above Con). *Statistical significance (P < 0.05).

Having demonstrated that PKD protein can be strikingly depleted in 18Co cells via transfection with PKD siRNA, we next determined the role of PKD in mediating synergistic COX-2 expression in response to LPA and TNF-α. As shown in Fig. 6B, knockdown of PKD in 18Co cells completely prevented the synergistic increase in COX-2 protein induced by treatment with LPA and TNF-α. The results show that PKD plays a critical role in mediating synergistic expression of COX-2 protein induced by LPA and TNF-α in 18Co myofibroblasts.

DISCUSSION

Dynamic interactions that occur between the GI epithelium and its underlying stroma regulate important biological functions in both normal and pathological conditions. In the setting of chronic inflammation, a large body of evidence supports a critical role of the stromal microenvironment on the epithelial transformation to an invasive phenotype and the development of cancer. The mechanism(s) underlying colitis-associated cancer is initiated, in part, by the local production of proinflammatory mediators that are released by multiple cell populations, including myofibroblasts. Cellular responses to the inflammatory microenvironment lead to complex interactions between neighboring cells that induce epithelial genomic instability, leading to proliferative and antiapoptotic properties, tumor invasion, and metastasis (50).

Mounting evidence supports a causal association between LPA-mediated signaling and cancer progression (28), particularly in the context of colitis-associated cancer (23). The importance of LPA in the development and progression of cancer was supported by the discovery that autotaxin, an ectoenzyme known to promote tumor invasion and metastasis, acts by producing bioactive LPA extracellularly in the tumor microenvironment (27). LPA has been linked to ovarian, prostate, gastric, and colorectal cancer (10, 23, 44, 65), as well as to the production of COX-2 and PG secretion (23, 30) by stromal cells of the GI tract (59).

The present study identifies a possible mechanism for the association between LPA-mediated signaling, inflammation, and cancer development. We found synergistic effects between LPA and TNF-α, resulting in the amplification of COX-2 expression and PGE₂ production through a conserved PKD-dependent signaling mechanism that appears to predominantly involve the LPA₁ receptor and the G_iα protein subunit, leading to augmented COX-2 expression in human colonic myofibroblasts.

The biological activity of LPA is tightly controlled by its production and degradation, but is also regulated by cross-talk signaling between other proinflammatory mediators, such as TNF-α. Evidence for cross talk between TNF-α and GPCR-mediated signaling exists (6, 15, 19, 62). Our laboratory previously identified signaling interactions between TNF-α and the specific GPCR BK, which also led to augmented COX-2 expression in colonic myofibroblasts through a PKD-dependent process (62). However, BK-mediated signaling involved a completely different cell surface receptor (the BK B2 receptor) and downstream G protein target (Gα_q). Given the central role that TNF-α plays in GI enteropathies, such as Crohn's disease and ulcerative colitis, we speculate that a mechanism of action could involve cross talk between other inflammatory signaling pathways that lead to exaggerated signaling and an amplification of physiological responses. The present data confirm that TNF-α is capable of interacting with multiple proinflammatory GPCRs in human colonic myofibroblasts, despite the fact that they signal through unique cell surface membrane receptors and through alternative G protein families.

The synergistic expression of COX-2 by TNF-α and LPA appears to involve a signaling cascade initiated, in part, by the LPA₁ receptor and the G protein G_iα, which, in turn, activates phospholipase C, PKC, and PKD. This pathway implies that other molecules downstream of PKD may also be involved. In other cell types, including Swiss 3T3 fibroblasts, a prominent mechanism by which PKD mediates GPCR-induced signaling is by increasing the duration of MEK/ERK/90-kDa ribosomal S6 kinase activation (46), which is also one of the major pathways leading to COX-2 transcriptional activation (1, 45, 60). It is plausible that the ERKs play a role in relaying the downstream PKD signal. Also, despite the linear nature of the signaling cascade we have identified, we cannot rule out overlapping contributions by the different LPA receptors (LPA_1–5) and their downstream G protein targets: Gα_q/11, G_i/o, and G_12/13 (64). This is supported by the fact that the putative LPA₃-receptor-specific agonist (2S)-3-[(hydroxymercaptophosphinyl)oxy]-2-methoxypropyl ester, 9Z-octadecenoic acid, triethyl ammonium salt independently induced COX-2 expression following overnight treatment with TNF-α, though not through either PKD or G_iα (data not shown). These findings confirm the redundancy in function between the different LPA receptors but through completely different signaling pathways, potentially providing a mechanism to maintain homeostasis, despite the loss of an upstream receptor or signaling protein.

While the exact mechanism of interaction between TNF-α and these various GPCRs remains unclear, to date, the common thread appears to be the involvement of PKD. Despite the differences in the initiating signaling events, interactions with TNF-α still led to the synergistic expression of COX-2 through a conserved pattern of activation involving PKC and PKD. The present study supports the notion that PKD plays a critical role in the regulation of COX-2 in human colonic myofibroblasts. Given the current limitations (i.e., side effects) with existing COX-2 inhibitors in the clinical treatment of patients with colonic adenomas or a genetic predisposition for colorectal cancer, the present findings support a role for PKD as a novel, and potentially more effective, target for COX-2 inhibition and cancer prevention.

GRANTS

This work was supported by National Institutes of Health Grants R0-1DK55003, R0-1DK56930, R21CA137292, and P30-DK41301 (to E. Rozengurt), and 1KO8DK085136-01A1 (to J. Yoo).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).