Cloning, expression, purification, crystallization and preliminary crystallographic analysis of NifH2 from Methanocaldococcus jannaschii

NifH2, a homologue of nitrogenase reductase from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized. X-ray diffraction data were collected to 2.85 Å resolution and the crystals belonged to space group P2.

Abstract

Nitrogenases are protein complexes that are only found in Azotobacter and are required for biological nitrogen fixation. They are made up of a nitrogenase, which is a NifD₂/NifK₂ heterotetramer, and a nitrogenase reductase, which is a homodimer of NifH. Many homologues of nitrogenase have been found in various non-nitrogen-fixing prokaryotes; in particular, they are found in all known methanogens. This indicates that these homologues may play a role in methane production. Here, the cloning of NifH2, a homologue of the NifH nitrogenase component, from Methanocaldococcus jannaschii (MjNifH2) and its expression in Escherichia coli with a polyhistidine tag, purification and crystallization are described. MjNifH2 crystals were obtained by the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 2.85 Å. The crystals belonged to space group P2, with unit-cell parameters a = 64.01, b = 94.38, c = 98.08 Å, α = γ = 90, β = 98.85°.

1. Introduction

Nitrogen is an essential element for life. Only fixed nitrogen can be used in metabolism and the major pathways of nitrogen fixation are biological fixation and fixation during lightning discharge. Biologically fixed nitrogen production currently far exceeds production owing to lightning discharge (Falkowski, 1997 ▶; Raymond et al., 2004 ▶).

All nitrogen-fixing organisms that have been characterized to date are prokaryotes and their capacity for nitrogen fixation is dependent solely on the organism possessing a nitrogenase enzyme system (Simpson & Burris, 1984 ▶). A typical nitrogenase complex is made up of two components: a nitrogenase and a nitrogenase reductase (Staples et al., 2007 ▶). Nitrogenases, which are also known as FeMo proteins, are α₂β₂ heterotetramers of the proteins NifD and NifK (Kim et al., 1993 ▶). They contain a P cluster (an unusual cluster which contains Fe₈S₇) and an active-site cluster (FeMo-co, containing Fe₈S₇MoN), the function of which is to reduce dinitrogen and produce ammonia (Chan et al., 1993 ▶; Tittsworth & Hales, 1993 ▶; Peters et al., 1997 ▶). Nitrogenase reductase, which is also known as the Fe protein, is a homodimer of NifH and has an Fe₄S₄ cluster bound between two subunits (Georgiadis et al., 1992 ▶; Kim & Rees, 1994 ▶). Nitrogen reductase is responsible for transferring electrons to the nitrogenase, allowing the reduction of dinitrogen to ammonia.

Recently, many atypical sequences related to nifH and nifD/nifK genes have been uncovered in various non-nitrogen-fixing organisms by analysis of their published complete genomes (Raymond et al., 2004 ▶; Staples et al., 2007 ▶). These genes were named nflH and nflD (nfl for Nif-like) and the proteins that they encode were named NflH and NflD, respectively (Staples et al., 2007 ▶). These proteins, which are classified as group VI nitrogenases, have been discovered in all known methanogens (Raymond et al., 2004 ▶). Nitrogen fixation is not attributed to these proteins and their biological function remains unknown.

Photosynthesis is one of the most important biochemical processes on earth. In this process, solar energy is converted to chemical energy by plants and phototrophs. Interestingly, homologues of Nifs have been linked to two photosynthetic processes (Burke et al., 1993 ▶; Fujita et al., 1993 ▶; Fujita & Bauer, 2000 ▶). The transformation of protochlorophyllide to chlorophyllide by reduction of ring D is accomplished using the enzymatic complex BchLNB and transformation of chloro­phyllide to bacteriochlorophyllide by reduction of ring B is accomplished using a system containing BchXYZ (Fujita & Bauer, 2000 ▶). Both BchLNB and BchXYZ are homologues of NifHDK: BchL and BchX are homologues of NifH, while BchNB and BchYZ are homologues of NifDK.

MjNifH2 (coded by gene MJ0685) is one of two homologues of NifH found in Methanocaldococcus jannaschii (the other is NflH, which is coded by gene MJ0879). It has only 24% sequence identity to NflH, but they share a conserved domain. Evolutionary research has shown that these nitrogenase homologues may be ancestors of nitrogenase. These homologous proteins are thought to have first occurred in archaebacteria before being transferred into the bacterial domain (Raymond et al., 2004 ▶).

Solving the structure of MjNifH2 would help us to better understand the process of methane production. In addition, comparison of the structures of NifH2 from M. jannaschii, NifH from Azotobacter and BchL and BchX from phototrophs may lead to elucidation of the evolutionary relationship between these homologous proteins.

2. Materials and methods

2.1. Strains and plasmids

The MJ0685 coding sequence was PCR-amplified by the use of Ex Taq (TaKaRa) and the primer pair (5′ to 3′) MJ0685/F (CGCGGA TCCCATATGATTGCTGTGAGTGGAAAAG; BamHI restriction site shown in bold) and MJ0685/R (CCGCTCGAGTTAAAATTTTTTATTAATTATCTTCTCAGC; XhoI restriction site shown in bold). The amplified DNA was digested with BamHI and XhoI and cloned into pET28a (Novagen) to obtain the plasmid pET28aMjNifH2.

2.2. Protein expression and purification

Escherichia coli BL21 (DE3) (Stratagene) was used as the expression host. The recombinant plasmid was transformed into E. coli BL21 (DE3) cells. The cells were first cultured in Luria–Bertani medium containing 100 µg ml⁻¹ kanamycin at 310 K until an OD₆₀₀ of 0.8 was achieved. To overexpress the protein, isopropyl β-d-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM in the medium. Cells were then cultured for a further 4 h at the same temperature.

The cells were harvested by centrifugation, resuspended in buffer A (20 mM Tris–HCl, 500 mM NaCl pH 8.0) and lysed by sonication. The supernatant containing MjNifH2 was separated from the cell lysate by centrifugation at 12 000g for 30 min. The supernatant was then loaded onto a nickel-chelating column (GE Healthcare) pre-equilibrated with buffer A. Ten column volumes of buffer A were used to wash the column and ten column volumes of buffer A con­taining 50 mM imidazole were then used to elute nonspecifically bound proteins. Finally, MjNifH2 was eluted using buffer A con­taining 400 mM imidazole.

The eluted MjNifH2 solution was concentrated by ultrafiltration. Upon concentration, the NifH2 solution exhibited a brown colour, indicating the presence of Fe–S cluster-containing proteins. The colour disappeared after the addition of 10 mM β-mercaptoethanol to the protein solution. The concentrated MjNifH2 solution was then loaded onto a Superdex 200 16/60 column (GE Healthcare) pre-equilibrated with buffer A containing 10 mM β-mercaptoethanol. The fraction containing the 30.3 kDa monomer of MjNifH2 was collected, concentrated and stored in 2 mM Tris–HCl, 50 mM NaCl pH 8.0. SDS–PAGE showed that the purity of NifH2 was greater than 95% (Fig. 1 ▶). The concentration of MjNifH2 was 20 mg ml⁻¹ as measured using a BCA Protein Assay Kit (Pierce).

Figure 1.

SDS–PAGE of MjNifH2. Lane 1, purified MjNifH2 (after β-mercaptoethanol treatment). Lane 2, molecular-weight markers (kDa).

2.3. Crystallization and data collection

Crystallization experiments were performed using the hanging-drop vapour-diffusion method. ProPlex (Molecular Dimensions) was used to screen initial crystallization conditions. Microcrystals were observed in condition 2.2 of the ProPlex kit [0.1 M sodium citrate, 8%(w/v) PEG 8000 pH 5.0]. Further optimization of the crystallization conditions was carried out using 1 µl protein solution mixed with 1 µl reservoir solution (0.1 M sodium citrate, 8% PEG 8000 pH 5.0) and equilibrated against 150 µl reservoir solution. After 10 d, single crystals which showed good diffraction properties appeared at a constant temperature of 277 K (Fig. 2 ▶). The largest crystal obtained was approximately 0.2 × 0.2 × 0.3 mm in size and was colourless.

Figure 2.

Photomicrograph of crystals of MjNifH2 formed using the hanging-drop method with 0.1 M sodium citrate, 8% PEG 8000 pH 5.0.

Crystals were mounted on a CrystalCap with a cryoprotectant consisting of 0.1 M sodium citrate pH 5.0, 8% PEG 8000, 20% glycerol and then directly flash-cooled at 100 K in a stream of nitrogen gas. X-ray diffraction data were collected using an MX-225 CCD image-plate detector (MAR Research) on BL17U of the SSRF (Shanghai Synchrotron Radiation Facility; Fig. 3 ▶). The oscillation angle was 1° per image and the exposure time was 2 s. A complete diffraction data set consisting of 180 images was collected using one crystal at a crystal-to-detector distance of 200 mm.

Figure 3.

Image of the diffraction to highest resolution.

Diffraction data were processed using HKL-2000 (Otwinowski & Minor, 1997 ▶). Data-collection and processing statistics are listed in Table 1 ▶.

Table 1. Statistics of data collection and reduction.

Values in parentheses are for the highest resolution shell.

No. of crystals	1
Wavelength (Å)	1.0
Temperature (K)	100.0
Rotation range per frame (°)	1
Total rotation range (°)	180
Exposure per frame (s)	2
Crystal-to-detector distance (mm)	200
Mosaicity (°)	0.89
Multiplicity	3.6
Space group	P2
Unit-cell parameters (Å, °)	a = 64.01, b = 94.38, c = 98.08, β = 98.85
Molecules per asymmetric unit	4
Resolution limits (Å)	40–2.85 (2.90–2.85)
Observations	93684
Independent reflections	26743
Completeness† (%)	93.4 (98.6)
〈I/σ(I)〉	14.7 (2.61)
Rmerge‡	0.083 (0.354)

^†The completeness is the ratio of the number of reflections to the number of possible reflections.

^‡ R _merge = , where I _i(hkl) is the observed intensity of reflection hkl and 〈I(hkl)〉 is the mean intensity of reflection hkl.

3. Results and discussion

Previous research has shown that NifHs form a homodimer in solution with the iron ion located between two subunits (Kim & Rees, 1994 ▶; Lawson & Smith, 2002 ▶). Superdex 200 16/60 chromatography indicated that the MjNifH2 protein was present as a mixture of two oligomeric states in solution, with both a dimeric and a monomeric state occurring. The chromatogram showed that these two forms were not fully separable under the chromatographic conditions used. SDS–PAGE and mass-spectrometric analysis confirmed the presence of two oligomeric states of the MjNifH2 protein. After 10 mM β-­mercaptoethanol was added to the protein solution, the dimer form disappeared and all protein was present as the monomer. This homogeneous protein was used for crystallization.

MjNifH2 crystallized in space group P2, with unit-cell parameters a = 64.01, b = 94.38, c = 98.08 Å, α = γ = 90, β = 98.85°. The X-ray data were alternatively scaled in space group P2₁, but analysis of the systematic absences showed that about two-thirds of the intensities of systematic absences were near zero, while the other third were nonzero. Therefore, it cannot be determined whether the crystal belongs to space group P2₁ or P2. Matthews analysis suggested that there were four molecules per asymmetric unit (Matthews coefficient 2.44 ų Da⁻¹, solvent content 49.6%). Analysis of a self-rotation function shows the same result. This data analysis laid the foundation for a full structure solution, which will be presented in a subsequent report.