Modulation of Canonical Transient Receptor Potential Channel 1 in the Proliferation of Oligodendrocyte Precursor Cells by the Golli Products of the Myelin Basic Protein Gene

Abstract

Golli proteins, products of the myelin basic protein gene, function as a new type of modulator of intracellular Ca²⁺ levels in oligodendrocyte progenitor cells (OPCs). Because of this, they affect a number of Ca²⁺-dependent functions, such as OPC migration and process extension. To examine further the Ca²⁺ channels regulated by golli, we studied the store-operated Ca²⁺ channels (SOCCs) in OPCs and acute brain slice preparations from golli knock-out and golli-overexpressing mice. Our results showed that pharmacologically induced Ca²⁺ release from intracellular stores evoked a significant extracellular Ca²⁺ entry after store depletion in OPCs. They also indicated that, under these pharmacological conditions, golli promoted activation of Ca²⁺ influx by SOCCs in cultured OPCs as well as in tissue slices. The canonical transient receptor potential family of Ca²⁺ channels (TRPCs) has been postulated to be SOCC subunits in oligodendrocytes. Using a small interfering RNA knockdown approach, we provided direct evidence that TRPC1 is involved in store-operated Ca²⁺ influx in OPCs and that it is modulated by golli. Furthermore, our data indicated that golli is probably associated with TRPC1 at OPC processes. Additionally, we found that TRPC1 expression is essential for the effects of golli on OPC proliferation. In summary, our data indicate a key role for golli proteins in the regulation of TRPC-mediated Ca²⁺ influx, a finding that has profound consequences for the regulation of multiple biological processes in OPCs. More important, we have shown that extracellular Ca²⁺ uptake through TRPC1 is an essential component in the mechanism of OPC proliferation.

Introduction

The myelin basic protein (MBP) gene encodes two families of proteins: the classic MBP components of the myelin membrane and a second set of products, the golli MBPs, whose function is only beginning to be understood (Campagnoni et al., 1993; Pribyl et al., 1993). Like the classic forms in the CNS, expression of golli proteins is developmentally regulated (Campagnoni et al., 1993; Landry et al., 1996). It tends to be high during embryonic development and declines with age (Landry et al., 1996, 1998). In the nervous system, golli proteins are expressed in oligodendrocytes (OLs) and in specific subsets of neurons, although golli protein expression has also been reported in activated microglia, macrophages, and adult OL progenitors (Filipovic et al., 2002).

Previous work has shown golli to be an important regulator of OL development and myelination. Golli regulates oligodendrocyte progenitor cell (OPC) process extension and differentiation in vitro (Paez et al., 2009a,b), and studies of golli knock-out (KO) and golli-overexpressing (JOE) brains indicate this influence on OPC development has important consequences for myelination in vivo (Jacobs et al., 2005, 2009). The golli KO animals exhibit widespread hypomyelination, with particularly striking myelin deficits in the visual and somatosensory cortices and the optic nerve. This hypomyelination has clear functional effects because these animals exhibit alterations in visual evoked potentials (Jacobs et al., 2005). JOE animals express multiple copies of the J37 golli isoform under the control of the classic MBP promoter. These animals present severe intention tremors between approximately postnatal day 15 (P15) and P50 and exhibit generalized hypomyelination in the brain (Martin et al., 2007; Jacobs et al., 2009). At later ages, the tremors abate and increased myelination is observed.

The cellular and molecular mechanisms governing the altered development of golli KO and JOE OPCs have been partially elucidated. Recent findings have clearly established that golli protein plays a critical role in regulating Ca²⁺ influx in OPCs (Paez et al., 2007, 2009a,b; Fulton et al., 2010).

Calcium influx can occur via a number of different mechanisms within the cell including the following: (1) ligand-operated Ca²⁺ channels (Simpson et al., 1997; Butt, 2006), (2) voltage-gated Ca²⁺ channels (Paez et al., 2007), and (3) by the opening of store-operated Ca²⁺ channels (SOCCs) in the membrane in response to Ca²⁺ depletion in the endoplasmic reticulum (ER) (Belachew et al., 2000; Alberdi et al., 2005). There are a number of Ca²⁺-selective store-operated currents found in different cells (Parekh and Putney, 2005), indicating that multiple types of SOCCs probably exist. The transient receptor potential (TRP) superfamily consists of six subfamilies, including the TRPC subfamily (the “canonical” TRPs). TRPCs have been postulated to be SOCC subunits and are a heterogeneous family of Ca²⁺ channels (Zitt et al., 2002; Smyth et al., 2006; Liao et al., 2007). Expression of TRPCs has been described in nervous tissue (Putney, 1999; Riccio et al., 2002), but most store-operated cation conductances have been demonstrated in excitable cells (Putney, 1993). Up to now, a role for TRPC channels in OLs has not been defined.

The goal of this study was to define the Ca²⁺ channels through which golli modulates Ca²⁺ homeostasis in OPCs and thereby modulates essential OPC functions, such as proliferation. In all the experiments, pharmacological tools and imaging techniques were used to compare the physiology of OPCs in genotype control mice to golli KO and golli-overexpressing (JOE) mice, both in vitro (cultured OPCs) and in situ (slice preparation). We show that changes in golli expression alter the activity of TRPC channels in OPCs, a finding that has profound consequences on multiple aspects of OPC maturation and survival.

Materials and Methods

Transgenic mice

Golli KO mouse.

We previously generated a golli KO mouse in which the golli products of the MBP gene were selectively ablated while permitting normal expression of the classic MBPs (Jacobs et al., 2005). Through non-brother–sister crosses, a line was generated that is homozygous for the golli ablation on a background that is 50% 129S7/SvEvBrd and 50% C57BL6/J. A control line (KO Control) was established that was also 50% 129S7/SvEvBrd and 50% C57BL6/J but was negative for the golli ablation. The golli KO phenotype was observed before keeping the lines separate and then was studied over at least eight generations and remained stable.

JOE mouse.

We generated a transgenic mouse that overexpresses the golli isoform J37 in oligodendrocytes under the control of a classic MBP promoter (Martin et al., 2007; Jacobs et al., 2009). In this transgenic mouse, the J37 golli isoform is driven by a 1.9 kb region of the classic MBP promoter, thus directing overexpression of the protein specifically to OLs in the CNS. These mice are called JOE mice for golli “J37 overexpressing.” A line was generated that is heterozygous for the MBP 1.9-J37 transgene on a background that is 50% BALB/cByJ, 37–50% C57BL/6, and 0–12% C3H/He. A control line (JOE Control) was established that was also 50% BALB/cByJ, 37–50% C57BL/6, and 0–12% C3H/He.

Primary cultures of cortical oligodendrocytes

Enriched oligodendrocytes were prepared as described by Amur-Umarjee et al. (1993). First, cerebral hemispheres from 1-d-old mice were mechanically dissociated and were plated on poly-d-lysine-coated flasks in DMEM and Ham's F-12 (1:1 v/v) (Invitrogen), containing 100 μg/ml gentamycin and supplemented with 4 mg/ml dextrose anhydrous, 3.75 mg/ml HEPES buffer, 2.4 mg/ml sodium bicarbonate, and 10% fetal bovine serum (FBS) (Omega Scientific). After 24 h, the medium was changed and the cells were grown in DMEM/F-12 supplemented with insulin (5 μg/ml), transferrin (50 μg/ml), sodium selenite (30 nm), T₃ (15 nm), d-biotin (10 mm), hydrocortisone (10 nm), 0.1% BSA (Sigma), 1% horse serum, and 1% FBS (Omega Scientific). After 9 d, OPCs were purified from the mixed glial culture by the differential shaking and adhesion procedure by Suzumura et al. (1984) and allowed to grow on polylysine-coated coverslips in defined culture media (Agresti et al., 1996) plus PDGF (10 ng/ml) and basic fibroblast growth factor (bFGF) (10 ng/ml) (Peprotech).

Immunocytochemistry

Cells were stained with antibodies against golli, TRPC1, and phospho-Histone H3 (Ser10) and examined by confocal microscopy. For golli and phospho-Histone H3 (Ser10) immunostaining, the cells were rinsed briefly in PBS and fixed in 4% buffered paraformaldehyde for 30 min at room temperature. After rinsing in PBS, the cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min at room temperature and then processed for immunocytochemistry following the protocol as outlined by Reyes et al. (2002). Essentially, fixed cells were incubated in a blocking solution (5% goat serum in PBS) followed by an overnight incubation at 4°C with a polyclonal antibody for golli (1:500) and phospho-Histone H3 (Ser10) (1:100; Millipore). Staining with TRPC1 (1:100; Alomone Labs) was performed on live cells without permeabilization for 1 h at room temperature before fixation. Cells were then incubated with the appropriate secondary antibodies (1:200; Jackson ImmunoResearch) and mounted onto slides with Aquamount (Lerner Laboratories), and fluorescent images were obtained using a Olympus spinning disc confocal microscope. Nuclei were stained with the fluorescent dye Hoechst 33342 (5 μg/ml in 1% DMSO), to determine the total number of cells. Quantitative analysis of the results was done counting the antigen-positive and Hoechst-positive cells in 20 randomly selected fields, which resulted in counts of >2000 cells for each experimental condition. Counts of antigen-positive cells were normalized to the counts of total Hoechst-positive cells for each condition.

Western blot analysis

Petri dishes containing ∼1.5 × 10⁶ cells per dish, under the different experimental conditions, were washed twice with PBS. The cells were collected by centrifugation (600 × g for 10 min at 4°C) and extracted with 20 mm Tris-HCl, pH 7.4, 150 mm NaCl, 10 mm EDTA, and 0.5% Triton X-100 for 1 h at 4°C. The insoluble material was cleared out by centrifugation (100,000 × g for 20 min at 4°C), and the resulting protein extracts (50 μg/lane) were subjected to SDS-PAGE (12.5% gels). After transfer, samples were analyzed by Western blot using an specific antibody for TRPC1 (1:500; Alomone Labs). Antibody binding was visualized with horseradish peroxidase-conjugated secondary antibody (used at a 1:1000 dilution) and the ECL Plus substrate kit (GE Healthcare).

Reverse transcription-PCR

Total RNA was isolated from 35 mm cell culture dishes containing ∼1.5 × 10⁶ cells per dish, using TRIZOL reagent (Invitrogen) according to the instructions of the manufacturer. RNA content was estimated by measuring the absorbance at 260 nm, and the purity was assessed by measuring A₂₆₀/A₂₈₀ ratios. PCR primers for TRPC1–TRPC6 were designed based on published sequences by Wang et al. (2004) with some modifications (Table 1). First-strand cDNA was prepared from 1 μg of total RNA using SuperScript III RNase H-reverse transcriptase (Invitrogen) and 1 μg of oligo-dT. The mRNA samples were denaturated at 65°C for 5 min. Reverse transcription (RT) was performed at 50°C for 55 min and was stopped by heating samples at 85°C for 5 min. The cDNA was amplified by PCR using the TRPC isoform-specific primers listed in Table 1 and PCR Platinum Supermix reagent (Invitrogen). PCR conditions were as follows: 94°C for 2 min, 40 cycles of 94°C for 30 s, 58°C for 30 s, followed by 68°C for 2 min. After completion of the 40 cycles, samples were incubated at 72°C for 10 min. A β-tubulin-positive control was performed alongside the experimental samples, as well as a negative control with no reverse transcriptase. The PCR products were visualized on an ethidium bromide-stained agarose gel, and the bands were digitized using a UVP BioImaging Analysis System with VisionWorksLS 5.5 software.

Table 1.

Sequences of primers and PCR product sizes used in the semiquantitative RT-PCR

Gene	Primer	Sequence	Size (bp)
	Sense	5′-CAAGATTTTGGGAAATTTCTGG-3′	372
TRPC1	Antisense	5′-TTTATCCTCATGATTTGCTAT-3′
	Sense	5′-CAGCTTCACCCGACTGGCATAT-3′	487
TRPC2	Antisense	5′-CTTTGGGGATGGCAGGATGTTA-3′
	Sense	5′-TGACTTCTGTTGTCCTCAAATATG-3′	311
TRPC3	Antisense	5′-CAGTCTTCTCCTCCTGCATTT-3′
	Sense	5′-TCTGCAGATATCTCTGGGAAGGATGC-3′	415
TRPC4	Antisense	5′-AAGCTTTGTTCGAGCAAATTTCCATTC-3′
	Sense	5′-ATCAGAACCGTGCCAAGAGCTA-3′	449
TRPC5	Antisense	5′-CCCCATTTGTGCATGAGCAAGT-3′
	Sense	5′-TTCATCATGGTGTTTGTAGCCTTT-3′	300
TRPC6	Antisense	5′-CACGTCCGCATCATCCTCAATTTC-3′

Small interfering RNA knockdown of TRPC1

OPCs were isolated and cultured in defined culture media (Agresti et al., 1996) plus PDGF (10 ng/ml) and bFGF (10 ng/ml). Twenty four hours after plating, the cells were transiently transfected with a combination of three different Stealth RNAi small interfering RNA (siRNA) duplexes (Invitrogen) specific for TRPC1 (for siRNA duplex sequences, see Table 2). Briefly, 6 pmol of each siRNA duplex were mixed with Lipofectamine RNAiMAX (Invitrogen), and the mixture was placed on 35 mm Petri dishes containing 80% confluent OPCs. OPCs were then further cultured for 48 h in defined culture media (Agresti et al., 1996) plus PDGF (10 ng/ml) and bFGF (10 ng/ml) before used for mRNA and protein determinations and Ca²⁺ imaging experiments. Control cells were exposed to Lipofectamine RNAiMAX alone using the same protocol.

Table 2.

Sequences of Stealth RNAi siRNA duplexes used for TRPC1 knockdown

	siRNA duplex oligoribonucleotide sequence
siRNA1	UUAACAUUAUCAGAGCUGGACUGGC
	GCCAGUCCAGCUCUGAUAAUGUUAA
siRNA2	AAGAGUCGAAGGUAACUCAGAACGU
	ACGUUCUGAGUUACCUUCGACUCUU
siRNA3	AUGAUUUGCUAUCAGCUGGAAGCUC
	GAGCUUCCAGCUGAUAGCAAAUCAU

Incorporation of bromodeoxyuridine

Twenty four hour pulses of 10 μm bromodeoxyuridine (BrdU) (BD Biosciences Pharmingen) were performed under different experimental conditions. After each BrdU pulse, cells were fixed in 4% paraformaldehyde and immunostained to determine the number of positive cells. After treatment with 6N HCl and 1% Triton X-100 to denature nuclear DNA, the cells were incubated in 0.1 m sodium borate (in PBS and 1% Triton X-100) for 10 min. Immunocytochemistry was done using an anti-BrdU antibody (1:1000; BD Biosciences Pharmingen) and an anti-NG2 (1:100; Millipore Bioscience Research Reagents) with the corresponding fluorescent secondary antibodies. The percentage of BrdU-positive (BrdU⁺) cells was estimated on the basis of the total number of NG2⁺ cells.

Cell cycle time analysis

To examine cell cycle time (Tc), mixed glial culture of green fluorescent protein (GFP)-labeled OPCs were used. These experiments were performed using a double-transgenic mouse created by breeding the JOE mouse with a line expressing GFP under control of the proteolipid protein (PLP) promoter (Mallon et al., 2002). Mixed glial cultures were prepared as described above (see Primary cultures of cortical oligodendrocytes). These cultures were incubated in a stage top chamber with 5% CO₂ at 37°C, which was placed on the stage of a spinning disc confocal inverted microscope equipped with a motorized stage, an atmosphere regulator, and shutter control. Fluorescent field images were obtained with a specific GFP filter at 6 min intervals. Individual clones of OPC–GFP were followed for a period of 48 h beginning at 4 and 6 d in vitro (DIV) before the shake off. In these time-lapse experiments, ∼30 clones were analyzed per experimental condition.

SlideBook 4.1 (Intelligent Imaging Innovations) was used in the analysis of video microscopic image sequences. The SlideBook software allow an investigator to cycle back-and-forth through the movie files frame by frame (minute by minute), facilitating the accurate determination of event time. To quantitatively analyze the dynamics of cell division, 120 cytokinetic events were randomly selected from movies at 4 and 6 DIV. Cell proliferation was assessed by calculating the average Tc (time between birth cytokinesis and division cytokinesis) in different OPC–GFP clones. Tracking of cells was performed by visual observation of image sequences as described above. In some cases, the cells were semiautomatically followed in SlideBook by attaching a number to the cell, which was propagated from frame to frame. Tracking was performed forward and backward in time from each identified cytokinesis events to maximize the number of lineally related cytokineses identified.

Slice preparation

Calcium imaging acquisitions of GFP-labeled OPCs were performed on living slices cut in coronal orientation at P4, as described previously (Kakita and Goldman, 1999). Briefly, mice were anesthetized with isoflurane, after which brains were rapidly removed and stored in ice-cold bicarbonate-buffered solution gassed with 95% O₂ and 5% CO₂ (Fulton et al., 2010). Coronal and sagittal slices were cut at 300 μm thickness on a vibratome. Brain tissue was kept in ice-cold bicarbonate solution during these procedures. The slices were then cultured with Eagle's Basal Medium with Earle's salts (Invitrogen) supplemented with 18.6 mm NaHCO₃, 1% BSA (fraction 5; Sigma), 5 μg/ml insulin, 5 μg/ml transferrin, 5 μg/ml sodium selenite (Sigma), 20 U/ml penicillin–streptomycin (Invitrogen), 2 mm l-glutamine (Invitrogen), and 27 mm glucose. After this, brain slices were ready for calcium imaging studies.

Calcium imaging

Methods were similar to those described previously (Colwell, 2000; Michel et al., 2002; Paz Soldan et al., 2003). Briefly, a cooled CCD camera (Hamamatsu ORCA-ER) was added to the Olympus spinning disc confocal microscope to measure fluorescence. To load the dye into cells, primary cultures of oligodendrocytes and brain slices were washed in serum and phenol red-free DMEM and incubated for 45 min at 37°C, 5% CO₂ in the same media containing a final concentration of 4 μm fura-2 AM (TefLabs) plus 0.08% Pluronic F-127 (Invitrogen), then washed four times in DMEM, and stored in DMEM for 0–1 h before being imaged (Paz Soldan et al., 2003). Resting calcium levels were made in serum-free HBSS containing 2 mm Ca²⁺ but no Mg²⁺. Other measurements were made in HBSS. Calcium influx and resting Ca²⁺ levels were measured on individual cells, and the results were pooled from five separate cells preparations for each condition. The fluorescence of fura-2 was excited alternatively at wavelengths of 340 and 380 nm by means of a high-speed wavelength-switching device (Lambda DG-4; Sutter Instruments). Image analysis software (SlideBook 4.1; Intelligent Imaging Innovations) allowed the selection of several “regions of interest” within the field from which measurements are taken. To minimize bleaching, the intensity of excitation light and sampling frequency was kept as low as possible. In these experiments, measurements were normally made once every 2 s.

Calibration of Ca²⁺ signals

Free [Ca²⁺] was estimated from the ratio (R) of fluorescence at 340 and 380 nm, using the following equation: [Ca²⁺] = K_d × slope factor × (R − R_min)/(R_max − R) (Grynkiewicz et al., 1985). The K_d was assumed to be 140 nm, whereas values for R_min and R_max were all determined via calibration methods. An in vitro method (fura-2 Ca²⁺ imaging calibration kit; Invitrogen) was used to make estimate values. With this method, glass coverslips were filled with a high-Ca²⁺ (fura-2 plus 10 mm Ca²⁺), a low-Ca²⁺ (fura-2 plus 10 mm EGTA), and a control solution without fura-2. Each solution also contains a dilute suspension of 15 μm polystyrene microspheres to ensure uniform coverslip/slide separation and facilitate microscope focusing. The fluorescence (F) at 380 nm excitation of the low Ca²⁺ solution was imaged, and the exposure of the camera was adjusted to maximize the signal. These camera settings were then fixed, and measurements were made with 380 and 340 nm excitation of the three solutions: R_min = F_340nm in low Ca²⁺/F_380nm in low Ca²⁺; R_max = F_340nm in high Ca²⁺/F_380nm in high Ca²⁺; and Sf = F_380nm in low Ca²⁺/F_380nm in high Ca²⁺.

Correlation analysis

Enriched oligodendrocytes were prepared as described by Amur-Umarjee et al. (1993). Cells plated onto poly-_d-lysine-coated 12 mm glass coverslips were transfected using the Lipofectamine 2000 (Invitrogen). Briefly, 1 μg of plasmid DNA (full-length golli-J37 clone in pEGFP–N3) (Reyes and Campagnoni, 2002) was used to transfect 4 × 10⁴ cells per coverslip. While the DNA was complexing, the cells were washed for 5 min with serum free media. The complexed DNA mixture was then applied to the coverslips and incubated at 37°C, 5% CO₂ for 6 h. The samples were washed with media supplemented with 10% FBS and subsequently incubated in defined culture media (Agresti et al., 1996) plus PDGF (10 ng/ml) and bFGF (10 ng/ml) for 2 d before use. Correlation studies of golli–GFP with Ca²⁺ influx kinetics were done by confocal microscopy using an Olympus spinning disc confocal equipment. Time-lapse digital images were analyzed using the Pearson's correlation coefficient (Rr) facility, which is provided by Image analysis software (SlideBook 4.1; Intelligent Imaging Innovations). Rr is a well-defined and commonly accepted means for describing the extent of correlation between image pairs. It is a value ranging between −1.0 and 1.0; a −1.0 value signifies no correlation, whereas a value of 1.0 signifies perfect correlation (Manders et al., 1993).

Statistical analysis

Data are presented as mean ± SEM unless otherwise noted. For fura-2 and cell cycle time experiments, statistical comparison between different experimental groups was performed by analysis of covariance. Measurements of the percentage of positive cells (phospho-Histone H3 and BrdU) were performed using Student's paired t test, in which p < 0.05 was defined as statistically significant.

Results

Golli enhances store-operated Ca²⁺ uptake in OPCs

We have found that the golli proteins function as new and novel modulators of intracellular Ca²⁺ levels in OPCs, T-cells, and probably neurons (Feng et al., 2006; Paez et al., 2007, 2009a,b). To characterize further the Ca²⁺ channels regulated by golli, we examined the contribution of store-operated Ca²⁺ entry in OPCs cultured from golli KO and JOE mice. Primary cultures of OPCs were first loaded with a membrane-permeable form of the Ca²⁺ indicator dye fura-2, before treatment with several agonists to activate different mechanisms that generate Ca²⁺ signaling in OPCs. Initially we sought to examine the effect of golli proteins on Ca²⁺ efflux from intracellular stores. Ca²⁺ responses to caffeine and thapsigargin (Tg) were studied in golli KO and JOE OPCs. Caffeine (2 mm) and thapsigargin (100 nm) both elicited a large and persistent increase in intracellular Ca²⁺ in the presence of normal extracellular Ca²⁺ (2 mm) (Fig. 1A). This response was significantly higher in JOE OPCs and lower in golli KO cells. The effect of extracellular Ca²⁺ on caffeine and thapsigargin responses was examined in parallel cultures by perfusion with caffeine or thapsigargin in Ca²⁺-free medium. This evoked a slow-onset transient elevation of intracellular Ca²⁺ in all the OPC genotypes. This response was typically small in amplitude, and, under this experimental condition, we did not find any appreciable difference between golli KO and JOE OPCs compared with genotype control cells (Fig. 1A). Subtraction of responses in Ca²⁺-free medium from those in normal extracellular Ca²⁺ revealed a slow-onset extracellular Ca²⁺-dependent response to caffeine and thapsigargin, which began after most of the store depletion (Ca²⁺ response in Ca²⁺-free medium) had occurred. The usual explanation for this phenomenon is activation of Ca²⁺ entry across SOCCs in the plasma membrane, subsequent to store depletion (Putney, 1993; Simpson et al., 1997). To examine the contribution of SOCC entry, fura-2-loaded OPCs were first pretreated with thapsigargin in the presence of zero Ca²⁺ to deplete intracellular stores and then reexposed to a Ca²⁺-containing medium to trigger Ca²⁺ influx via SOCCs. Reexposure to Ca²⁺-containing medium triggered a significantly larger increase in the fura-2 signal in JOE cells compared with responses in genotype controls (Fig. 1B). Interestingly, opposite effects were observed in golli-deficient OPCs (Fig. 1B). Additional pharmacological experiments in JOE cells treated with thapsigargin in zero Ca²⁺ medium demonstrated that the increased Ca²⁺ response was insensitive to Cd²⁺ and verapamil (Fig. 2D) and was abolished in the presence of the SOCCs inhibitors La²⁺ and 2-APB (Fig. 2B,D), confirming that this Ca²⁺ influx is not carried by voltage-operated Ca²⁺ channels (VOCCs), and more likely reflects influx via SOCCs. Similar results were found using MRS-1845, a specific blocker of store-operated Ca²⁺ entry that does not activate intracellular Ca²⁺ release (Fig. 2C,D).

Figure 1.

SOCC activity was examined in JOE and golli KO OPCs. A, Application of either caffeine (Caff) (2 mm) or Tg (100 μm) to JOE and golli KO OPCs elicited robust increases in the fura-2 ratio that were dependent on the presence of external Ca²⁺. The graphs shows the average amplitude calculated from the responding cells, expressed as percentage of change of the emission intensities. Values are expressed as mean ± SEM of at least four independent experiments (n > 400 cells for each condition). *p < 0.05, **p < 0.01 versus respective control. B, Fura-2-loaded JOE and golli KO OPCs were first pretreated with Tg in the presence of zero Ca²⁺ medium and then reexposed to a 2 mm Ca²⁺-containing medium to trigger Ca²⁺ influx via SOCC. Fura-2 ratios in selected cells are plotted with respect to the time of stimulation. The times of addition of Tg- and Ca²⁺-containing external solutions are indicated by the horizontal bars.

Figure 2.

A, SOCC activity was examined in JOE OPCs pretreated with Tg in the presence of zero Ca²⁺ medium. B, The increased Ca²⁺ response in JOE cells, after reexposure to 2 mm Ca²⁺-containing medium, was totally abolished in 25 μm 2-APB. C, Similar results were found using 10 μm MRS-1845, a specific blocker of store-operated Ca²⁺ entry. Note that each trace corresponds to a single OPC. The times of addition of Tg-, 2-APB-, MRS-1845-, and Ca²⁺-containing external solutions are indicated by the horizontal bars. D, The increased Ca²⁺ response in JOE cells was insensitive to treatment with 10 μm Cd²⁺ or 25 μm verapamil and was abolished in 1 μm La²⁺, 25 μm 2-APB, and 10 μm MRS-1845. The graphs show the average amplitude calculated from the responding cells, expressed as percentage of change of the emission intensities. Values are expressed as mean ± SEM of at least four independent experiments (n > 400 cells for each condition). **p < 0.01 versus respective controls.

Together, these data indicate an important role for golli proteins in the regulation of SOCC-mediated Ca²⁺ influx. As a whole, these results suggest that Ca²⁺ release from ER stores might not be affected by golli but rather that golli regulates Ca²⁺ influx after store depletion, probably mediated by SOCCs.

In situ imaging studies reveal store-activated Ca²⁺ currents in OPCs

We performed in situ experiments using live tissue sections to examine Ca²⁺ influx in GFP-labeled OPCs in golli KO and JOE mice. These experiments were performed using double-transgenic mice created by breeding the golli KO and JOE mice with a line expressing GFP under control of the PLP promoter (Mallon et al., 2002). In these mice, GFP expression provides a convenient marker for cells in the oligodendroglial lineage, thus facilitating experiments aimed at imaging OPCs in live tissue slices. Initially, we focused our in situ measurements of OPC in slice preparations containing the lateral ventricle subventricular zone (SVZ) because this region has been well studied as a source of OPCs. Our goal in these experiments was to confirm the in vitro data in live preparations with respect to SOCC activity in OPCs lacking golli or overexpressing golli. Recordings were made at P4. To examine in situ SOCC Ca²⁺ entry, fura-2-loaded tissue slices were first pretreated with thapsigargin (Tg) in the presence of zero Ca²⁺ to deplete intracellular stores and then reexposed to a Ca²⁺-containing medium to trigger Ca²⁺ influx via SOCCs. Reexposure to Ca²⁺-containing medium triggered a significantly larger increase in the [Ca²⁺]int in JOE SVZ cells compared with control OPCs (Fig. 3A–C). Furthermore, pharmacological experiments demonstrated that the increased Ca²⁺ response seen in JOE cells was abolished in the presence of 2-APB and MRS-1845, specific SOCCs blockers (Fig. 3D). As expected, golli KO cells exhibited Ca²⁺ signaling after stimulation with thapsigargin in the presence of zero Ca²⁺, but these Ca²⁺ signals were significantly weaker than that of the control cells (Fig. 3E). Additional experiments were made at P7, P14, and P21, allowing analysis of the developmental regulation of store-operated Ca²⁺ influx in OPCs. In agreement with our previous findings, Ca²⁺ uptake after store depletion was significantly greater in golli-overexpressing cells located in the SVZ at all time points tested (Fig. 3F). However, no significant differences between JOE and control cells were found in the corpus callosum of 21-d-old mice (Fig. 3F), suggesting that golli modulation of SOCCs may play a role during the early stages of OPC maturation. Together, and in agreement with our previous data from cultured OPCs, these in situ results uncover a key role for golli protein in the regulation of SOCC-mediated Ca²⁺ influx in SVZ and CC OPCs.

Figure 3.

Brain slices were incubated in a chamber with 5% CO₂ at 37°C, which was placed on the stage of a spinning disc confocal inverted microscope. Fura-2 images were obtained for brain slices with specific filters at 5 s intervals for a total of 20 min. A, Time-lapse series of P4 GFP-expressing OPCs in the dorsolateral SVZ. Each frame represents a single section of a fura-2 time-lapse experiment. An increased fura-2 fluorescence ratio is indicated by warmer colors. Time is denoted in minutes in the top right corner, and the area of the dorsolateral SVZ is indicated in the inset. LV, Lateral ventricle. Scale bar, 200 μm. Yellow arrowheads in high-magnification insets show OPCs that were selected for the analysis. Scale bar, 60 μm. B, C, SOCC activity was examined in P4 GFP-expressing OPCs from JOE control and JOE mice pretreated with Tg in the presence of zero Ca²⁺ medium. Note that each trace corresponds to a single cell, and times of Tg and Ca²⁺ addition are indicated by the horizontal bars. D, E, The Ca²⁺ response in SVZ JOE and golli KO cells after reexposure to Ca²⁺-containing medium was totally abolished in 25 μm 2-APB and 10 μm MRS-1845. F, SOCC activity was examined in GFP-expressing OPCs from the SVZ and corpus callosum (CC) of control and JOE mice at P7, P14, and P21. The graphs show the average amplitude calculated from the responding cells expressed as percentage of change of the emission intensities. Values are expressed as mean ± SEM of at least four independent experiments (n > 200 cells for each condition). **p < 0.01 versus respective controls.

Blockage of TRPC1 reduces store-operated Ca²⁺ entry in OPCs

Oligodendrocytes express TRPC channels that have been implicated in mediating store-operated Ca²⁺ entry (Fusco et al., 2004; Weerth et al., 2007). Using an antibody against TRPC1, we were able to block the function of TRPC1 channels and demonstrate their involvement in golli-evoked Ca²⁺ entry in cultured OPCs. We used an antibody against TRPC1 that was designed to bind to amino acid residues 557–571 in the proposed pore-forming region of human/mouse TRPC1 and block the functioning of the channel (Wang et al., 1999). This antibody has been used to block TRPC1 current (Kim et al., 2003) and TRPC1-mediated Ca²⁺ influx (Xu and Beech, 2001; Antoniotti et al., 2002). Therefore, this antibody can specifically block the function of TRPC1-containing channels and determine the extent of their involvement in SOC entry. Cultured OPCs were pretreated with thapsigargin in the presence of zero Ca²⁺ to deplete intracellular stores, but in this case cells were preincubated with TRPC1 antibody (10 μg/ml for 1 h) before Ca²⁺ readdition to allow the antibody sufficient time to bind and block the channels. Preincubation with the antibody caused a significant decrease in the measured amount of store-operated Ca²⁺ entry compared with JOE cells that were not incubated with TRPC1 antibody (Fig. 4A,B). This decrease in Ca²⁺ entry was of a similar proportion to that seen using SOCC blockers (2-APB and MRS-1845), indicating that TRPC1 is involved in mediating store-operated Ca²⁺ uptake in golli-overexpressing OPCs. It also represents the first time this channel has been shown to be functional in OPCs. Furthermore, the effect of anti-TRPC1 was abolished by preincubation of the antibody with the antigen peptide (+Pept), underlying the specificity of the primary antibody (Fig. 4C,D).

Figure 4.

A, SOCC activity was examined in JOE OPCs pretreated with Tg in the presence of zero Ca²⁺ medium (Basal). B, JOE OPCs were incubated with an antibody against TRPC1 (10 μg/ml; 1 h) before depleting their internal Ca²⁺ stores with Tg in zero Ca²⁺ solution (TRPC1 Ab). Compared with JOE cells in basal conditions (A), these OPCs have a significant decrease in internal Ca²⁺ elevations when 2 mm Ca²⁺ is returned to the external solution. C, The effect of anti-TRPC1 was totally abolished by preincubation of the antibody with the antigen peptide (+Pept). The times of addition of Tg- and Ca²⁺-containing external solutions are indicated by the horizontal bars. D, The graphs show the average amplitude calculated from the responding cells, expressed as percentage of change of the emission intensities for each experimental condition. Values are expressed as mean ± SEM of at least four independent experiments (n > 400 cells for each condition). **p < 0.01 versus respective controls.

To determine which TRPC homologs are expressed in OPCs, semiquantitative RT-PCR reactions were run using primers specific for individual TRPC homologs (Table 1). As shown in Figure 5A, OPCs express mRNA for TRPC1, TRPC2, TRPC3, TRPC4, TRPC5, and TRPC6. Importantly, no significant differences in TRPC expression were observed between control and golli-overexpressing OPCs (Fig. 5A). To confirm the role of TRPC1 in mediating SOC uptake in golli-overexpressing OPCs, we used an siRNA approach to selectively suppress mRNA levels for TRPC1. Twenty four hours after plating, OPCs were transiently transfected with a combination of three different siRNA duplexes specific for TRPC1 (Table 2). Two days later, the mRNA levels were monitored using semiquantitative RT-PCR methods. The data in Figure 5B illustrate the selective suppression of TRPC1 mRNA by expression of siRNA specific for that TRPC homolog. Thus, levels of TRPC1 mRNA could be selectively suppressed by ∼90%. Western blots were performed to confirm that TRPC1 protein levels were also suppressed by siRNA expression. The Western blots in Figure 5C illustrate that the specific reduction in mRNA for TRPC1 is accompanied by a reduction of ∼95% in TRPC1 protein levels (Fig. 5C). The effect of suppression of TRPC1 homolog on the level of SOC influx was then determined by monitoring thapsigargin stimulation of Ca²⁺ entry in JOE cells at 4 and 5 DIV. The suppression of TRPC1 protein levels produced an ∼80% inhibition of thapsigargin-stimulated Ca²⁺ influx at both 4 and 5 DIV (Fig. 6), indicating that TRPC1 is heavily involved in mediating SOC entry in golli-overexpressing OPCs.

Figure 5.

A, RT-PCR analysis of TRPC mRNA. Equal amounts of cDNA, prepared from total RNA of control and JOE OPCs, were added for each reaction. TRPC isoform-specific PCR primers (Table 1) and the semiquantitative RT-PCR conditions used for these experiments are described in Materials and Methods. β-Tubulin was used as internal standard, and data are representative of three independent experiments. B, Pure OPCs from control and JOE mice were transiently transfected with a combination of three different siRNA duplexes specific for TRPC1 (siTRPC1) and grown for 2 d in defined culture media. Semiquantitative RT-PCR analysis of TRPC1 mRNA expression in OPCs was performed using β-tubulin as internal standard. Data from three independent experiments are summarized based on the relative spot intensities and plotted as percentage of controls. C, OPCs were grown under conditions described above. For each lane, 50 μg of total protein extract was applied, and Western blots were performed as described in Materials and Methods. A representative Western blot for TRPC1 is shown, and data from three independent experiments are summarized based on the relative spot intensities and plotted as percentage of controls.

Figure 6.

A, B, SOCC activity was examined in JOE OPCs pretreated with Tg in the presence of zero Ca²⁺ medium. After 1 DIV, JOE cells were transiently transfected with a combination of three different siRNA duplexes specific for TRPC1 (siTRPC1) and grown for 2 d in defined culture medium. Ca²⁺ entry experiments were performed after 3 and 4 d of siRNA transfection (i.e., 4 and 5 DIV). C, The graphs shows the average amplitude calculated from the responding cells expressed as percentage of change of the emission intensities for each experimental condition. Values are expressed as mean ± SEM of at least four independent experiments (n > 400 cells for each condition). **p < 0.01 versus respective controls.

Inhibition of TRPC1 significantly attenuates proliferation in JOE cells

Proliferation of OPCs is clearly important for normal myelination as well as for remyelination in demyelinating diseases. Our recently published data (Paez et al., 2009a) indicate that golli enhances the proliferative activity of PDGF, a potent mitogen for OPCs (Noble et al., 1988; Raff et al., 1988; Calver et al., 1998).

To investigate the physiological relevance of TRPC1 expression in OPCs, we used an siRNA approach to knock down the expression of TRPC1 channel and measure proliferation and cell cycle time to determine whether TRPC channels are involved in golli-induced OPC proliferation. Twenty four hours after plating, OPCs were transiently transfected with a combination of three different siRNA duplexes specific for TRPC1 (Table 2). Two days later, the medium was changed and the cells were grown in the presence of PDGF (20 ng/ml) for 48 h. Because actively proliferating cells duplicate their DNA content, we labeled proliferating OPCs from control and JOE mice with the thymidine analog BrdU. Twenty four hour pulses of 10 μm BrdU were performed at 3 and 4 DIV (Fig. 7A). After each BrdU pulse, proliferating progenitors were identified by double immunofluorescence for BrdU and NG2, and the relative number of NG2⁺/BrdU⁺ cells was quantified in each cell population (Fig. 7B). In agreement with our previous findings (Paez et al., 2009a), at 4 and 5 DIV, the average number of proliferating cells in the JOE population was significantly higher than that of the control group (Fig. 7C). However, after TRPC1 knockdown, the average percentage of proliferating OPCs in the golli-overexpressing cell population was found to be significant lower compared with nontransfected JOE cells, and additionally no significant differences between JOE and control cells were found (Fig. 7C).

Figure 7.

A, Twenty four hours after plating, pure OPC cultures from JOE mice were transiently transfected with a combination of three different siRNA duplexes (siTRPC1) specific for TRPC1 and grown for 2 DIV in defined culture medium plus PDGF (10 ng/ml) and bFGF (10 ng/ml). Then the medium was changed and the cells were grown in the presence of PDGF (20 ng/ml) for another 2 d (i.e., 4 and 5 DIV). Twenty-four-hour pulses of 10 μm BrdU were begun at 3 and 4 DIV. After each BrdU pulse, cells were fixed and immunostained with anti-BrdU and anti-NG2 antibodies. B, Microphotographs showing NG2⁺/BrdU⁺ cells at 4 and 5 DIV. Green, NG2 immunostaining; red, BrdU immunostaining. Scale bar, 80 μm. C, The percentage of NG2⁺/BrdU⁺ cells in each condition was compared with respective controls. D, The percentage of phospho-Histone H3⁺ cells in each experimental condition was measured as described in Materials and Methods. Values are expressed as mean ± SEM of four independent experiments. **p < 0.01, ***p < 0.001 versus respective controls.

The BrdU cell proliferation results in the JOE OPC population were confirmed using an anti-phospho-Histone-H3 (Ser28) antibody as a marker of mitotic cells. Phosphorylation of Histone H3 at Ser10 and Ser28 is very important for chromosome condensation and segregation during mitosis (Wei et al., 1999). The phosphorylation of Histone H3 at Ser28 occurs in chromosomes predominantly during early mitosis and coincides with the initiation of mitotic chromosome condensation in various mammalian cell lines (Goto et al., 1999). At 4 and 5 DIV, in the presence of 20 ng/ml PDGF, there were more H3⁺ cells in the golli-overexpressing cell population than in the control cells (Fig. 7D), but 24 and 48 h after TRPC1 knockdown (4 and 5 DIV) no significant differences between groups were found (Fig. 7D).

Additionally, we measured the Tc and the percentage of mitotic OPCs of the JOE and control cells by performing time-lapse imaging in mixed glial cultures using GFP-labeled OPCs as we have done previously (Paez et al., 2009a). We imaged individual clones of GFP-labeled OPCs (OPC–GFP) in the presence of an astrocyte monolayer, a known source of growth factors such as PDGF and bFGF (Hinks and Franklin, 1999). These experiments were performed for a period of 48 h at 4 and 6 DIV before the shake off (Fig. 8A). In these time-lapse experiments, the role of TRPC1 on cell proliferation was assessed by calculating the average Tc in different OPC–GFP clones using an anti-TRPC antibody to block the functioning of TRPC1 channels. Cell cycle time was defined as the period between the cytokinesis at which a cell was generated and when the cell divided, giving birth to two daughter cells. The time at which cytokinesis occurred was considered to be the first appearance of a distinct border between two daughter cells in a video microscopic image sequence (see Materials and Methods). Examples of cytokinetic events in GFP-labeled OPCs from JOE mice grown for 4 d on an astrocyte monolayer are shown in Figure 8B. At 4 DIV, control OPCs showed a Tc of ∼24 h, whereas the JOE cells showed a Tc of ∼18 h. In contrast, the proliferation rate of JOE OPCs was increased to a Tc ∼31 h at 4 DIV and ∼34 h at 6 DIV in the presence of TRPC1 antibody used to block TRPC1-mediated Ca²⁺ influx (Fig. 8C). Furthermore, as shown in Figure 8D, the percentage of cycling OPCs during the first 12 h of the time-lapse experiment was significantly higher in the JOE cell population, suggesting that the fraction of proliferating OPCs is increased by golli overexpression.

Figure 8.

A, Mixed glial cultures were incubated in a chamber with 5% CO₂ at 37°C, which was placed on the stage of a spinning disc confocal inverted microscope. GFP-labeled OPC clones were imaged with a specific GFP filter at 6 min intervals for a period of 48 h beginning at 4 and 6 DIV before the shake off. B, Time-lapse series of OPC–GFP clones from JOE mice grown for 4 d on an astrocyte monolayer (4 DIV) and incubated with an antibody against TRPC1 (TRPC1 Ab) (10 μg/ml). Yellow arrowheads designate cytokinesis events. Tracking of cells between birth cytokinesis and division cytokinesis was noted with a yellow asterisk near the cell, which was generated from frame to frame. Each frame represents a single section of a time-lapse video sequence. Time is denoted in hours in the bottom right corner. Scale bar, 60 μm. C, D, Estimated Tcs and percentage of mitotic OPCs were determined as described in Materials and Methods for each experimental condition. Values are expressed as mean ± SEM of four independent experiments. *p < 0.05, **p < 0.01 versus control.

These results indicated, by several independent measures, that golli promoted OPC proliferation in the presence of growth factors, i.e., an increase in the number of BrdU⁺ cells, a decrease in the cell cycle time, and an increase in the number of cells in S phase. This effect disappeared when TRPC1 expression was suppressed by specific siRNAs or when the channel was blocked by specific antibodies, indicating that golli influences OPC proliferation by modulating Ca²⁺ influx through TRPC1. Additionally, these experiments are the first to demonstrate that extracellular Ca²⁺ uptake through TRPC1 is an important component in the mechanism of OPC proliferation.

Golli colocalizes with TRPC1 Ca²⁺ channels in OPC processes

Using digital confocal analysis, we found TRPC1 expression throughout the cell body and processes of OPCs (Fig. 9A). A number of circular “hotspots” were found in the cell body and along OPC processes. TRPC1 expression was highly varied such that certain sites along the processes were found to possess markedly higher levels of TRPC1 than surrounding regions (Fig. 9A). We then examined whether these patches of TRPC1 expression along OPC processes were associated with golli. Double immunofluorescence for golli and TRPC1 revealed that cell regions with TRPC1 accumulations tended to colocalize with high levels of golli expression along OPC processes (Fig. 9B). To examine whether the sites of high-density golli protein distribution were related to the sites of high SOC influx kinetics, we performed correlation experiments between golli–GFP expression and Ca²⁺ levels in OPC processes. We stimulated OPCs overexpressing golli–GFP with thapsigargin in the presence of zero Ca²⁺ to deplete intracellular stores and then reexposed to a Ca²⁺-containing medium to trigger Ca²⁺ influx via SOCCs. The kinetics of the resulting Ca²⁺ influx was measured in serial z-sections along cell processes. The pattern of golli–GFP fluorescence was then imaged, and the intensities were measured within the same serial sections of the cell in which the Ca²⁺ influx kinetics were measured. The resultant profile was then compared with the profile of Ca²⁺ influx kinetics using correlation analysis (see Materials and Methods). In the OPC processes, the Pearson's Rr = 0.912 ± 0.034 (n = 25), indicating that there is a significant overlap of golli–GFP and SOC influx sites in OPCs processes. A plot of the local Ca²⁺ amplitudes against the length of the process, together with the intensity of golli–GFP measured in the same cellular sites, showed that the regions with high-intensity golli–GFP corresponded closely with the regions of the process in which the local peak Ca²⁺ amplitudes were highest (Fig. 9C,D). These studies indicated that golli is probably associated with TRPC1 at discrete cellular regions. Such high-density golli and TRPC1 expression at these sites would be expected to participate in the regulation of Ca²⁺ uptake in these cellular microdomains.

Figure 9.

A, Confocal microscopy analysis of JOE OPCs reveal high TRPC1 expression in certain sites along the processes and soma of the cells. Scale bar, 25 μm. B, JOE OPCs were immunostained for golli (red) and TRPC1 (green). Merged images show areas of obvious colocalization and/or juxtaposition (arrows). Note that golli fluorescence is predominantly concentrated in multiple high-intensity patches along the processes, and TRPC1 is found closely associated with these sites of high golli concentration (arrows). Scale bar, 15 μm. C, Time-lapse confocal microscopy of OPC process overexpressing golli–GFP during SOC influx. Peaks in local amplitude of Ca²⁺ uptake were found at several sites along the process. The close interrelationship between golli and Ca²⁺ influx sites can be clearly seen, with golli–GFP being closely surrounded by high levels of fura-2 fluorescence (arrows). D, Correlation analysis of the patterns of local peak Ca²⁺ amplitudes and golli–GFP in the same OPC process shown in C. Local peak Ca²⁺ amplitudes after reexposure to Ca²⁺-containing medium (120 s) (red line) along the process are shown compared with golli–GFP fluorescence measurement (green line) in the same cellular sections.

Discussion

Golli proteins promote Ca²⁺ influx after Ca²⁺-store mobilization

In many cells, including OLs, an important mechanism for stimulating Ca²⁺ influx is through SOCCs, located in the plasma membrane (Simpson and Russell, 1997). The SOCCs are stimulated to take up Ca²⁺ from increases in internal Ca²⁺ concentrations through depletion of the internal stores, primarily from the ER. Release occurs via inositol 1,4,5-triphosphate (IP₃) or ryanodine receptors, and Ca²⁺ is subsequently re-sequestered into stores via sarcoplasmic–endoplasmic reticulum Ca²⁺ ATPases (SERCAs) (Berridge, 1993; Simpson et al., 1995). In many cell types, SERCA inhibition leads to elevation of cytosolic Ca²⁺ secondary to leakage of Ca²⁺ from stores. Thapsigargin is used to inhibit SERCA pumps in cultured cells, and it has been demonstrated that SERCA-mediated store depletion activates store-operated Ca²⁺ entry in glial cells (Simpson and Russell, 1997). The results presented here show that inhibition of SERCA pumps by thapsigargin or ryanodine receptor activation by caffeine evokes significant Ca²⁺ release from intracellular stores and Ca²⁺ entry after store depletion in OPCs. Our data clearly indicated that, under these pharmacological treatments, golli promoted a significant activation of SOCCs and Ca²⁺ uptake both in vitro (cultured OPCs) and in situ (slice preparation). Importantly, this increased Ca²⁺ influx in JOE cells was totally abolished by the specific SOCC inhibitors 2-APB and MRS-1845, confirming that this influx is carried by SOCCs.

TRPC1 mediates golli effect on store-operated Ca²⁺ entry

In addition to entry through voltage-gated calcium channels and release from intracellular stores, members of the TRP channel superfamily present an alternative mechanism for Ca²⁺ entry and regulate multiple processes in the developing and mature nervous system. TRP channels are a family of 28 nonselective cation channels, and all except TRPM4 and TRPM5 display varying degrees of calcium permeability (Nilius et al., 2007). Members of the TRPC family are involved in SOC entry (Zitt et al., 2002; Smyth et al., 2006; Liao et al., 2007), which is thought to be an essential component in establishing intracellular Ca²⁺ concentrations (Woods et al., 1986; Foskett and Wong, 1994). The expression of TRPC1 and TRPC3 proteins have been reported in OLs (Fusco et al., 2004; Weerth et al., 2007), and we have found by RT-PCR that TRPC1–TRPC6 are expressed in cultured OPCs.

In the mature nervous system, TRP channels play important roles in the processing of sensory information (Clapham, 2003) and fear-related learning and memory (Riccio et al., 2009), and defects in particular channels underlie models of neurodegeneration such as cerebellar ataxia (Becker et al., 2009). During early development, members of the TRP channel families modulate neural progenitor proliferation (Fiorio Pla et al., 2005), whereas at later stages specific members of the TRPC family have been shown to both positively and negatively regulate neurite extension (Greka et al., 2003; Wu et al., 2008), likely because of the activation of Ca²⁺-dependent processes (Gomez and Zheng, 2006).

In this study, we demonstrated that a large portion of SOC entry in cultured OPCs is likely mediated through TRPC1-containing channels in the plasma membrane. We demonstrated that Ca²⁺ entry via TRPC1 plays an important role in oligodendrocyte Ca²⁺ dynamics. We found that, after thapsigargin treatment, in the presence of zero Ca²⁺ reexposure to a Ca²⁺-containing medium caused an increase in cytoplasmic Ca²⁺, which was reduced by ∼80% when TRPC1 was blocked by specific antibodies or siRNA expression. This may indicate that Ca²⁺ channels containing TRPC1 are dynamically refilling the intracellular stores during transient cytoplasmic Ca²⁺ increases in OPCs. Conversely, when TRPC1 was blocked in cells overexpressing golli, a significant reduction in Ca²⁺ uptake occurred after store depletion, suggesting an involvement of TRPC1 channels in the SOC influx induced by golli proteins. Together, the data presented here provide the first evidence for an involvement of a channel belonging to the TRPC family in store-operated Ca²⁺ influx in oligodendroglial cells.

A previous study has shown that TRPC1 can heterotetramerize with other TRPCs expressed during brain development to form complexes containing TRPC1/TRPC3/TRPC6 and TRPC1/TRPC4/TRPC5, which give rise to channels with different properties (Strubing et al., 2003). We used RT-PCR to detect the presence of TRPC channels other than TRPC1 in primary culture of OPCs and found the presence of mRNAs for TRPC1, TRPC2, TRPC3, TRPC4, TRPC5, and TRPC6. Interestingly, no significant differences in the TRPC profiles were observed between control and golli-overexpressing OPCs. We found an 80% reduction in OPC SOC uptake when TRPC1 was knocked down, indicating that TRPC1 is the most important SOCC isoform in OPCs, but our results do not exclude a possible involvement of other TRPC homologs during store-operated Ca²⁺ uptake in OPCs. Future studies will address whether other TRPC homologs are involved in OPC Ca²⁺ dynamics.

Store-operated Ca²⁺ uptake correlates with sites of high golli concentrations in OPC processes

Simpson et al. (1997) have been able to localize microdomains of Ca²⁺ activity within OL processes. They have identified microdomains within OPC processes, indicating the infiltration of the ER into the OPC processes. In many instances, the ER lies in very close proximity to the plasma membrane of the processes in which Ca²⁺ channels are located. Thus, components of the Ca²⁺ release mechanism from internal stores can be in close proximity to SOCCs located on the plasma membrane surface. Such a structural arrangement can facilitate the Ca²⁺ waves along processes as well as initiate local Ca²⁺ responses in the processes. Recently, Weerth et al. (2007) have been able to identify signaling microdomains associated with lipid raft-like membrane specializations in glial cells. They also identified putative SOCC components and IP₃R2 receptors, suggesting close interaction between Ca²⁺ signaling sites on the ER with those on the plasma membrane. Thus, Ca²⁺ signaling components are located within OPC processes, and they may play an important role in process elongation, retraction, and migration.

Using high-resolution spatiotemporal analysis, we showed that SOC influx in OPCs overexpressing golli initiated with different latencies at discrete cellular locations. Specifically, regions of the OL process with elevated golli levels consistently displayed higher-amplitude Ca²⁺ signals than were found in surrounding areas. We hypothesize that golli proteins are needed at wave-amplification sites along OPC processes to regulate the activity of SOCCs located in close apposition to ER. The principal role of high golli levels may be to maintain locally high levels of Ca²⁺ within the ER and thereby contribute to elevated Ca²⁺ influx at wave-amplification sites.

A recent independent study has shown binding of golli proteins to STIM1, the master regulator of SOCCs (Walsh et al., 2010). Walsh and colleagues propose that golli functions to regulate SOC influx via a direct interaction with STIM1, but the exact molecular mechanism underlying this interaction has yet to be defined.

Golli modulation of TRPC1 affects OPC proliferation

Proliferation of OPCs is clearly important for normal myelination as well as for remyelination in demyelinating diseases. This study indicates that golli overexpression increases the proliferation rate of OPCs as assessed by several parameters, including a decrease in the cell cycle time. Our results indicated that endogenous golli expression can modulate OPC proliferation through SOCCs. More importantly, this effect disappeared when TRPC1 expression was suppressed by specific siRNAs or blocked by antibodies, indicating a key role for TRPC1 in OPC proliferation.

Jacobs et al. (2009) have shown previously that golli overexpression causes a significant delay in OPC maturation, with accumulation of significantly greater numbers of premyelinating OLs that fail to myelinate axons during the normal myelinating period. Although an increase in proliferating OPCs was not detected in this study, a greater number of OPCs were found in the JOE brain around the second postnatal week, suggesting that increased proliferation in the JOE mice may occur at early developmental stages.

Our recently published data indicate that golli enhances the proliferative activity of PDGF and that PDGF induced a biphasic transient increase in OPC intracellular Ca²⁺ (Paez et al., 2009a). The first phase occurred in the absence of external Ca²⁺ and was completely abolished by thapsigargin pretreatment, indicating that the first phase was attributable to Ca²⁺ release from intracellular stores. The second phase was completely abolished by store-operated Ca²⁺ channel inhibitors, indicating that these channels were involved in maintaining the elevated intracellular Ca²⁺ concentration characteristic of this phase. The store-operated Ca²⁺ influx was higher in JOE cells, suggesting that the mechanism responsible for the effect of golli on OPC proliferation was mediated through an increase in store-operated Ca²⁺ influx. In this paper, we identified the channel responsible for this Ca²⁺ uptake increase in golli-overexpressing cells, and we revealed for the first time that extracellular Ca²⁺ uptake through TRPC1 is an important component in the mechanism of OPC proliferation. Recently, Cuddon et al. (2008) reported that PDGF activates store-operated Ca²⁺ entry in neuronal precursor cells, a finding that supports our data indicating that SOCCs are essential for neural cell division. Furthermore, several studies have shown that TRPC1 plays a role in Ca²⁺ influx and smooth muscle cell proliferation (Golovina et al., 2001; Sweeney et al., 2002a,b) and mediates Ca²⁺ influx activated by bFGF (FGF-2) in endothelial cells (Antoniotti et al., 2002).

We have found that golli regulates different aspects of OPC function through distinct routes of Ca²⁺ entry. Golli regulation of SOCCs influences OPC proliferation, and its modulation of VOCCs influences OPC process extension/migration (Paez et al., 2007, 2009b). How can these different routes of Ca²⁺ influx modulates different aspects of OPC development? The answer must lie in the pattern of Ca²⁺ signals in time and space evoked by the activation of different Ca²⁺ channels. Ca²⁺-sensitive sites that evoke process outgrowth and migration are located close to VOCCs (Bolsover, 2005), but TRPC1 activation, as occurs during store depletion in OPCs, will cause a significant increase of Ca²⁺ concentration within the ER activating cell proliferation.

In summary, the findings described in this work suggest a key role for golli proteins in the regulation of OPC Ca²⁺ homeostasis. This involvement in Ca²⁺ signaling in the myelin forming cells of the CNS indicates that golli proteins can have a significant effect on the ability of OPCs to respond to remyelination cues in clinical situations resulting in demyelination. As such, golli proteins represent important molecules that may be of direct relevance to demyelinating diseases.